Synergistic cooperation between the β-catenin and SF1 regulates progesterone synthesis in laying hen ovarian granulosa cells

Abstract

The development of ovarian follicles in poultry is a key factor affecting the performance of egg production. Ovarian follicle development is regulated via the Wnt/β-catenin signaling pathway, and β-catenin, encoded by CTNNB1, is a core component of this pathway. In this study, using ovary GCs from laying hens, we investigated the regulatory role of CTNNB1 in steroid synthesis. We found that CTNNB1 significantly regulates the expression of StAR and CYP11A1 (key genes related to progesterone synthesis) and the secretion of progesterone (P4). Furthermore, simultaneous overexpression of CTNNB1 and SF1 resulted in significantly higher levels of CYP11A1 and secretion of P4 than in cells overexpressing CTNNB1 or SF1 alone. We also found that in GCs overexpressing SF1, levels of CYP11A1 and secreted P4 were significantly greater than in controls. Silencing of CYP11A1 resulted in the inhibition of P4 secretion while overexpression of SF1 in CYP11A1-silenced cells restored P4 secretion to normal levels. Together, these results indicate that synergistic cooperation between the β-catenin and SF1 regulates progesterone synthesis in laying hen ovarian hierarchical granulosa cells to promote CYP11A1 expression.

Keywords:

• Laying hens
• β-catenin
• granulosa cells
• SF1
• CYP11A1
• progesterone

Introduction

Laying performance in hens, a very important economic trait, is affected by myriad factors, but depends mainly on ovarian function and follicle development.¹ A follicle, the basic functional unit of the ovary, is composed of thecal cells, follicular granulosa cells (GCs), and oocytes.² The differentiation and proliferation of GCs and their synthesis of follicle steroid hormones, play an important role in follicle recruitment, selection, growth, and maturation.³ Earlier studies have reported several factors regulating GC proliferation and differentiation, most of which are related to the Wnt/β-catenin signaling pathway. For example, SMAD4 inhibits granulosa cell apoptosis;⁴ bone morphogenetic protein-15 promotes follicular selection in hen granulosa cells;⁵ PITX2 regulates granulosa cell proliferation and steroid hormone production in dairy goats.⁶ β-catenin, encoded by CTNNB1, is a protein in the classical Wnt signaling pathway; it can activate the transcription of target genes related to cell proliferation and hormone secretion, and its abnormal activation may lead to the formation of tumors.^7–9 Early studies in mice showed that β-catenin binds to the transcription factor TCF/LEF activating the expression of corresponding target genes and promoting the production of steroid hormones, thereby regulating the development of ovarian follicles.¹⁰ Castanon et al. report, that in bovines, FSH regulates CTNNB1 expression and induces secretion of steroid hormones from granulosa cells thus promoting ovarian follicle development,¹¹ and Bae et al. report that CTNNB1 can be used as an estrogen-inducing gene to influence the development of fallopian tubes in chicks.¹² Thus, β-catenin plays a crucial role in follicular development by participating in the synthesis of steroid hormones.

The hypothalamic-pituitary-ovarian axis plays a critical part in animal reproduction by regulating the synthesis of steroid hormones.¹³ During ovarian growth and maturation, follicular granulosa cells undergo a series of physiological and biochemical changes, including the expression of gonadotropin receptors and the synthesis of steroids.¹⁴ The production of steroid hormones is regulated by several factors, including genes related to steroid production, hormones, and various other regulatory factors.^14,15 Progesterone receptor is located in the nucleus of GCs and binds specifically to hormones to form hormone receptor complexes, which are involved in follicle growth and development, maturation, and ovulation, as well as steroid synthesis.¹⁶ Steroidogenic acute regulatory protein (StAR), cholesterol side chain cleavage cytochrome P450 (P450scc), and 3β-hydroxysteroid dehydrogenase (3β-HSD) are directly involved in the synthesis of progesterone.^6,16 In addition, several regulatory factors (IGF1, EGF, TGF-β, and SF1) and transcription factors (FOXL2, WT1, AP1, and SP1) regulate the expression of ovarian steroid synthesis genes, as well as hormone secretion, by activating multiple molecular signaling pathways.¹⁶ Among them, steroidogenic factor 1 (SF1, officially designated NR5A1) is an important transcription factor in hormone synthesis; it regulates the transcription of CYP11A1, StAR, and 3β-HSD.¹⁷ SF1 regulates the activity of the CYP11A1 promoter in bezoar somatic cells;¹⁸ PITX2 interacts with SF1 to participate in the WNT pathway and enhance the production of E2 and P4 in GCs of dairy goats;⁶ In rat granulosa cells, SF1 interacts with β-catenin to regulate the expression of CYP19A1.¹⁰

