NCAPD2 promotes the malignant progression of oral squamous cell carcinoma via the Wnt/β-catenin pathway

ABSTRACT

Oral squamous cell carcinoma (OSCC) is the most common type of oral cancer, with a poor prognosis, yet the underlying mechanism needs further exploration. Non-SMC condensin I complex subunit D2 (NCAPD2) is a widely expressed protein in OSCC, but its role in tumor development is unclear. This study aimed to explore NCAPD2 expression and its biological function in OSCC. NCAPD2 expression in OSCC cell lines and tissue specimens was analyzed using quantitative polymerase chain reaction, western blotting, and immunohistochemistry. Cancer cell growth was evaluated using cell proliferation, 5-Ethynyl-2’-deoxyuridine (EdU) staining, and colony formation assays. Cell migration was evaluated using wound healing and Transwell assays. Apoptosis was detected using flow cytometry. The influence of NCAPD2 on tumor growth in vivo was evaluated in a mouse xenograft model. NCAPD2 expression was significantly higher in OSCC than that in normal oral tissue. In vitro, the knockdown of NCAPD2 inhibited OSCC cell proliferation and promoted apoptosis. NCAPD2 depletion also significantly inhibited the migration of OSCC cells. Moreover, NCAPD2 overexpression induced inverse effects on OSCC cell phenotypes. In vivo, we demonstrated that downregulating NCAPD2 could inhibit the tumorigenicity of OSCC cells. Mechanically, OSCC regulation by NCAPD2 involved the Wnt/β-catenin signaling pathway. These results suggest NCAPD2 as a novel oncogene with an important role in OSCC development and a candidate therapeutic target for OSCC.

KEYWORDS:

• Apoptosis
• migration
• non-SMC condensin I complex subunit D2
• oral squamous cell carcinoma
• proliferation

1. Introduction

Oral squamous cell carcinoma (OSCC) accounts for approximately 90% of oral cancers, representing the most common subtype [1,2]. Owing to its propensity for local recurrence and distant metastasis, the treatment efficiency of OSCC remains poor, and the 5-year survival rate is only approximately 50% [3]. Thus, there is an urgent need to explore the molecular mechanisms underlying OSCC and develop effective treatment strategies to improve the survival rate of patients with OSCC.

Non-SMC condensin I complex subunit D2 (NCAPD2) is a subunit of condensin I, composed of structural maintenance of chromosomes SMC2 and SMC4 and three auxiliary subunits NCAPD2, NCAPG, and NCAPH [4]. It is mainly involved in the condensation and segregation of chromosomes during mitosis [5,6]. Previous studies have shown that NCAPD2 is also related to the occurrence and development of human diseases, including inflammatory bowel disease [7], primary microcephaly [8], Alzheimer’s disease [9], and Parkinson’s disease [10]. In addition, abnormal expression of NCAPD2 in ovarian cancer may act as an independent prognostic factor [11]. NCAPD2 is highly expressed in colorectal cancer (CRC) clinical tissue samples and tumor cells, and plays a role in promoting colorectal carcinogenesis and CRC growth [12]. Meanwhile, NCAPD2 plays a vital role in regulating the cell cycle progression, proliferation, and invasion of triple-negative breast cancer cells, and is closely related to the malignant phenotype of these tumors [13].

Although the role of NCAPD2 has been studied in some tumors, it has not been studied in OSCC. This study aimed to investigate the biological functions and potential mechanisms of NCAPD2 in OSCC. To the best of our knowledge, this is the first study to clarify the effect of NCAPD2 on tumor progression in OSCC. This study provides a reliable target for diagnosis, prediction, and targeted therapy of OSCC, and potential new therapy for OSCC.

2. Materials and methods

2.1. Analysis of publicly available mRNA expression data

Transcriptome and clinical data of head and neck squamous cell carcinoma were obtained from UCSC XENA (https://xenabrowser.net/datapages/) database [14]. The Student’s t-test was used to calculate the significance of differences between groups. The R package vioplot was used to visualize the analysis results.

