Oleanolic acid inhibits cholesterol synthesis by suppressing the expression and enzymatic activity of HMGCR

ABSTRACT

This study investigated the impact of Oleanolic Acid (OA) on cholesterol metabolism and. MTT assays demonstrated that OA had no cytotoxic effects on HepG2 cells at concentrations below 20 μM. Subsequent experiments focused on 3-hydroxy-3-methyl-glutaryl-CoA reductase (HMGCR), a key enzyme in cholesterol biosynthesis. OA significantly reduced HMGCR protein expression without affecting other enzymes. Further investigations revealed that OA reduced the protein and mRNA expression of HMGCR and its upstream regulator Sterol regulatory element binding protein-2 (SREBP-2) in HepG2 cells. OA activated Adenosine 5’-monophosphate (AMP)-activated protein kinase (AMPK), enhancing HMGCR phosphorylation and inhibiting its activity. Molecular docking experiments suggested that OA could suppress HMGCR enzymatic activity through hydrophobic interactions, reducing catalytic efficiency. Overall, OA downregulated HMGCR expression and activity, leading to decreased cholesterol synthesis. These findings highlight OA’s regulatory role in cholesterol metabolism and its potential for improving atherosclerosis (AS), supporting its application in functional food development.

KEYWORDS:

• Oleanolic acid
• HMGCR
• cholesterol synthesis
• molecular docking simulation

1. Introduction

Cholesterol, also known as cholesterin, is a metabolite in the human body. Nearly all cells have the capability to synthesize cholesterol, with approximately 80% of total cholesterol synthesis occurring in the liver (Tao et al., 2013). In medical practice, there is an urgent need for compounds that can selectively inhibit cholesterol synthesis to treat elevated LDL-C levels (Zodda et al., 2018), thereby maintaining optimal LDL-C levels and reducing the risk of atherosclerotic cardiovascular disease (CVDs). At present, statins are commonly used in clinical practice to regulate HMGCR to inhibit cholesterol synthesis (Istvan & Deisenhofer, 2001). However, long-term use of statins can induce side effects, such as muscle spasms, liver injury, diabetes, and cataracts (Attardo et al., 2022; Averbukh et al., 2022; Dobrzynski & Kostis, 2015; Galicia-Garcia et al., 2020). Therefore, solely relying on statins for the treatment of CVDs is not feasible (Sirtori, 2014). Recent studies have found that oleanolic acid (OA), a natural small molecule compound extracted from medicinal plants and food, acts as a cardioprotective agent for the prevention and treatment of heart diseases (Sun et al., 2019) and improves the incidence rate of CVDs and AS (Buus et al., 2011; Q. Zhang et al., 2021). The occurrence of atherosclerosis (AS) is mainly related to cholesterol accumulation in the body (Thomas et al., 2022), and HMGCR, as the key rate-limiting enzyme in the pathway of cholesterol synthesis, is the primary target of most cholesterol inhibitors (Lu et al., 2020).

OA is a widely occurring triterpenoid pentacyclic natural small molecule compound. It can be extracted from as many as 1600 kinds of plants, such as olive leaves with a high content of up to 8 mL/g plant material (Sánchez-Avila et al., 2009), root parts of Lantana camara L. with a content of 1.23% (DW roots) (Verma et al., 2013), Ligustrum lucidum Ait with a content of 6.3 ± 0.25 mg/g (Xia et al., 2012) etc. According to statistics, OA exists in free and saponin forms in 146 families, 698 genera, and 1620 species of plants, including roses, madder, Aristolochia, gardenia, Rhamnus, and ginseng (Xu et al., 2014). OA is not only an important ingredient in many plants but also an effective component that plays a biologically active function in some traditional Chinese medicines. OA has a relieving effect on liver and kidney injuries (Liu et al., 2022), protective effect on the gastrointestinal tract (Shi et al., 2021), anti-cancer and anti-obesity effects (Djeziri et al., 2018; Gao et al., 2023), and can improve AS and CVDs (Buus et al., 2011). However, the pharmacological mechanism of OA is still under exploration.

