Degradation of potato peels using amylase- and pectinase-producing fungal strain in an electrochemical cell and by-product analysis

ABSTRACT

Degradation of the waste using amylase- and pectinase-producing fungal strains in Microbial fuel cells (MFC) can be a sustainable and economic strategy for solid waste management. An isolate of the fungal strain Aspergillus niger, which showed amylase and pectinase activities was implemented for potato peel waste degradation. MFC was constructed and the highest OCV was observed using KMnO4 in catholyte (1586 ± 63 mV/m3) with anode graphite electrode-coated MWCNT. MFC in fed-batch mode was also performed by adding 10% of the sample every 24 h, and an improved result was obtained. The power density observed with 100-ohm and 1000-ohm external resistors was 119 ± 7 W/m3 and 42 ± 9 W/m3, respectively. From MFC operation at an optimised condition removal rate of COD, ammoniacal-nitrogen, reducing sugar and TSS were 37.69%, 67.72%, 72.64%, and 65.95% respectively. Sugar and byproduct analysis in digested product was done by HPLC, various value-added products were generated from waste sample.

KEYWORDS:

• Potato peel waste
• microbial fuel cell (MFC)
• chemical oxygen demand (COD)
• multi-walled carbon nanotube (MWCNT)
• cyclic voltammetry (CV)

1. Introduction

Potato peel waste presents a significant opportunity for utilisation and valorisation, considering its substantial organic content and abundance in food processing industries (Gómez-García et al. 2021). Although fresh potato consumption is declining in many countries, more potatoes are being processed into value-added products to meet demand, particularly from the fast food and convenience food industries. Using a practical approach can help raise awareness about how organic waste should be managed and can also be used to synthesise various compounds like enzymes, lactic acid, biosorbent, biohydrogen and bioelectricity (Figure 1). These compounds can be used to build connections between industries and share new ideas and technologies (Sawicka, Skiba, and Barbaś 2022).

Figure 1. Logic diagram of bioelectricity generation from solid waste.

Microbial fuel cells (MFCs) are bioelectrochemical that generate electricity by redirecting electrons from microbial oxidation of reduced compounds on the anode to oxidised compounds on the cathode via an external electrical circuit (Godbole et al. 2023). MFCs, which have recently been expanded into a variety of Bio-Electrochemical Systems (BESs), are an exciting and rapidly developing field of science and technology for bioremediation, energy recovery, waste variolisation, green technology development and environmental sustainability (Santoro et al. 2017).

Fungal metabolism plays a multifaceted role in MECs, contributing to organic matter degradation, extracellular electron transfer, biofilm formation, and biocatalyst diversity. By taking advantage of the metabolic capability of fungus in MECs, it is possible to increase the bioelectrochemical systems’ adaptability and efficiency for a range of uses, such as the treatment of waste, the production of bioenergy, and bioremediation (Tiwari et al. 2021). The molecule is oxidised by the metabolism of microorganisms at the anode-releasing electrons and generating H + ion (protons), releasing energy ${\mathrm{C}}_6{\mathrm{H}}_{12}{\mathrm{O}}_6+6{\mathrm{H}}_2\mathrm{O}\to 6\mathrm{C}{\mathrm{O}}_2+24{\mathrm{H}}^{+}+24{\mathrm{e}}^{-}$

At the cathode, oxygen combines with protons that have migrated from the anode to the cathode internally, as well as electrons given from the anode via the external electrical circuit, to generate water: $6{\mathrm{O}}_2+24{\mathrm{H}}^{+}+24{\mathrm{e}}^{-}\to 12\mathrm{H}2\mathrm{O}$

2. Materials and methodology

2.1. Sample collection

During February 2021, potato peels were collected from the Tribhuvan University Girls Hostel, where potatoes were brought from the Kalimati vegetable market. The sample was then ground and kept in a plastic bag and then stored at −20°C for future use.