Many of the studies on the regulation of reproduction focus mainly on mammals, there are many fewer reports on the regulation of reproduction in laying hens. To determine the regulatory factors and related signaling pathways that can improve egg production, it is necessary to elucidate the molecular mechanisms of laying performance. We previously reported that CTNNB1, as the target gene of miR-458b-5p, is highly expressed in hen hierarchical follicular granulosa cells,¹⁹ so we speculated that CTNNB1 may regulate the development of hierarchical follicular granulosa cells in laying hens by participating in progesterone synthesis. In this study, we investigated the role of β-catenin and SF1 as regulatory factors of progesterone secretion from follicular hierarchical granulosa cells in laying hens.

Materials and methods

Ethics approval

All animal experiments were approved by the Institutional Animal Protection and Use Ethics Committee of Shandong Agricultural University (SDAUA-2018-018) and conducted in accordance with the "Guidelines for Experimental Animals" of the Ministry of Science and Technology of China.

Sample collection

Three healthy Hyline-brown hens of about 30 weeks of age were randomly selected from a local research farm affiliated with Shandong Agricultural University. Hens were slaughtered via carotid artery bleeding, the abdominal organs were incised with surgical scissors, and all hierarchical follicles (diameters > 12mm, F6-F1) were placed in sterile beakers containing 5% penicillin/streptomycin PBS (HyClone, Logan, UT) to remove residual connective tissue and attached blood filaments. Using forceps, the outer membrane on the follicles was peeled away, follicles were then punctured and the granulosa cell layer was separated by gentle shaking.

Cell culture and transfection

The granulosa cell layer was placed in PBS, washed three times, and then digested by adding 0.25% trypsin (Gibco, Grand Island, NY) and incubating 8-10 min at 37 °C in a 5% CO₂ humidified atmosphere. After digestion, single cells were obtained by passing the suspension through a 200 μm filter. After centrifugation, cells were suspended in M199 complete medium (Gibco) containing 10% fetal bovine serum (Gibco) and 1% penicillin/streptomycin (Solarbio, Beijing, China), aliquoted into 6-well culture plates at a density of 5 × 10⁵ cells/well, and incubated for about 12 hours at 37 °C and 5% CO₂. When the cell density reached more than 70%, cells were transfected (the plasmid and siRNA used for transfection were 2 ng and 8 µL per well); Lipofectamine 2000 (Invitrogen, Carlsbad, CA) was used for the transfection of recombinant expression plasmids and Lipofectamine RNAiMAX (Invitrogen) was used for the transfection of siRNA. Transfections were performed according to the manufacturer’s protocol.

RNA extraction, cDNA synthesis, and quantitative real-time PCR (qRT-PCR)

Total RNA was extracted from GCs using TRIzol reagent (Novizan, Nanjing, China). OD was measured using a spectrophotometer (Thermo, Carlsbad, USA), and RNA purity and concentration were determined by the 260/280 ratio. All samples had an acceptable purity (absorbance ratio from 1.9 to 2.1). cDNA was synthesized by reverse transcription using a HiScrip®II First Strand cDNA Synthesis Kit (Novizan) containing gDNA wiper. The samples were stored frozen at −20 °C until use. ChamQ Universal SYBR qPCR Master Mix (Novizan) was used for qRT-PCR. Primer sequence information is listed in Table 1. The quantitative real-time PCR protocol was as follows: 2xChamQ SYBR qPCR Master Mix 10.0 µL, Forward primer (10 µmol/L) 0.4 µL, Reverse primer (10 µmol/L) 0.4 µL, template (cDNA) 1.0 µL, and RNase Free ddH2O 8.2 µL. The reaction conditions were performed as follows: 95 °C for 30 s; 95 °C for 10 s and 60 °C for 30 s for 40 cycles; 95 °C for 15 s, 60 °C for 60 s, and 95 °C for 15 s. The relative expression levels of genes were determined by the 2^−ΔΔC_T method.

Table 1. Primer sequences.