2.2. Patients and specimens

Tissue samples were obtained from 48 patients diagnosed with OSCC who underwent surgery in the Department of Oral and Maxillofacial Surgery at the Affiliated Hospital of Inner Mongolia Medical University (Inner Mongolia, China). None of the patients received chemotherapy or radiotherapy before surgery. In addition to the 48 OSCC tissue samples, five healthy marginal oral cavity tissues were included in the analysis. The OSCC tissues comprised of 15 tongue, 13 cheek, 9 palate, 6 gingival, and 5 lip cancer samples. The study protocol was reviewed and approved by the Ethics Committee of the Affiliated Hospital of Inner Mongolia Medical University (KY2021008), and all patients provided written informed consent.

2.3. Immunohistochemical staining (IHC)

The tissue sections were deparaffinized, repaired with citric acid, blocked, and incubated with the NCAPD2 antibody (ab198019, 1:50; Abcam, Cambridge, UK) at 4°C overnight. After washing thrice with phosphate buffered saline (PBS), universal secondary antibody IgG (K8000, DAKO, Denmark) was added, and the samples were incubated at 25°C for 30 min. The tissue sections were subsequently stained with 3,3’-diaminobenzidine and hematoxylin for visualization. Images were acquired using a microscope (BA200; Motic, Hong Kong), and analyzed using a previously described method [15].

2.4. Plasmid construction and lentivirus infection

Three target sequences of NCAPD2 (shNCAPD2–1, shNCAPD2–2, and shNCAPD2–3) were generated (Table 1) and incorporated into BR-V108 (Shanghai Biosciences Co., Ltd., Shanghai, China). Scramble was used as RNAi negative-control (shCtrl) [16]. NCAPD2 overexpression plasmid (LV-013, pMD2.G, and psPAX2) and an empty vector were obtained from Shanghai Biosciences Co., Ltd. The plasmids were amplified and extracted using the EndoFree Maxi Plasmid Kit (DP118; Tiangen, Beijing, China), and were then transfected in 293T cells to harvest indicated lentiviruses. Real-time quantitative polymerase chain reaction (RT-qPCR) was performed to select the most efficient interference sequence.

Table 1. Target sequences and negative control sequence.

Group	Target sequence (5'–3')
shNCAPD2–1	CAGGTTCTCAGTGGCGATCAA
shNCAPD2–2	TTGCATCACTTTCGAAGTATA
shNCAPD2–3	TTGGATGGAATCAAGGAGCTT
shCtrl	TTCTCCGAACGTGTCACGT

2.5. Culture of cells and construction of NCAPD2-knockdown and -overexpression cell lines

The human OSCC cell lines SCC-25, Tca-8113, CAL-27, and HN4 were purchased from Beina Biotechnology Co., Ltd. (Beijing, China). SCC-25, CAL-27, and HN4 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Life Technologies, CA, USA) supplemented with 10% fetal bovine serum (FBS; HyClone, UT, USA) and 1% penicillin/streptomycin (Life Technologies). Tca-8113 cells were maintained in Roswell Park Memorial Institute 1640 medium (Gibco, Waltham, MA, USA) supplemented with 10% FBS and 1% penicillin/streptomycin. All cell lines were cultured in a humidified incubator at 37°C under 5% CO₂. To generate NCAPD2-silenced and -overexpressed cell models, the indicated lentiviruses were transfected into CAL-27 and HN4 cells (5×108 TU/mL, 10 MOI), and Tca8113 cells (3×107 TU/mL, 10 MOI) under ENI.S+Polybrene. Fluorescence microscopy was used to observe the transfection efficiency after 72 h. The NCAPD2-knockdown and -overexpression efficiencies were assessed using RT-qPCR and western blotting.

2.6. RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

The total RNA was isolated using TRIzol Reagent (T9424-100 ML; Sigma, St. Louis, MO, USA). Single-stranded cDNA was obtained using Hiscript QRT Supermix for qPCR (+gDNA WIPER) (R123–01; Vazyme, Nanjing, China). Thereafter, the AceQ qPCR SYBR Green Master Mix (Q111–02, Vazyme) was used for RT-qPCR in accordance with the manufacturer’s instructions. The PCR primers for human NCAPD2 were generated by Jinwei Zhi Co. (Shanghai, China). The expression of NCAPD2 was normalized to that of glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and its relative expression level was calculated using the 2^−∆∆CT method [17] (Table 2).

Table 2. List of qPCR primer sequences.