2.2. Physiochemical analysis of sample

Physical characterisation of the samples, such as pH, moisture content, total suspended solid, volatile suspended solid and ash content, was determined according to AOAC, 2000. Moisture content (% w/w) was determined by overnight drying the biomass in a hot air oven at 105°C and ash content (% w/w) was determined by burning the leaf waste in a muffle furnace at 550°C for 2 h (Maharjan et al. 2023).

Similarly, various chemical parameters, such as total phosphorus, COD, reducing sugar, ammoniacal-nitrogen, trace elements and heavy metals, were also determined. ammoniacal-nitrogen content was determined using the Nessler reagent. A series of concentrations ranging from 0.1 to 2.0 mg/L of ammoniacal nitrogen was used as standard to generate a calibration curve. Then 2 mL of nessler’s reagent was added to each tube and mixed thoroughly. The solution was allowed to stand for 20 min for colour development followed by spectrophotometric analysis at 425 nm. Similarly, chemical oxygen demand was determined by the spectrophotometric method (Maharjan et al. 2023) using hydrogen phthalate as standard. 2 mL of sample and standard was taken in a culture tube and 1.2 mL of digestion solution was mixed thoroughly. Then 2.8 mL of catalyst solution was added to each tube, cap tightly and shaken properly to mix the layers. Then culture tubes were taken to digester within the oven at 150℃ for 2 h. After digestion solutions were allowed to cool down, absorbance was measured at 600 nm using a blank for background correction.

Total reducing sugar was analysed using the dinitro salicylic acid (DNSA) method (Joshi 2018). The glucose was used as standard and samples were measured using a spectrophotometer (Shimadzu) at 540 nm. Then, the amount of phosphorus was determined by observing absorbance at 880 nm after the addition of an acidified ammonium molybdate solution mixture, as described by Altahan, Esposito, and Achterberg (2022). Firstly, the sample was digested on a hot plate (100℃) using the H2SO4-Salicylic acid-H2O2 mixed reagent. Thus, the prepared sample was analysed for phosphorus and other elements. Trace elements and heavy metals were determined by atomic absorbance spectroscopy.

2.3. Isolation, screening and characterisation of microorganism

A fungus strain was isolated from decaying wood, gathered from the Tribhuvan University grounds. Potato dextrose agar (PDA) plates were used to cultivate the isolate at a temperature of 28°C. Aspergillus niger strain having gene bank accession number OK353813 (Dhungana et al. 2022) was tested for Amylolytic and pectinolytic activities according to Sopalun and Iamtham 2020.

A fungal isolate was inoculated into a well on modified starch agar medium (1.4 g potassium dihydrogen phosphate, 10 g ammonium nitrate, 12.5 g ammonium oxalate, 5 g potassium chloride, 0.1 g magnesium sulphate, 0.01 g ferric sulphate, 5 g soluble starch, 1 L distilled water and 15 g agar) after being cultured for 48 h in potato dextrose broth. The plate was incubated for 48 h at 28°C after the inoculation. After flooding the incubated plate with the iodine solution, the colonies’ clear zones were observed. Similarly, the isolated strain cultured in PD broth was inoculated inside a well of a pectinase agar plate (20 g pectin ammonium oxalate, 1 L 0.1 M sodium acetate buffer and 15 g agar) and plates were incubated at 30℃ for 24 h. After the incubation plate was flooded with 1:1 v/v conc. HCl and water were then observed for a clear halo zone around the well.

DNA was isolated from amylase- and pectinase-producing isolates from broth culture using the CTAB method (Dhungana et al. 2022). The CTAB extraction buffer (2% CTAB [Sigma-Aldrich, USA], 1.4 M NaCl, 0.02 mM EDTA, 100 mM Tris-HCl [pH 8.0], 1% PVP) was prepared in a water bath at 60–65 0C in a 50 mL falcon tube. 50–100 mg fungal colonies were mashed with 500 µL preheated CTAB extraction buffer in a sterile mortar and pestle. It was then transferred to a 2 mL Eppendorf’s tube and incubated for 30–60 min at 60–65℃. The tubes were allowed to cool to room temperature before being filled with 500 µL chloroform: isoamyl alcohol (24:1) and well mixed after incubation. The tubes were then centrifuged at 9000 rpm for 8 min. The upper aqueous layer was transferred to a new Eppendorf tube, and an equal volume of cold isopropanol was added, carefully mixed and incubated at −20℃ for 1 h. The tubes were centrifuged at 9000 rpm for 8 min at room temperature. The pellet was washed and dried. Then electrophoresis was done using 1% agarose gel.