Primer name	Primer sequence (5’–3’)	Melting temperature (°C)	Product length (bp)	GenBank number
CTNNB1	F:TCATTGGCAGCAGCAGTCATAT	56.6	253	NM_205081.3
	R: CATTCCTTCATCCAGTGTTTCG	53.7
SF1	F: GCGGGAGGAATAAGTT	47.9	169	NM_205077.2
	R: ATGGCGTGGATGCTGT	54.5
StAR	F:GACAACATGGAGCAGATGGGCGACTGG	66.3	160	NM_204686.3
	R: GCCGGGAGCACCGAACACTCACAA	67.1
CYP11A1	F: ACCGCAACAAGCCCTACG	58.9	238	NM_001001756.2
	R: CACACAGACTCCAAGGCAAAG	56.5
β-actin	F: CACGATGGAGGGGCCGGACTCATC	67.1	241	NM_001101.5
	R: TAAAGACCTCTATGCCAACACAGT	55.4

CTNNB1, catenin beta-1; SF1, nuclear receptor subfamily 5 group A member 1; StAR, steroidogenic acute regulatory; CYP11A1, cytochrome P450 family 11 subfamily A member 1; β-actin, actin-beta.

Plasmids and siRNA

The siRNA and negative control (NC) used in the experiment were designed and synthesized by GenePharma (Shanghai, China). pcDNA3.1 is kept by the laboratory. The recombinant expression plasmids pcDNA3.1-CTNNB1 and pcDNA3.1-SF1 were constructed by Tsingke (Beijing, China). siRNA sequences are listed in Table 2.

Table 2. siRNA sequences.

Name	Sequence (5’–3’)
siRNA-CTNNB1	5′-CCCUAUGAUGGAACAUGAATT-3′
	5′-UUCAUGUUCCAUCAUAGGGTT-3′
siRNA-SF1	5′-GCUCCACUUUCAUAGCACUTT-3′
	5′-AGUGCUAUGAAAGUGGAGCTT-3′
siRNA-CYP11A1	5′-GGCUGACAAAUGUAUCCAATT-3′
	5′-UUGGAUACAUUUGUCAGCCTT-3′
siRNA-NC	5′-UUCUCCGAACGUGUCACGUTT-3′
	5′-ACGUGACACGUUCGGAGAATT-3′

ELISA

GCs were transfected into a 6-well plate for 24 h, and cell supernatant was collected. Concentrations of progesterone (P4) was determined using a chicken P4 ELISA kit (Enzyme-linked Biotechnology, Shanghai, China; Meimian Biotechnology, Jiangsu, China) according to the manufacturer’s instructions (The sensitivity of ELISA Kits of P4 was tolerance within batch and tolerance between batches of CV < 10% and there was no cross-reactivity with ELISA kit). Absorbance (OD) was measured at 450 nm using the Molecular Devices SpectraMax i3x Multi-Mode Microplate Detection System. The concentration of P4 in the samples is then determined by comparing the OD of the samples to the standard curve.

Statistical analysis

All data were statistically analyzed using SPSS version 22.0 and are presented as the means ± standard deviation. The two groups were compared by t-test, and the multiple groups were compared by one-way analysis of variance (ANOVA). Multiple comparisons were made using the Duncan’s test. Statistical significance is defined as P ≤ 0.05. GraphPad Prism 8.0 software was used for the visualization of all data.

Results

β-catenin regulates progesterone secretion through hierarchical follicular granulosa cells

Figure 1a illustrates, as determined by qRT-PCR, the increased expression of CTNNB1 in hierarchical follicular granulosa cells transfected with pcDNA3.1-CTNNB1 (P < 0.01), and Figure 1b illustrates the silencing efficiency of CTNNB1 in cells transfected with siRNA-CTNNB1 (P < 0.01). In cells overexpressing CTNNB1, levels of StAR and CYP11A1 (genes related to progesterone) were significantly increased over empty vector control, and in cells under-expressing CTNNB1, levels of StAR and CYP11A1 were significantly decreased over siRNA-NC control (P < 0.01 and P < 0.05 respectively; Figure 1c–f). ELISA results showed that levels of P4 was significantly increased after transfection with pcDNA3.1-CTNNB1 (P < 0.05; Figure 1g), and significantly decreased after transfection with siRNA-CTNNB1 (P < 0.01; Figure 1h). These results suggest that CTNNB1 regulates the synthesis and secretion of progesterone in GCs.

Figure 1. β-catenin promotes the secretion of progesterone in GCs. (a) Relative level of CTNNB1 after transfection with pcDNA3.1-CTNNB1. (b) Relative expression of CTNNB1 mRNA after transfection with siRNA-CTNNB1. (c) Relative expression of StAR after transfection with pcDNA3.1-CTNNB1. (d) Relative expression of StAR after transfection with siRNA-CTNNB1. (e) Relative expression of CYP11A1 after transfection with pcDNA3.1-CTNNB1. (f) Relative expression of CYP11A1 after transfection with siRNA-CTNNB1. (g) Levels of P4 after transfection with pcDNA3.1-CTNNB1. (h) Levels of P4 after transfection with siRNA-CTNNB1. Results are presented as means ± SE; n = 3; * P < 0.05; ** P < 0.01.