Primer	Sequence (5'–3')	PCR Products
NCAPD2 Primer-F	TCCATCAAACATCTTCCACCAC	136 bp
NCAPD2 Primer-R	TGAGGCCAGGATCTATACTTCG
GAPDH Primer-F	TGACTTCAACAGCGACACCCA	121 bp
GAPDH Primer-R	CACCCTGTTGCTGTAGCCAAA

2.7. Western blotting

The cells were harvested, and the total protein was extracted in radioimmunoprecipitation assay buffer (RIPA; Beyotime, Beijing, China) containing PMSF (1 mmol/L; Beyotime). Protein concentrations were determined using a BCA Protein Assay Kit (HyClone-Pierce, Waltham, MA, USA). The proteins were resolved using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred onto polyvinylidene difluoride membranes. The membranes were incubated with primary antibodies at 4°C overnight. After washing with PBS, the membranes were incubated for 1 h at 25°C with corresponding secondary antibodies. An Amersham ECL prime western blotting kit (Amersham, Chalfont, UK) was used to visualize the proteins. GAPDH (1:3,000, Abcam, ab9485) was used as an internal reference. The primary antibodies used in western blotting were as follows: NCAPD2 (1:1000; Abcam, ab137075), β-Catenin (1:2000, Proteintech 66,379–1-1 g), c-Myc (1:1000, CST 13,987), Wnt3a (1:1000, CST, 2721S), Caspase-3 (1:2000, Abcam, ab32351), Bcl-2 (1:2000, Abcam, ab182858), Bax (1:2000, Proteintech 50,599–2-1 g), Bcl-w (1:1000, CST, 2724). The secondary antibody used in western blotting was horseradish peroxidase (HRP) Goat Anti-Rabbit IgG (1:3,000, Beyotime, A0208).

2.8. High-content screening (HCS)-based cell-proliferation assays

We detected the proliferation of OSCC cells using HCS [18] with a fully automated analysis on a Celigo Imaging Cytometer (Nexcelom Bioscience, San Diego, CA, USA) [19]. CAL-27 and HN4 cells transfected with shNCAPD2 or shCtrl were plated in 96-well plates (3599; Corning, New York, USA) at 2,000 cells/well in 100 µL of DMEM supplemented with 10% FBS, and Celigo was used to read the plate once daily for five consecutive days. The green fluorescent protein (GFP)-positive cells were counted in each scan, and 5-day cell proliferation curves were plotted.

2.9. MTT assay

After transfection, OSCC cells in the logarithmic phase were seeded in 96-well plates and cultured at 37°C for 24 h. Then 20 μL of MTT solution (5 mg/mL, Beyotime) was added to each well, and incubated for 4 h at 37°C. Next, 100 μL DMSO was added to each well, and the plates were shaken slowly. The optical density (OD) for each well was measured at 490 nm.

2.10. Colony formation assay

OSCC cells were seeded in six-well plates and cultured for 2–3 weeks until clones were visible. The cell colonies were washed with PBS, fixed with 4% paraformaldehyde for 15 min, and stained with 0.1% crystal violet for 10 min. The colonies were photographed manually and then counted.

2.11. EdU staining

CAL-27 and HN4 cells were seeded in 96-well plates and incubated at 37°C for 24 h. Then 10 μM EdU was added and incubated at 37°C for 2 h. The cells were fixed with 4% paraformaldehyde for 15 min, then treated with 0.3% Triton X-100 for 15 min. The reaction solution was removed, and the cells were washed with PBS. The cells were then incubated with click reaction solution at 25°C in the dark for 30 min. Subsequently, the cells were incubated with Hoechst 33,342 at 25°C for 10 min. The cells were washed with PBS, observed under a fluorescence microscope, and images were acquired.

2.12. Apoptosis assay

OSCC cells were collected when they grew to the logarithmic growth phase and were plated in 6-well plates. The cells in each well were digested and collected 72 h after transfection. Then the cells were re-suspended with 1× binding buffer, and 200 μL cell suspension (1 × 10⁶ cells/mL) was transferred to a flow tube. Annexin V-allophycocyanin and propidium iodide were added to each tube, mixed, and incubated at 25°C in the dark for 15 min. A flow cytometer was used to assess the apoptosis rate.