After the confirmation of genomic DNA, PCR amplification was done using 18s rRNA universal primer (New England Biolabs). The forward and reverse primer sequences were 5′GGTCTTGTAATTGGAATGAG 3′ and 5′CTTCCGTCAATTCCTTTAAG3′, respectively. The PCR product was sent to the Nepal Academy of Science and Technology, Khumaltar, Lalitpur, Nepal. The obtained sequences were edited using Sequencher 4.1.4 software. Sequence similarity searches were done with NCBI Blast and then aligned with multiple sequence alignment. Finally, the phylogenetic tree was generated using a neighbour-joining algorithm in MEGA11 software.

2.4. Inoculum preparation

In comparison to many bacterial strains, fungal strains, such as Aspergillus niger can tolerate more extreme environmental conditions. They frequently have a greater tolerance for pH, temperature, and hazardous chemical extremes. When it comes to their enzymatic capabilities, fungi are more diverse. For the growth of the given fungal strain, about a loop of fungal culture was taken and cultured in 100 mL potato dextrose broth. The culture was incubated for acclimatisation at 28°C for 5 days. It was primarily used in MFC for waste degradation.

2.5. MFC designs and operation

MFCs are made up of anodic and cathodic chambers, two electrodes (anode and cathode), and a salt bridge. A dual-chambered fuel cell of 350 mL capacity was taken and marked as an anode and cathode. A proton exchange membrane (PEM) situated in between anodic and cathodic chambers acts as a salt bridge. Graphite sheets were used as electrodes and Nafion 177 was used as a proton exchange membrane.

Once the MFC set-up was ready, 300 mL of sterilised substrate was poured into the anodic compartment and 300 mL buffer was poured into the cathodic compartment under aseptic conditions. Then set-up was connected with the measuring device using wire, which was operated for about 12 days in batch mode at the temperature of 27℃±1 and the generated voltage was observed using a multimeter. The open circuit voltage reading was taken for the optimisation of MFC performance. Power, voltage and current were obtained from the closed circuit possessing 1000 and 100 Ω resistance. The anodic sample was taken for the determination of reducing sugar, COD, phosphorous and nitrogen at the end of each operation. Further improvements in MFC performance were done using the graphite felt coated with PANI/MWCNT as an anode and 1.0% potassium permanganate, potassium ferricyanide, and potassium dichromate in phosphate buffer at the cathodic compartment. Electrode modification with PANI/MWCNT was done by following the method explained in Maharjan et al. 2023. Fed-batch operation was done using the same parameters such as batch mode, only the 10% volume of the total substrate was replaced by the same amount of new substrate every 24 h.

2.6. Electrode and membrane treatment

Graphite sheets (10cm × 2.8cm × 0.2) were used as anode and cathode. Copper wires were used to connect the electrodes on each side of the chamber. These electrodes were chosen because they are affordable and readily available. Before use, electrodes were ultra-sonicated with 70% methanol and 70% acetone, followed by distilled water and finally 15 min under UV light. Nafion membrane having a diameter of 5 cm treatment was done in four steps. Firstly, the membrane was boiled in 3% H₂O₂ at 100℃ for 2 h. Then it was taken in distilled water and boiled for 2 h at 100℃. Again, the membrane was boiled at 100℃ in 0.5 M sulphuric acid for 2 h and finally in distilled water for 2 h at 100℃ (Maharjan et al. 2023).

2.7. Statistical analysis

Data analysis was done using statistical tools: MS Excel and Graph pad prism (version 9.1.1). Concentrations of various compounds were calculated from their respective standard.