Therefore, this study chose OA as the research object, hypothesizing that it could reduce cholesterol levels by targeting and inhibiting HMGCR, the key rate-limiting enzyme in the cholesterol synthesis pathway. To verify this hypothesis, we first observed whether OA could inhibit cholesterol levels in HepG2 cells and further studied the regulatory effect of OA on the SREBP-2/HMGCR signaling pathway, i.e. reducing cholesterol synthesis by inhibiting the protein level and gene expression of SREBP-2/HMGCR in HepG2 cells. Simultaneously, we explored the possible pathway of OA regulating HMGCR enzyme activity and found that OA regulates the phosphorylation state of HMGCR by inhibiting AMPK phosphorylation, leading to an increase in the ratio of HMGCR phosphorylated protein to total protein, thereby inhibiting the enzyme activity of HMGCR. Lastly, we studied whether the interaction between OA and HMGCR affects HMGCR’s enzyme activity, demonstrated the binding site of HMGCR and OA through computer molecular docking simulation, and proved the direct binding between OA and HMGCR through molecular interaction experiments. In summary, this study provides new ideas and a theoretical basis for developing therapies targeting HMGCR for treating AS and functional foods primarily comprising natural small molecule compounds.

2. Materials and methods

2.1. Reagents

The materials utilized in this study were as follows: OA (≥97%, #O110088), 25-Hydroxycholesterol (≥99%, #C130176), and Lovastatin (≥98%, # L107709) obtained from Aladdin (Shanghai, China). LDL (≥98%, #AY-1502) acquired from AngYu Biotechnologies Ltd. (Shanghai, China). HMG-CoA Reductase Activity Assay test kit (Colorimetric) (ab204701) was purchased from Abcam (Shanghai, China). The antibodies utilized were: Antibodies against Phospho-HMGCR (Ser872) (Abmart, #PY3865) diluted 1:1000. Antibodies against AMPK (Abmart, #T55326) diluted 1:1000. Antibodies against DHCR7 (Abmart, # PHY2844) diluted 1:1000. β-Tubulin antibody (Abmart, #M20005) diluted 1:5000. All antibodies were purchased from Abmart (Shanghai, China). Antibodies against HMGCR (#ab242315) purchased from Abcam (Shanghai, China) at a dilution of 1:1000. Antibodies against SREBP2 (#sc -13552) and DHCR24 (#sc -398938) purchased from SCBT (Shanghai, China) at a dilution of 1:1000. Antibodies against SQLE (#A2428) and ACLY (#A3719) purchased from Abclonal (Wuhan, China) at a dilution of 1:1000. Recombinant Human HMGCR protein (ab132810; Abcam), Acetoacetyl-CoA sodium salt hydrate (A1625; Sigma-Aldrich), and HMG-CoA (H6132; Sigma-Aldrich) were used exclusively for SPR study purposes.

2.2. Cell culture

The HepG2 (KCB200507YJ) cell lines were procured from the Kunming Cell Bank, Committee for Culture Preservation, Chinese Academy of Sciences. These cell lines were cultivated in DMEM medium (MA0545, Meilunbio) supplemented with 1% Penicillin-Streptomycin Liquid (P1400, Penicillin 100 U/mL, streptomycin 100 μg/mL, Solarbio). Additional experiments were conducted both with and without the addition of 10% Fetal Bovine Serum (FBS 10099–141, GibcoTM, Australia). Standard culture conditions were maintained throughout.

2.3. Measurement of cholesterol content in cells

The total cholesterol content levels were quantified using a commercially available kit (A111-1-1) obtained from Nanjing Jiancheng Bioengineering Institute. The measurement was performed following the manufacturer’s instructions precisely. Bioengineering Institute.

2.4. Cell proliferation

The cytotoxic effect of OA was determined in HepG2 cells using the MTT assay after 48 and 72 hours. The cells were cultured in DEME supplemented with 100 U/mL penicillin and 100 μg/mL streptomycin, seeded at a density of ~ 1 × 10⁴ cells/200 μL in 96-well plates, and incubated overnight at 37°C under an atmosphere of 5% CO₂. Subsequently, the culture medium was replaced with a medium containing 5 μM to 40 μM concentrations of OA dissolved in DMSO. After 72 hours, MTT (5 mg/mL) was added to each well and incubated for 4 hours in the dark. The formazan products generated by the viable cells were dissolved in DMSO, and the absorbance was measured at 490 nm. Cell viability (%) was calculated by comparing the absorbance with that of the control wells, which contained only cell culture medium with equal quantities of the solvent used for dissolving the drugs. The experiments were performed in triplicate.