2.13. Wound-healing assay

OSCC cells were plated in 96-well plates at 5 × 10⁴ cells/well in a serum-free medium. Scratches were made on the cell surface at 90% confluence and immediately imaged, followed by continued incubation at 37°C under 5% CO₂, and the scanning timepoints were determined based on cell growth rate. Celigo was used to scan the plates and analyze cell migration into the wound at each timepoint.

2.14. Transwell assay

After 48 h of transfection, 2 × 10⁵ cells were suspended in 100 μL of serum-free medium in the upper chamber of a Transwell plate (3422; Corning, NT, USA), and 600 μL of medium containing 30% FBS was added to the lower chamber as a chemical attractant. After incubation for 24 h, the cells on the lower surface of the membrane were fixed for 15 min in cold methanol (4°C) and then stained with 0.1% crystal violet. The cells in at least five fields per sample were counted under an optical microscope.

2.15. Human phospho-kinase antibody array

Phosphorylated human proteins were detected in CAL-27 cells transfected with shNCAPD2 or shCtrl using the Human Phospho-Kinase Antibody Array (R&D Systems, Minneapolis, MN, USA) following the manufacturer’s instructions. The total proteins were extracted from CAL-27 cells. After blocking for 1 h, 200 μg of total proteins was added to the array membranes and incubated at 4°C overnight. Thereafter, the detection antibody was added and incubated for 2 h. The membranes were washed to remove unbound proteins, and the HRP-labeled secondary antibody was added. Membrane intensity was measured using enhanced chemiluminescence (ECL) (Amersham, Chicago, IL, USA). The signal intensities were analyzed using ImageJ software (National Institute of Health, Bethesda, MD, USA).

2.16. Animal xenograft model

BALB/c female nude mice (4 weeks old, weighing 18–20 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). CAL-27 cells transfected with shNCAPD2 or shCtrl were subcutaneously injected into 10 mice (4 × 10⁶ cells per mouse), which were randomly divided into shCtrl and shNCAPD2 groups. The mice were housed in a conditional environment with a 12-h dark/light cycle. The tumor volume and mouse weight were measured regularly. For bioluminescence imaging in vivo, the mice were administered 10 μL/g bodyweight D-luciferin (15 mg/mL; Shanghai Qianchen, Shanghai, China) via intraperitoneal injection. Quantitation of bioluminescence signals was performed using a Living Image System (PerkinElmer, Waltham, MA, USA). After 35 days, the mice were euthanized, and the tumors developed were removed and collected. Finally, the tumors were weighed and photographed. Animal experiments were approved by the Ethics Committee of Inner Mongolia Medical University(YKD202101034)and handled following the National Guidelines for Animal Usage in Research (China).

2.17. Ki-67 staining

Tumor tissues were collected from euthanized mice for Ki67 immunostaining. Formalin-fixed and paraffin-embedded tissues were sliced into 4-μm thick sections, then deparaffinized and rehydrated. All sections were then repaired and blocked with the citrate antigen. All sections were incubated with Ki-67 primary antibody (1:300, Abcam, ab16667) at 4°C overnight and subsequently incubated with the secondary antibody IgG (1:400, Abcam, ab97080) at room temperature for 30 min. Finally, the sections were stained with 3,3-diaminobenzidine and then with hematoxylin. The stained sections were imaged under a microscope.

2.18. Statistical analysis

The data are presented as mean ± standard deviation (SD), and GraphPad Prism 8 (GraphPad Software Inc., San Diego, CA, USA) was used for plotting. The differences were analyzed using the Student’s t-test between two groups or one-way ANOVA followed by Bonferroni’s post hoc test among multiple groups. Results with p < 0.05 were considered statistically significant. All statistical analyses were performed using SPSS software version 21.0 (SPSS, IBM Corp., Armonk, NY, USA).

3. Results

3.1. NCAPD2 was highly expressed in OSCC cells and clinical specimens

In the samples from the UCSC XENA database, NCAPD2 expression level was significantly higher in head and neck squamous cell carcinoma (HNSCC) than that in healthy tissues (Figure 1(a)). The UCSC XENA database analysis showed that the expression level of NCAPD2 mRNA is closely related to clinical stage, pathological grade, and lymph node metastasis of HNSCC (p < 0.05, Figure 1(b–d)). The IHC findings revealed that NCAPD2 is expressed in both the nucleus and cytoplasm. Consistently, NCAPD2 expression was significantly higher in OSCC tissues than that in healthy oral tissues (p < 0.001; Table 3; Figure 1(e)).