3. Results and discussion

3.1. Determination of physiochemical parameters of a sample

Potato peel waste contained a moisture content of 78.6 ± 1.267%, TSS of 21.4 ± 1.275%, VSS of 88.31 ± 7.056% and ash content of 11.68 ± 7.056%. Similarly, the pH of the sample was 6.51 ± 0.081 (Table 1). The moisture level of potato peels was 70–75%, with just 25–30% dry matter left (Jin et al. 2018). Similarly, various chemical parameters of the waste substrate are given in Table 2. The reducing sugars and COD of the sample were 1.061 ± 0.64 mg/g and 10.24 ± 0.12, respectively. Similarly, ammonical-nitrogen, phosphorus, iron, copper and zinc were also found in the substrate, whereas heavy metals, such as lead and nickel, were not found. According to Joshi et al. 2020, total carbohydrates in potato peels are 8.7–12.4 mg per 100 grams. Starch, organic acids, and micro- and macro-elements, such as sodium, potassium, phosphorus, and calcium are abundant in the peel. It’s also high in vitamin C, fat, and glucose.

Table 1. Physical parameters of potato peel waste sample.

Characteristics of Sample
pH	6.51 ± 0.081
Moisture Content %	78.6 ± 1.267
Total Suspended Solid (TSS) %	21.4 ± 1.275
Volatile Suspended Solid (VSS) %	88.31 ± 7.056
Ash Content %	11.68 ± 7.056

Table 2. Different chemical parameters of potato peel waste samples.

Analytical Parameters of Samples	Concentration mg/g
Reducing Sugars	1.061 ± 0.64
Ammoniacal Nitrogen	0.011 ± 0.01
Chemical Oxygen Demand (COD)	10.24 ± 0.12
Phosphorus Iron	0.015 ± 0.017 0.167
Copper	0.007
Lead	Not detected
Nickel	Not detected
Zinc	0.007
Manganese	0.002

3.2. Screening of fungal isolate for enzyme production and characterisation

The iodine-based starch hydrolysis test used to confirm the isolate’s generation of amylase is depicted in Figure 2(a). Aspergillus niger can produce amylase, an enzyme that is used in the starch degradation process (Wang et al. 2018). When the pectin media plate was flooded with 1:1 v/v HCl, the halo zone around the well was visible, indicating that the isolate indeed produced pectinase. Pectin molecules are hydrolysed by enzymes called pectinases, which results in the formation of smaller oligosaccharides or monosaccharides. An acidic environment is produced in the pectin medium plate by adding HCl then the media undergo a colour shift as a result of this acidic pH (Quilez-Molina et al. 2023).

Figure 2. Test for (a) amylase activity by starch hydrolysis test; halozone formed by isolate on starch agar media flooded with iodine (b) pectinase activity halozone formed by isolate on pectin media flooded with 1:1 v/v HCl.

The 18S rDNA region of the fungal isolate was amplified by a universal 18S RNA primer. Amplified products were then sent for sequencing to the National Academy of Science and Technology. The obtained sequences were edited by sequencher software, aligned by Bioedit software and analysed by NCBI blast. Isolate resembled Aspergillus niger. A phylogenetic tree was developed using MEGA11 software (Figure 3).

Figure 3. Phylogenetic tree construct by the neighbour-joining method using Mega 11 software (F = Isolated strain).

3.3. Optimisation of pH for amylase and pectinase

The effect of pH on enzyme activity is shown in Figure 4. The greatest enzyme activity of amylase was observed at pH 5, followed by a quick reduction at pH 5.5. The highest enzyme activity of pectinase was found at pH 5 and slightly lower at pH 5.5. pH 5 is found a favourable condition for optimal condition for organisms to produce enzymes. According to Bellaouchi et al. 2021, the highest activity of amylase produced by Aspergillus niger was found in pH 5. These enzymes are often active under acidic conditions, which is the characteristic of the natural habitats where Aspergillus niger thrives, such as acidic soils and decaying organic matter. Extreme pH levels can denature amylase, rendering it inactive. At very low or high pH levels, the enzyme’s structure can change, disrupting its active site and preventing it from catalysing reactions effectively. The pH affects the enzyme’s tertiary structure, altering its ability to interact with substrates (Abedi, Kaveh, and Mohammad Bagher Hashemi 2024). Because of that reason, the pH of the substrate was maintained at 5.5 ± 0.2 for better enzyme activity.