β-catenin and SF1 regulate progesterone secretion in hierarchical follicular granulosa cells

Figure 2a illustrates the transfection efficiency of pcDNA3.1-SF1 into hierarchical follicular granulosa cells (P < 0.01), the level of SF1 was significantly increased over cells transfected with empty vector; and Figure 2b illustrates the silencing efficiency of SF1 after transfection of with three different siRNAs-SF1 (P < 0.05). We next co-overexpressed CTNNB1 and SF1 and quantified the levels of CYP11A1 and the secretion of P4. By qPCR, simultaneous overexpression of CTNNB1 and SF1 resulted in significantly higher levels of CYP11A1 over controls (P < 0.05; Figure 2c) and, by ELISA, significantly higher levels of secreted P4 (P < 0.05; Figure 2d). Cells were then cotransfected with pcDNA3.1-CTNNB1 and siRNA3-SF1, and Figure 2e shows the transfection efficiency (P < 0.01). In SF1-silenced cells overexpressing CTNNB1, levels of CYP11A1 were significantly decreased over controls (P < 0.01; Figure 2f), and the levels of secreted P4 returned to normal (P > 0.05; Figure 2g).

Figure 2. β-catenin and SF1 co-promote the secretion of progesterone in GCs. (a) Relative expression of SF1 after transfection with pcDNA3.1-SF1 cells. (b) Relative expression of SF1 after transfection of with three different siRNAs-SF1. (c) Relative expression of CYP11A1 after cotransfection with pcDNA3.1-CTNNB1 and pcDNA3.1-SF1. (d) Levels of secreted P4, measured by ELISA, after cotransfection with pcDNA3.1-CTNNB1 and pcDNA3.1-SF1. (e) Relative expression of CTNNB1 and SF1 after cotransfection with pcDNA3.1-CTNNB1 and siRNA3-SF1. (f) Relative expression of CYP11A1 after cotransfection with pcDNA3.1-CTNNB1 and siRNA3-SF1. (g) Level of secreted P4 after cotransfection with pcDNA3.1-CTNNB1 and siRNA3-SF1. Results are presented as means ± SE; n = 3; * P < 0.05; ** P < 0.01; a, b, and c indicate significant different values (P < 0.05).

We therefore speculated that β-catenin promotes the secretion of P4 in hierarchical follicular granulosa cells by synergizing with SF1.

SF1 and CYP11A1 regulate progesterone secretion in hierarchical follicular granulosa cells

Song et al. discussed the regulatory effect of SF1 on CYP11A1 in goats²⁰, so we investigated its potential effect on CYP11A1 in chickens. We first determined the silencing efficiency of three siRNAs-CYP11A1 (P < 0.05; Figure 3a). In cells cotransfected with siRNA2-CYP11A1 and pcDNA3.1-SF1 we found that the level of SF1 was significantly increased, and that of CYP11A1 was significantly decreased (P < 0.01; Figure 3b) over controls. In cells overexpressing pcDNA3.1-SF1 the level of CYP11A1 was significantly increased over control and in SF1 silenced cells, the level of CYP11A1 was significantly decreased compared to control (P < 0.01, Figure 3c, d). By ELISA, cells overexpressing SF1 had significantly higher levels of secreted P4 than control, cells with CYP11A1 silenced had significantly lower levels of secreted P4 than control, and cells that simultaneously overexpressed SF1 and under-expressed CYP11A1 were restored to the normal levels of secreted of P4 (P < 0.01 and P > 0.05; Figure 3e). These results further suggest that SF1 plays a role in regulating progesterone secretion by targeting CYP11A1.

Figure 3. SF1 and CYP11A1 co-promote the secretion of progesterone in GCs. (a) Relative expression of CYP11A1 after transfection of with three different siRNAs-CYP11A1. (b) Relative expression of SF1 and CYP11A1 after cotransfection with pcDNA3.1-SF1 and siRNA2-CYP11A1. (c) Relative expression of CYP11A1 after transfection with pcDNA3.1-SF1. (d) Relative expression of CYP11A1 after transfection with siRNA3-SF1. (e) Level of secreted P4 in cells cotransfected with pcDNA3.1-SF1 and siRNA2-CYP11A1. Results are presented as means ± SE; n = 3; * P < 0.05; ** P < 0.01; a, b, and c indicate significant different values (P < 0.05).