Figure 1. Non-SMC condensin I complex subunit D2 (NCAPD2) was highly expressed in oral squamous cell carcinoma (OSCC). (a) UCSC XENA database analysis of NCAPD2 expression in head and neck squamous cell carcinoma (HNSCC) tissues compared with healthy normal tissues. (b) Expression of NCAPD2 in HNSCC based on clinical stage. (c) Expression of NCAPD2 in HNSCC based on the pathological grade of the tumor. (d) Expression of NCAPD2 in HNSCC based on nodal metastasis status. (e) NCAPD2 expression in healthy and OSCC tissues. Scale bars: left, 200 μm; right, 100 μm. Data are presented as mean ± standard deviation (SD; n = 3), ***p < 0.001.

Table 3. NCAPD2 expression in OSCC and control tissues.

	Tumour tissue		Control tissue
NCAPD2 expression	Cases	Percentage	Cases	Percentage	P-value
Low	22	45.8%	5	100.0%	0.000
High	26	54.2%	0	-

The endogenous expression of NCAPD2 in the four OSCC cell lines was detected using RT-qPCR. NCAPD2 was expressed in all cell lines tested and was the highest in HN4 and CAL-27 cells. Therefore, these lines were used to establish NCAPD2-knockdown models for in vitro experiments (Figure 2(a)). Tca-8113 cell line, in which NCAPD2 was not overexpressed, was used to establish the NCAPD2-overexpression cell model (Figure 2(a)).

Figure 2. NCAPD2 expression in OSCC cell lines and construction of knockdown and overexpression strains. (A) NCAPD2 expression in four OSCC cell lines. (B) Expression of NCAPD2 mRNA in knockdown cell lines CAL-27 and HN4 and in overexpressing cell line Tca8113. (C) Western blotting of NCAPD2 in knockdown cell lines CAL-27 and HN4 and in overexpressing cell line Tca8113. Data are presented as mean ± SD (n = 3), *p < 0.05, **p < 0.01, ***p < 0.001.

Three short hairpin RNAs (shRNAs) targeting NCAPD2 were designed and packaged into lentiviruses for cell transfection. RT-qPCR showed that shNCAPD2–1 had the highest efficiency (73.4%, Figure S1); therefore, it was employed in all subsequent experiments. Similarly, the NCAPD2-overexpression cell model was also established using lentivirus transfection. RT-qPCR confirmed > 60% NCAPD2-knockdown efficiency in the shNCAPD2 groups and the successful overexpression of NCAPD2 (Figure 2(b)). The protein-expression level of NCAPD2, as determined using western blotting, also indicated the knockdown or overexpression of NCAPD2 (Figure 2(c)). These results demonstrated the successful construction of NCAPD2 knockdown or overexpression cell lines.

3.2. NCAPD2 regulated the proliferation and apoptosis of OSCC cells

To study the role of NCAPD2 in OSCC in vitro, a series of functional experiments were performed. The MTT assay revealed that, compared with the rate of proliferation in control cells, NCAPD2 knockdown slowed the proliferation of OSCC cells, and NCAPD2 overexpression accelerated it (Figure 3(a)). The inhibition of OSCC cell proliferation via NCAPD2 knockdown was also verified using the Celigo cell counting assay (Figure S2). To further investigate how NCAPD2 regulates cell proliferation, the apoptosis level of OSCC cells was analyzed using flow cytometry. As shown in Figure 3(b)), a significant increase in the number of apoptotic cells was observed after NCAPD2 depletion. Furthermore, OSCC cell apoptosis was significantly inhibited upon NCAPD2 overexpression (Figure 3(b)). Moreover, it was demonstrated that the colony formation ability of OSCC cells could be weakened or enhanced upon NCAPD2 knockdown or overexpression, respectively (Figure 3(c)). In addition, EdU staining was performed on OSCC cells with or without NCAPD2 knockdown, and we observed a lower ratio of EdU-positive cells in the shNCAPD2 groups than those in the shCtrl group (Figure S3). In contrast, the significant ability of NCAPD2 to regulate the levels of apoptosis-related proteins also revealed the potential mechanism by which NCAPD2 influences apoptosis (Figure S4). These results indicate significant growth-regulating effects of NCAPD2 on OSCC cells.