Figure 4. The activity of enzymes produced by fungal isolate in media having different pH values.

3.4. MFC construction and optimisation for the enhancement of electricity

MFC operation was done for bioremediation and energy production in the form of power generation. The electrodes, among all the MFC components, are most important for producing energy because the come into direct contact with microorganisms and control the rates at which electrons transfer (Yaqoob, Ibrahim and Rodríguez-Couto 2020). Isolated fungal strain acts as a biocatalyst of these reactions, the complex carbohydrates were metabolised by the enzyme produced by Aspergillus niger and help in the production of electrons and protons in MEC (Bangaru et al. 2022). In this study, various parameters were optimised such as the concentration of sample, cathodic solution, and electrode modification for the enhancement of generated OCV. All the MFC operations were carried out at a temperature of 27 ± 1℃, and the pH was maintained at 6.5.

3.4.1. Effect of substrate concentration in MFC operation

However, the waste sample was solid, which required water for dilution. For the optimisation of the amount of water used, three different concentrations were used in MFC operation. The maximum OCV obtained using 1:5, 1:10 and 1:15 dilution of the substrate was found 450 ± 36 mV/m³, 663 ± 6 V/m³ and 496 ± 40 mV/m³, respectively, as shown in Figure 5. From this result, the highest OCV value was shown in MFC using 1:10 dilution, which was used in further MFC operation. The more amount of substrate allowed to microorganisms more oxidation process occur through the metabolism which increases the output of the product. However, in this result substrate concentration increased from 1:10 to 1:15, and the OCV value decreased. According to Tan et al. (2020), when glucose concentration is high, most of it remains unconsumed, likely because it exceeds the capacity for consumption of microorganisms. However, in the lowest concentration up to 5%, the OCV value was minimal due to the limitation of the substrate. An ideal concentration must be selected since the amount of carbon sources that bacteria may use is limited. The concentration utilised shouldn’t be too low to cause saturation or inhibition, nor should it be too high (Ullah and Zeshan 2019). According to the result observed, 1:10 dilution substrate was taken for further MFC operation.

Figure 5. Effect of concentration of substrate on open circuit voltage at different times.

3.4.2. Effect of different catholytes in MFC operation

The open circuit voltage reading of an MFC using various electron acceptors in the cathode is shown in Figure 6. According to this, OCV using a normal buffer as control was found 663 ± 6 V/m³ which is nearly equal to using NaCl as catholyte 636 ± 23 mV/m³. Our aim was to enhance the amount of voltage generated for which releasing electrons in an anodic chamber should flow through an external circuit to the cathode. At the cathode, the electrons need to be accepted to complete the circuit and allow continuous electron flow, for which an electron acceptor plays a great role in producing electricity (Leung et al. 2020). Three different electron acceptors were used in catholyte, KMnO₄ has the highest OCV i.e. 1680 ± 60 mV/m³ followed by K₂Cr₂O₇ i.e. 1156 ± 33 mV/m³ and then K₃[Fe (CN)₆] i.e. 863 ± 26 mV/m³. According to Tessema and Yemata (2022), KMnO₄ has a higher electron-accepting ability (310.09 ± 0.06 mV) than K₂Cr₂O₇ (252.18 ± 0.12 mV), however, is recognised as a strong oxidising agent. 50 mM acetate buffer in the cathode was taken as the control. Similarly, 5% NaCl was also used as the catholyte instead of buffer, and the OCV generation using acetate buffer and NaCl was found in the same range.

Figure 6. Effect of different catholytes used in cathode on open circuit voltage at different times.