2.5. Cell growth assays

HepG2 cells were cultured in a DEME medium supplemented with penicillin (100 U/mL) and streptomycin (100 μg/mL). Cells were seeded at a density of ~ 6 × 10⁵ cells/4 mL in 60 mm dishes and incubated overnight at 37°C with 5% CO₂. The medium was then replaced with a drug-containing medium with concentrations ranging from 5 μM to 40 μM, dissolved in DMSO. The corresponding concentration of drugs was changed every three days. After treatment, the cells were fixed with 4% paraformaldehyde and stained with 1% crystal violet solution. The stained cells were photographed and quantified by measuring OD values at 490 nm after elution with 5% SDS. Triplicate experiments were conducted.

2.6. Cell morphology assessment assay

For cell morphology assessment, HepG2 cells were cultured and passaged using the previously described method. The cells were then seeded into 60 mm dishes at a density of 800,000 cells/dish. After washing with preheated PBS, the cells were treated with drug-containing serum-free DMEM medium at various concentrations. Cell morphology was observed daily using an inverted biomicroscope (Quanta 200, America) at × 200 magnification. The serum-free DMEM medium was replaced every 3 days with the same concentration of drug. Pictures were taken to document any changes in cell morphology.

2.7. Western blot analyses

HepG2 cells were lysed using a phosphatase inhibitor cocktail (A10014S, Abmart) and Cell Lysis Solution (PMSF: RIPA = 1:100; R0010, Solarbio). The proteins were separated by 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and transferred to 0.45 μm polyvinylidene fluoride membranes (PVDF, Millipore, Shanghai, China). Antibodies were used for blot probing. Immunoreactive proteins were detected using an enhanced chemiluminescence (ECL) detection kit. Quantification was performed using ImageJ software (National Institutes of Health, Bethesda, MD, U.S.A.).

2.8. Real-time quantitative PCR analysis PCR

Total RNA was extracted from HepG2 cells using Trizol reagent (9108; Takara, Japan) and reverse transcribed into cDNA using the PrimeScriptTM RT reagent kit with gDNA Eraser (RR047Q; Takara, Japan), as per the manufacturer’s instructions. Quantitative real-time PCR was performed on the LightCycler480 II Real-Time PCR System(05015243001, Roche Diagnostics. Co. Ltd., Germany)using SYBR Green (RR820A, Takara, Japan) as the detection method. The expression levels of the target genes were normalized to the 2^−ΔΔCT method and β-actin was used as the housekeeping gene. The primer sequences for real-time PCR were as follows: Human HMGCR 5′ CTTGTGTGTCCTTGGTATTAGAGC 3′ (Forward) and 5′ ATCATCTTGACCCTCTGAGTTACAG 3′ (Reverse); Human SREBP-2, 5′ CAAGAAGAAGGCTGGAGAC 3′ (Forward) and 5′ CACCACCGACAGATGATG 3′ (Reverse); β-actin 5′ ACAGAGCCTCGCCTTTGCCG 3′ (Forward) and 5′ ACATGCCGGAGCCGTTGTCG 3′ (Reverse).

2.9. HMG-CoA reductase inhibition assay

The HMG-CoA reductase inhibition assay was conducted following the manufacturer’s instructions (Sigma-Aldrich CS-1090, St. Louis, MO, U.S.A.). NADPH aliquots (4 μL, final concentration 400 μM) and HMG-CoA substrate (12 μL, final concentration 0.3 mg/mL) were dispensed into UV-compatible 96-well plates. Phosphate buffer pH 7.4 was added to achieve a final volume of 0.2 mL per well. At time point 0, 2 μL of HMG-CoA reductase (enzyme protein concentrate with a concentration of 0.50 to 0.70 mg/mL) was added, followed by incubation at 37°C, in the presence or absence of 1 μL pravastatin. The consumption of NADPH was measured every 20 seconds for 600 seconds by monitoring the decrease in absorbance at 340 nm using a SpectraMax M5 device (Molecular Devices, Sunnyvale, CA, U.S.A.). The rate of NADPH oxidation was expressed as μmol/min/mg.