Figure 3. NCAPD2 regulated the proliferation and apoptosis of OSCC cells in vitro. (a) MTT assays comparing the proliferation of NCAPD2-silenced (shNCAPD2) CAL-27 and HN4 cells and NCAPD2-overexpressing (NCAPD2) Tca8113 cell. (b) Flow cytometry was performed to examine the effects of NCAPD2 knockdown on the apoptosis of CAL-27 and HN4 cells and NCAPD2 overexpression on the apoptosis of Tca8113 cells. (c) Colony formation assay was performed to detect the effects of NCAPD2 on the colony formation ability of CAL-27, HN4, and Tca8113 cells. Data are expressed as mean ± SD (n = 3), **p < 0.01, ***p < 0.001.

3.3. NCAPD2 regulated the migration of OSCC cells

The wound-healing and Transwell assays were used to investigate the migration ability of OSCC cells. The rate of wound healing was significantly delayed in the shNCAPD2 group compared with that in the shCtrl group, but it was accelerated upon NCAPD2 overexpression (Figure 4(a)). Consistently, after 24 h of culture in Transwell chambers, the number of migrated OSCC cells was significantly low when NCAPD2 was knocked down or high when NCAPD2 was overexpressed (Figure 4(b)). These findings indicate that NCAPD2 exerted significant regulatory effects on OSCC cell migration in vitro.

Figure 4. NCAPD2 regulated the migration of OSCC cells. (a) Wound-healing assays were used to assess the effects of NCAPD2 knockdown/overexpression on OSCC cell migration. (b) Transwell assay was used to assess the effects of NCAPD2 knockdown/overexpression on the migration of OSCC cells. Data are expressed as mean ± SD (n = 3), magnification: 200×, *p < 0.05, **p < 0.01, ***p < 0.001.

3.4. Exploration of the mechanism underlying OSCC regulation by NCAPD2

To further explore the mechanism by which NCAPD2 regulates OSCC, a Human Phospho-Kinase Antibody Array was used to identify differentially expressed phosphorylation-related proteins in cells with or without NCAPD2 knockdown. We found that NCAPD2 knockdown downregulated β-catenin (p < 0.05) (Figure 5(a,b)). We hypothesized that NCAPD2 knockdown might regulate the Wnt/β-catenin signaling pathway. Therefore, the regulation of several well-characterized cancer-related and Wnt/β-catenin pathway-related factors by NCAPD2 was observed. As shown in Figure 5(c), the downregulation of c-Myc, Wnt3a, and β-catenin by NCAPD2 knockdown was confirmed using western blotting. Moreover, the enhanced expression of c-Myc, Wnt3a, and β-catenin was also observed in NCAPD2-overexpressed OSCC cells, which could be partially reversed by treatment with an inhibitor of the Wnt pathway (Figure 5(d)). The promotion of cell proliferation and inhibition of cell apoptosis induced by NCAPD2 overexpression were alleviated by inhibitor treatment (Figure 5(e,f)). These results suggest the involvement of the Wnt/β-catenin signaling pathway in NCAPD2-induced regulation of OSCC development.

Figure 5. Exploration of the mechanism underlying OSCC regulation by NCAPD2. (a) A human phospho-kinase antibody array was used to identify differentially expressed phosphorylation-related proteins in CAL-27 cells with or without NCAPD2 knockdown. (b) NCAPD2 knockdown downregulated β-catenin. (c) c-Myc, Wnt3a, and β-catenin expression detected by western blotting in CAL-27 cells of the shCtrl and shNCAPD2 groups. (d) NCAPD2, c-Myc, Wnt3a, and β-catenin expression detected using western blotting in CAL-27 cells of the control, NCAPD2, and NCAPD2 + C59 groups. The control group refers to blank overexpression control, NCAPD2 group refers to NCAPD2 overexpression, NCAPD2+C59 group refers to NCAPD2 overexpression plus WNT signaling pathway inhibitor C59 treatment (20 μM). GAPDH was detected as a loading control in the western blot. (e) CCK8 assay showed cell viability in the control, NCAPD2, and NCAPD2+C59 groups of CAL-27 cells treated with or without the WNT signaling pathway inhibitor C59 (20 μM). (f) Apoptosis assay was performed to detect cell apoptosis of various cell groups. Data are presented as mean ± SD (n = 3), *p < 0.05, **p < 0.01, ***p < 0.001.