3.4.3. Effect of sterilised and unsterilised substrate in MFC operation

When pure fungus culture was used as inoculum in a sterilised anode sample, the OCV value was 663 ± 6 mV/m³ whereas when an unsterilised sample was used, the OCV value was 637 ± 23 mV/m³_, as shown in Figure 7. Achieving sterilisation on a large scale can be difficult, particularly in fields or outdoor environments. Large volumes of materials for sterilisation might be logistically challenging to transport and handle. So we can use an unsterilised sample with fungal inoculum because it generates an OCV almost similar to that of a sterilised substrate. According to Islam et al. (2018) the co-culture of microorganisms enhances the OCV generation in MFC than using pure culture. When a sterilised sample with fungal culture was used, the curve was going constantly while in microbial co-culture declined after reaching the peak. However, in a co-culture, different microbial species compete for resources like nutrients and electron donors/acceptors. This competition can lead to reduced overall efficiency (Espinosa-Ortiz, Rene, and Gerlach 2021).

Figure 7. Effect of fungal inoculum in sterilised substrate and unsterilised substrates containing other microorganisms on open circuit voltage at different times.

3.4.4. Effect of electrode modification in MFC operation

From this result, we can conclude that the use of MWCNT coated anode improves open circuit voltage generation i.e. 1586 ± 63 mV/m³ than using a normal electrode i.e. 663 ± 6 mV/m³. In the MWCNT electrode maximum OCV was found on the second day of operation which is more than 2 times than using a normal graphite electrode. The comparison in OCV generation between using multiwalled carbon nanotubes (MWCNT)-coated electrode and normal graphite electrode (not coated) using acetate buffer in both cases is shown in Figure 8. According to Erbay et al. 2015, an anode’s power density is 7.4 times more than that of a bare carbon electrode, the greatest improvement for MFCs with nanomaterial-decorated electrodes ever documented. In MFCs, coated material provides high conductivity and a wide unique surface area greatly improving charge transfer efficiency and biofilm formation on the electrode surface. The MWCNT nanocomposite was a desired anode material for MFCs when the power density of the proposed MFC was compared to that of other MFCs in the literature (Yaqoob, Ibrahim, and Rodríguez-Couto 2020).

Figure 8. Effect of electrode modification on open circuit voltage at different times.

3.4.5. Open circuit voltage in MFC recycling substrate in 24 h intervals of time (Fed batch)

After 72 h of operation 10% of the initial sample was added in intervals of every 24 h. An experiment was done for up to 25 days and the maximum OCV was 873 ± 36 mV/m³ at the 14th day of operation which is a more improved result than that of MFC operation in batch mode. After 15 days, the level of OCV generation remains constant; it can be operated for more and more days using buffer only in the cathode because the pH was 8 at the end of 25 days (Figure 9). Fed-batch operation plays a crucial role in large-scale MFCs by enabling controlled substrate addition which helps to prevent substrate inhibition and enhance stability because fluctuations in substrate concentration can lead to variations in microbial activity, affecting electron transfer rates and overall power output (Abdallah et al. 2019). According to Choudhury et al. 2021 in the beginning, 100 mL of sample solution containing 0.2% milk powder was used in MFC with minimal medium and run for 72 h. After 72 h of operation, 50 mL of sample was added which produced a maximum OCV of 654 mV after 123 h.

Figure 9. Effect on open circuit voltage observed on MFC with continuous addition of substrate at 24 h intervals of time.