2.10. Surface plasmon resonance (SPR) analysis

The recombinant HMGCR protein was immobilized onto a Series S CM5 sensor chip coated with 10 μg/mL of 10 mM sodium acetate (pH 4.5). Amine coupling facilitated the achievement of a surface density of 10,000 RU using the amine conjugation kit (GE Healthcare, Uppsala, Sweden). To analyze kinetics and affinity, various concentrations of OA (6.25–100 µM) were tested against recombinant human HMGCR, employing PBS-P buffer (20 mM phosphate buffer, 2.7 mM KCl, 137 mM NaCl, and 0.05% v/v P20 surfactant) at 10 μL/min flow rate and 25°C. Binding analyses were completed under the same conditions but at a higher flow rate of 30 μL/min. Subsequently, the binding curves were analyzed using a kinetic binding model in the Biacore Evaluation Software (GE Healthcare, MA, United States).

2.11. Molecular docking simulation

First, the structure files for HMGCR and OA were downloaded from the PDB database. The AutoDock 4.2.6 software (Morris et al., 2009) (version 4.2.6, The Scripps Research Institute, La Jolla, CA, U.S.A.) was then opened for molecular docking calculations. The specific steps for docking are as follows: (1) The protein structure of HMGCR was hydrogenated, charges were computed, and atomic types were modified using AutoDockTools to convert it into a PDBQT file. Likewise, the OA small molecule was converted into a PDBQT file after examining its charges, determining the rootDAT, and selecting suitable ligand torsionable bonds. This completes the coordinate files for the system. (2) AutoGrid was used to estimate the affinity between OA and HMGCR. To minimize energy, the maximum iteration was set as 1000, and the convergence criterion was restricted to 0.001 kcal/mol/Å. To identify the binding sites of OA within the protein molecule, OA and HMGCR were docked by setting the size of the grid box, and the docking results were saved as a gpf file. (3) AutoDock was employed to dock the ligand OA into the catalytic active site of the receptor HMGCR. The protein was opened, and the receptor protein was set as rigid. The Local Search Parameters algorithm was selected, followed by setting the docking parameters and exporting the file in dpf format. (4) Finally, the results were analyzed using AutoDock Tools. The file mentioned earlier was opened, and after energy-based sorting, the docking results between OA and HMGCR were examined. To visualize the results, the most reasonable docking position was chosen, and the results were exported in.pdb format for visualization using PyMOL software (ver. 1.8.4.2). Additionally, Ligplot⁺ software (Laskowski & Swindells, 2011) and Discovery Studio™ (M. M. Zhang et al., 2021) were used to calculate the hydrophobic binding ability of the obtained results.

2.12. Statistical analysis

The data obtained from the experiments were presented as mean ± SEM. To analyze the statistical differences between groups, GraphPad Prism 8.0 (GraphPad Software, San Diego, CA) was employed. For the comparison of the two groups, a t-test was performed. Meanwhile, for comparisons involving more than two groups, a one-way ANOVA was conducted followed by Dunnett’s post hoc test. A significance level of p < .05 was used to determine statistical significance. The results with p < .05 were considered statistically significant.