3.5. NCAPD2 knockdown inhibited OSCC tumor growth in vivo

The above assay confirmed that NCAPD2 promotes cell proliferation and migration while inhibiting apoptosis in vitro. We speculated whether NCAPD2 silencing would affect OSCC growth in vivo. CAL-27 cells with or without NCAPD2 knockdown were subcutaneously injected into mice to establish a mouse xenograft model. Tumor growth was estimated with an animal experiment by calculating tumor volume; we observed considerably slower tumor growth in the shNCAPD2 group than that in the shCtrl group (p < 0.05, Figure 6(a)). The average tumor weight of the murine model in the shNCAPD2 group was also considerably lower (82 ± 34 mg) than that in the shCtrl group (p < 0.05) (Figure 6(b,c)). Moreover, the bioluminescence intensity was considerably decreased in the shNCAPD2 group relative to that measured in the shCtrl group (p < 0.05) (Figure 6(d,e)). In addition, the xenografts collected from the shNCAPD2 group showed lower expression of NCAPD2 and lower Ki-67 index, which could represent the proliferative activity to some extent, than those from the shCtrl group (Figure 6(f)).

Figure 6. NCAPD2 knockdown suppressed tumor growth in vivo. (a) Tumor volumes were measured in animal models. (b) Representative photos of tumors. (c) Tumor weights were measured after euthanizing the mice. (d) Fluorescence expression of xenograft tumors in nude mice in the shCtrl and shNCAPD2 groups. (e) Fluorescence expression of xenograft tumors in the two groups. (f) Representative images of sections of the indicated tumors and stained with hematoxylin and eosin staining (upper panel), anti-Ki67 (middle panel), and immunohistochemical staining for NCAPD2 (lower panel). Scale bar: 100 μm. Data are presented as mean ± SD (n = 3), *p < 0.05.

4. discussion

NCAPD2 is one of the subunits of condensin I, and earlier research has shown that it is mainly involved in the condensation and separation of mitotic chromosomes during the cell cycle [20]. Literature analysis showed that this gene was highly expressed in breast and colon cancer [12,21], and an earlier biogenic analysis by our group found that NCAPD2 was highly expressed in HNSCC. Therefore, we speculate that this gene may be related to the development of HNSCC. In this study, we first analyzed the expression of the NCAPD2 gene in HNSCC and its relationship with the clinicopathologic features of patients through database analysis. We found that a high expression of NCAPD2 was related to clinical stage, pathological grade, and lymph node metastasis of HNSCC (Figure 1(a–d)), which is consistent with some of the findings of Zhang et al., namely, the expression of NCAPD2 was positively associated with lymph node metastasis [13]. OSCC, which accounts for 38% of all HNSCC cases [22], has no effective treatment, and it substantially affects patient survival and quality of life. Therefore, through this study, we aimed to confirm whether NCAPD2 is related to the occurrence and development of OSCC and analyze the expression and biological function of NCAPD2 in OSCCC.

We detected the expression of NCAPD2 in OSCC and normal tissues using immunohistochemistry. The results showed that NCAPD2 expression was up-regulated in OSCC (Figure 1(e)). NCAPD2 plays a core role in mitosis [20]. The development of oral cancer is related to the rapid proliferation of tumor cells [23]. The rapid proliferation of tumor cells involves mitosis [24], so we speculate that NCAPD2 may promote OSCC proliferation through mitosis. Cell and animal studies were conducted to verify the role of the NCAPD2 gene in OSCC proliferation. NCAPD2 depletion or overexpression in OSCC cells resulted in the inhibition or promotion of cell proliferation (Figure 3(a,c)), respectively, and this was verified using cell proliferation assays and EdU staining (Figure S3). This finding is consistent with the that of Zhang et al., who showed that NCAPD2 deletion leads to abnormal mitosis and tetraploid cell accumulation [13]. In vivo, we confirmed that NCAPD2 down-regulation considerably decreased tumorigenicity (Figure 6(a,c)). In addition, we also found that NCAPD2 knockdown/overexpression inhibits/promotes OSCC cell migration (Figure 4(a,b)), likely due to the action of NCAPD2 in stabilizing centrosomes and promoting microtubule formation [25]. However, the underlying mechanism needs to be explored further in the future.