3.5. Removal of various parameters

Degradation of waste biomass and reduction in various parameters, such as COD, reducing sugars, ammoniacal-nitrogen and TSS, were calculated by determining the initial and final concentration of these parameters. Maximum COD removal was found in using KMnO₄ as an electron acceptor in cathode 37.69%. The removal of COD in MFC is closely related to the generation of OCV through the microbial metabolism occurring within the system. Efficient COD removal supports sustained microbial activity, leading to increased electron transfer rates and higher OCV generation in the MFC. The COD removal can be increased from 23.3% to 51.53% using various treatment methods such as coagulation treatment and anaerobic filter for solid waste (Reddy, Rao, and Kalamdhad 2022). Similarly, the removal of ammoniacal-nitrogen in waste samples after MFC operation was determined. There was a huge reduction in ammoniacal-nitrogen by 54.54–67.72%, as given in Figure 10(b). Ammoniacal-nitrogen removal can be done by fungal strains effectively using ammonia-nitrogen and removal through assimilation, denitrification, ammonia oxidation and biofiltration. Almost 52.88% of ammonia was removed from the municipal wastewater (Lin et al. 2022).

Figure 10. Removal of (a) COD (b) Ammonia-nitrogen (c) Reducing sugar and (d) TSS with different modes of MFC operation.

In the case of reducing sugar, the removal rate was in between 50 and 70% at the end of 12 days of operation. It is well recognised that fungi are important players in bioremediation processes, where they use oxidation to break down organic molecules, including sugars. Solid waste contains a complex form of sugars. Optimisation of process parameters and selection of appropriate treatment techniques are essential for maximising sugar utilisation from the solid waste up to 90% (Aruwajoye, Faloye, and Kana 2017). In overall MFC operations TSS removal was between 55 and 66%, this result indicates that pretreatment of the sample might be helpful for more amount of TSS removal. According to Yushi Tian et al. (2017) MFCs fed with 10 g/L PPW removed 56.8% of total suspended solids, while MFCs fed with 20 g/L PPW removed 53.6% of TSS. TSS removal was found higher in using fed-batch than batch mode MFC.

3.6. Power generation in MFC using different resistors

Power generation in MFC using two different external resistors was calculated. This experiment was done to observe the effect of external resistance on the overall performance of MFC. The maximum power density generated using 1000-ohm resistance and 100-ohm resistance was 396 ± 23 W/m³ and 140 ± 30 W/m³, respectively. Power density is affected by various factors, such as substrate concentration and electrode size and maily material (Obileke et al. 2021). Anode potential fluctuations with external resistances were observed, and the greatest anode potential was exhibited by the shift in external resistance. Higher anode potentials allow for the extraction of more free energy, which may facilitate the generation of electricity (Du and Li 2017). When external resistors are increased from 15 Ω to 2k Ω, the power density usually rises. Conversely, if the resistance load was very high, it would have hindered the flow of electrons through the circuit, resulting in a decreased responsiveness in the current output. In the case where graphite electrode and water served as the electrolyte, the maximum power density using 2k Ω was 13.09 mW/m³, while the power density using 15 Ω was less than 1 mW/m³ (Lopez Zavala and Gutiérrez 2023). At a 95% level of confidence, using a two-tailed test p-value was 0.0305 (less than 0.5) between using 100- and 1000-ohm resistors. Thus, the experiment was significant at a 5% level of significance (Figure 11).

Figure 11. Effect of the external resistor on power generation in optimised microbial fuel cell operation.

[Note: p value = 0.0305, 95% level of confidence].

3.7. Cyclic voltammetry

Cyclic voltammetry is an electrochemical method frequently used to study the reduction and oxidation processes of molecular species. It also examines chemical reactions, such as catalysis, which are sparked by electron transfer. Protons (H+) and electrons (e-) are continuously produced and used by the cell by metabolic activities. The movement of electrons towards the working electrode and deposit, produces a voltammogram. The cyclic voltammogram consists of 2 anodic peaks and a cathodic peak. The typical carbon electrode shows the first anodic peak at 0.5 V, which is the peak of electroactive oxide/hydroxide. A second peak between 0.6 and 0.7 was probably metal oxide because the sample of potato peels included metals such as iron, copper, and zinc. The Fe₂O₃ oxidation peak was around 0.7 V and the peak of carbon was around 0.55 V. The cathodic peak of the voltammograms was observed at −0.35 V probably due to oxygen reduction (Ravichandran et al. 2020). During oxidation in an anodic peak maximum current produced was 1.26A/m³ of the sample volume (Figure 12).