Discussion

Follicle development is the basis of reproduction in female animals.¹⁶ Follicular development is regulated by hormones and growth factors secreted or paracrine by granulosa cells, thecal cells, and oocytes. Granulosa cells not only provide nutrition for oocyte growth but are also the main site for the synthesis of steroid hormones.²¹

β-catenin, encoded by CTNNB1, is a crucial regulator in the Wnt/β-catenin signaling pathway. Numerous studies have demonstrated that the Wnt/β-catenin signaling pathway is involved in the regulation of myriad cell functions, some of which are cell proliferation, differentiation, apoptosis, and steroid synthesis.¹⁹ Bu et al. reported that in goat GCs, steroidogenesis-related gene expression was decreased by siRNA-CTNNB1.⁶ Guo et al. reported that by up-regulating the Wnt/β-catenin pathway in mouse cells, cell proliferation increased as did steroidogenic enzyme expression.²² Abedini et al. found that WNT5A acts as a negative regulator of FSH-stimulated steroid production in bovine granulosa cells.²³ These results demonstrate that the Wnt/β-catenin signaling pathway has many important effects on the regulation of steroids in mammalian follicular granulosa cells, but as its role in laying hen ovarian granulosa cells is not well known, we speculate that CTNNB1 plays a similar role in the GCs of laying hens.

E2, P4, and androgen are the main steroids involved in the regulation of female fertility.²⁰ The synthesis of E2 and P4 is mainly controlled by StAR, CYP11A1, and CYP19A1.²⁴ Steroidogenic acute regulatory protein (StAR) carries free cholesterol in the cytoplasm and transports it to the inner mitochondrial membrane where it is converted into pregnenolone (P5) by cytochrome P450 (CYP11A1). P5 is catalyzed by 3β-HSD to form progesterone, which is finally converted to androstenedione by the steroid 17α-hydroxylase; this synthetic pathway is known as the Δ4 pathway. Androstenedione is catalyzed by 17β-hydroxysteroid dehydrogenases to form testosterone, which is finally catalyzed by aromatase to produce estrogen (E2).^25–27 In mammals, E2 and P4 can be synthesized by GCs, but the main site of P4 synthesis is in the corpus luteum cells after ovulation, in birds, E2 and P4 can also be synthesized by granulosa cells, and the main site of E2 synthesis is TCs, so there are some significant differences in the regulation of steroid synthesis between the two.²⁸

Here, we determined that CTNNB1 promotes the secretion of P4 in hierarchical follicular granulosa cells. Jordan et al. showed that there is a synergistic effect between β-catenin and SF1 in mouse cells, and the two can promote the secretion of P4 in transfected cells.²⁹ We cotransfected hierarchical follicular granulosa cells with pcDNA3.1-CTNNB1 and pcDNA3.1-SF1, and pcDNA3.1-CTNNB1 and siRNA-SF1, and found that CTNNB1 and SF1 together significantly promoted the secretion of P4. GCs overexpressing CTNNB1 and SF1 also had significantly higher levels of secreted P4 than cells overexpressing CTNNB1 and SF1 alone. In SF1 silenced cells overexpression of CTNNB1 still affects the expression of CYP11A1 and the secretion of P4. Therefore, we concluded that CTNNB1 promotes the secretion of P4 in hierarchical follicular granulosa cells in concert with SF1.

The steroidogenic factor SF1 belongs to the nuclear receptor family of transcription factors and has the typical structure of the nuclear receptor family, including a C-terminal ligand-binding domain, an intermediate hinge domain, and an N-terminal DNA-binding domain. SF1 plays a key role in the development and function of steroid organs, it transcribes a range of factors required to regulate steroid hormone biosynthesis and is required for gene expression in the pituitary and reproductive tracts.^30–32 SF1 regulates the transcription of CYP11A1,¹⁷ and a large number of studies have shown that in mammals, the highly conserved sequence (SF1RE: TAGCCTTGA) in the promoter region of CYP11A1 is the binding site of SF1.^33–35 By comparing this sequence in chickens and mammals, we found that there was a difference of one base. As we thought, overexpression of SF1 results in increased secretion of P4, and silencing of CYP11A1 in SF1 overexpressing cells resulted in decreased secretion of P4. Therefore, we speculate that SF1 and CYP11A1 jointly promote the secretion of P4. However, the binding of SF1 to the core promoter region of CYP11A1 needs to be verified in laying hens. Although this study verified the effects of β-catenin, SF1, and CYP11A1 on P4 synthesis, they are by no means the only three variables regulating P4 synthesis, so the specific mechanism of steroid hormone synthesis in laying hens needs to be studied further.

Disclosure statement

We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.

Additional information

Funding

This research was supported by the National Natural Science Foundation of China (31872344), and the Shandong Provincial Key Project for R&D (2022LZGCQY016).