Furthermore, we found that the percentage of apoptosis significantly increased in both shNCAPD2 cells compared with the apoptosis percentage observed in the shCtrl group (Figure 3(b)). Apoptosis, or programmed cell death, is defined as cells’ autonomous death controlled by genes. Cell apoptosis has recently been regarded as a key biological behavior in cancer therapy [26]. Apoptosis involves a series of proteins, such as the Caspase family, Bcl-2 family, and P53 proteins. Among them, the Caspase family is the protease system that directly leads to the disintegration of apoptotic cells and plays a pivotal role in the mechanism network of apoptosis [27]. Caspase-8 and −9 are initiator caspases, while caspase 3 is an effector caspase [28]. Caspase-3 is a key zymogen in cell apoptosis and is not activated until it is cleaved by initiator caspases during apoptotic flux [29]. He et al. reported that down-regulating NCAPD2 expression promotes apoptosis of breast cancer cells [21]. Consistent with this, our study demonstrated that NCAPD2 knockdown promoted the apoptosis of OSCC cells, and the expressions of apoptosis-related proteins Caspase-3 and Bax were up-regulated, while the expressions of Bcl-2 and Bcl-w were down-regulated (Figure S4). This suggests that NCAPD2 may affect OSCC cell apoptosis by regulating Bcl-2 to activate Caspase-3.

To further explore the mechanism of NCAPD2-induced regulation of OSCC, a Human Phospho-Kinase Antibody Array was used to identify differentially expressed phosphorylation-related proteins in CAL-27 cells with or without NCAPD2 knockdown. The results demonstrated that NCAPD2 knockdown downregulated β-catenin (Figure 5(b)). The detection of several Wnt pathway-related proteins further indicated the potential regulatory effects of NCAPD2 on the Wnt pathway (Figure 5(c)).

Notably, we found that the regulation of Wnt pathway-related protein levels and OSCC cell phenotypes by NCAPD2 overexpression was partially reversed by treatment with a Wnt pathway inhibitor (Figure 5(d-f)). Increasing evidence indicates that aberrant regulation of the Wnt/β-catenin signaling pathway has been associated with the occurrence, invasion, and metastasis of various cancers [30–32]. Abnormal activation of the Wnt/β-catenin signaling pathway enhanced the transcription of c-Myc and cyclin D1, promoting the progression of HNSCC [33,34]. A previous study demonstrated that OSCC is associated with Wnt signaling pathways [35].

Although the importance of the role played by NCAPD2 in cancer has begun to be unveiled, the underlying mechanism is yet to be elucidated [13]. Existing studies have found that NCAPD2 promotes the progression of colon cancer by regulating autophagy, and promotes the progression of breast cancer by regulating CDK1 [12,21]. Our preliminary findings indicate that NCAPD2 promotes OSCC through Wnt signaling pathway, but it is still unclear which factor plays a role between NCAPD2 and the Wnt signaling pathway. We plan to elucidate this in our future studies.

In conclusion, NCAPD2 promotes the proliferation and migration of OSCC cells, and inhibits apoptosis by activating the Wnt/β-catenin signaling pathway. Our findings reveal, for the first time, the presence of NCAPD2 as a tumor-promoting factor for OSCC, providing a new potential target for molecular targeted therapy.

Informed consent

All patients provided written informed consent.

Ethical approval

The tissue specimens used in this study were reviewed and approved by the Ethics Committee of the Affiliated Hospital of Inner Mongolia Medical University (KY2021008). The animal experiment was approved by the Ethics Committee of Inner Mongolia Medical University (YKD202101034).

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The data that support the findings of this study are available from the corresponding authors, Z.H. and W.J., upon reasonable request.

Supplemental material

Supplemental data for this article can be accessed online at https://doi.org/10.1080/15384101.2024.2348918

Additional information

Funding

This study was financially supported by the Natural Science Foundation of Inner Mongolia [grant number [2021LHMS08037] and Inner Mongolia Medical University Program [grant number [YKD2022MS056].