Figure 12. Cyclic voltammogram of graphite sheet used as an electrode in the MFC on the fourth day of set-up.

3.8. Sugar analysis in potato peels sample by HPLC

Sugar analysis in potato peels sample was done in HPLC (Agilent) using the zorbax carbohydrates-specific column (C18). Calibration standards were analysed in HPLC according to which different peaks in the chromatogram were identified based on retention time, as shown in Figure 13. Three different sugars (glucose, xylose and arabinose) were identified in the chromatogram. According to Choi et al. 2020, potatoes mostly comprise non-starch polysaccharides (NSP), methyl groups, glucose, starch, and amylose. Rhamnose, galactose, arabinose, xylose, mannose, and glucose were found in the insoluble NSP; the first three sugars decreased significantly after the three weeks of storage. Thus, the concentration of arabinose was very low and might decrease because of the storage of the sample (Table 3).

Figure 13. Chromatogram of sugar analysis of potato peel sample using RI detector.

Table 3. The concentration of different sugars determined by HPLC analysis.

Sugar	Concentration (mg/g)
Glucose	3.34 ± 0.2
Xylose	0.467 ± 0.17
Arabinosa	0.02 ± 0.05

3.9. By-products analysis after MFC operation by HPLC

Figure 14 shows the by-product analysis after MFC operation using the Aminex HPX-87H column. Quantitative analysis of HPLC is shown in Table 4 based on different concentrations of various calibration standards. Thus, the concentrations of citric acid, acetic acid, propionic acid and succinic acid were 3.04 ± 0.11 mg/g, 2.51 ± 0.09 mg/g, 0.021 ± 0.0015 mg/g and 12.03 ± 0.56 mg/g, respectively as shown in Table 4. According to Robbert Kleerebezem et al. (2015), anaerobic digestion of organic waste produces acetic acid, propionic acid, succinic acid, lactic acid and butyric acid. In our study, lactic acid and butyric acid were not determined, it might be due to a very low amount which could not detected by HPLC. Similarly, the ethanol is the by-product of fermentation. Potato peels mostly contain starch and pectin which were hydrolysed by amylase and pectinase produced by fungal strain. The glucose found in the initial substrate was then taken up by the fungal cells and metabolised through glycolysis and the TCA cycle (Jayakumar et al. 2022).

Figure 14. Chromatogram of by-product analysis of potato peel sample using RI detector.

Table 4. Concentration of different byproducts determined from HPLC analysis.

Components	Concentration (mg/g)
Citric acid	3.04 ± 0.11
Glucose	0.87 ± 0.06
Fructose	10.11 ± 0.81
Succinic acid	12.03 ± 0.56
Acetic acid	2.51 ± 0.09
Propionic acid	0.021 ± 0.0015
Ethanol	0.81 ± 0.079

4. Conclusion

Physiochemical analysis of potato peel waste was done to analyse various components of waste. Isolated fungal strain Aspergillus niger showed amylase- and pectinase-producing ability which was well suited for degradation. Operation of MFC was done for the enhancement of electricity generation by optimising various parameters. In this study, organic waste degradation efficiency and subsequent electricity generation were evaluated with a maximum power generation of 396 ± 23 W/m³ using a 1000-ohm external resistor. Additionally, COD, ammoniacal-nitrogen, reducing sugar, and total suspended solid (TSS) removal were measured. The results indicated that TSS removal ranged from 55% to 66%, suggesting a need for increased hydrolysis for enhanced electricity production. This research aims to achieve bioremediation of solid waste while generating alternative energy with the production of valuable by-products. This study should be followed up with scale-up and integration of advanced technologies in electrode designs. It can be implemented as closed-loop systems that promote recycling, reuse, and repurposing of waste materials to minimise environmental impact and promote sustainability.

Acknowledgement

Central Department of Biotechnology, Tribhuvan University is highly acknowledged.

Disclosure statement

No potential conflict of interest was reported by the author(s).