3. Results

3.1. OA inhibits cholesterol synthesis in HepG2 cells

OA, a natural pentacyclic triterpenoid compound, is widely present in nature (Figure 1(a)). Given the close correlation between cholesterol levels and atherosclerosis, we studied the effects of OA on HepG2 cells. The MTT assay was employed to evaluate the impact of OA on HepG2 cell viability. Results revealed no significant effect on cell vitality at concentrations below 20 μM after 6 hours of treatment, with the IC₅₀ value determined to be 52.12 μM (Figure 1(b)). Following this, we examined the effect of OA treatment on cholesterol content in HepG2 cells after 6 (Figure 1(c)). Compared to the blank control group, different concentrations of OA treatment significantly inhibited intracellular cholesterol content at both time points. To further study the impact of cholesterol reduction on cell growth, we examined the effect of various concentrations of OA on cell generation. The results showed that with an increase of OA concentration from 2.5 μM to 7 μM, cell growth was significantly inhibited. However, the addition of 10 μg/mL of cholesterol significantly improved the growth of cells compared to the untreated control group (Figure 1(d)). According to literature (Chakraborty et al., 2020), deficiency of intracellular cholesterol, especially when cholesterol self-synthesis is significantly reduced, affects cell survival rate and morphology. In the morphological observation experiment (Figure 1(e)), we found that compared to the control group, the cells in the drug group underwent significant changes, shrinking and becoming round; whereas the LDL group with added 10 μg/mL cholesterol significantly improved cell morphology. This indicates that adding LDL can partially restore the cellular morphological changes caused by OA. In summary, our research results show that OA, by inhibiting cholesterol synthesis, can alter the morphology of HepG2 cells and even cause cell death.

Figure 1. Illustrates the impact of OA on cholesterol synthesis in HepG2 cells. The chemical structure of OA is depicted in (a). Cell viability was assessed after a six-hour treatment with different concentrations of OA in HepG2 cells (b). The results revealed a significant inhibition of cholesterol levels by OA in HepG2 cells after both 6 hours (c) of treatment. To investigate long-term effects, HepG2 cells were exposed to OA for eight days with or without cholesterol supplementation. The absorbance at 560 nm was measured after removing crystal violet with 5% SDS (d). Effects of OA treatment on HepG2 cell morphology after 8 days (e). Comparing the upper layer cells, which were untreated, treated with 10 μM OA, or treated with 10 μM lovastatin, with the lower layer cells that received concurrent supplementation of 10 μg/mL cholesterol provided insights into the effects of OA and cholesterol. The abbreviations used are as follows: OA for oleanolic acid and CHOL for cholesterol. Statistical analysis revealed significance with *p < .05, **p < .01, ***p < .001 compared to the control group, and #p < .05, ##p < .01, ###p < .001 compared to the cholesterol group. The presented data represent the mean ± standard error of at least three replicates. Statistical comparisons were made against the OA 0 μM group (*p < .05, **p < .01, ***p < .001).

3.2. OA affects HepG2 cell cholesterol synthesis key enzyme protein levels

OA significantly inhibits cholesterol synthesis in HepG2 cells, as demonstrated by the reduction in intracellular cholesterol content following OA treatment. Endogenous cholesterol synthesis is a multi-step pathway involving energy metabolism and over 30 enzymatic reactions. In this pathway, the generation of mevalonic acid is an irreversible process. The key rate-limiting enzyme HMGCR, which catalyses the formation of MVA from HMGC-CoA, plays an important role in this process. Therefore, we further examined the expression levels of various protein enzymes including HMGCR, as well as its upstream and downstream enzymes. As shown in Figure 2(a), compared to the control group, 10 μM of OA had no effect on the protein levels of key upstream and downstream enzymes such as ACLY, DHCR7, DHCR24, and SQLE in HepG2 cells, but significantly reduced the expression level of HMGCR. In summary, our results suggest that OA reduces cholesterol levels in HepG2 cells by inhibiting the key rate-limiting enzyme HMGCR in the cholesterol synthesis pathway.

Figure 2. Impact of OA on key enzyme protein levels involved in cholesterol synthesis in HepG2 cells. (a) Effect of OA on the expression of ACLY, HMGCR, SQLE, DHCR7, DHCR24 proteins in HepG2 cells. (b) Quantification chart of the effect of OA on ACLY protein expression in HepG2 cells. (c) Quantification chart of the effect of OA on HMGCR protein expression in HepG2 cells. (d) Quantification chart of the effect of OA on SQLE protein expression in HepG2 cells. (e) Quantification chart of the effect of OA on DHCR7 protein expression in HepG2 cells. (f) Quantification chart of the effect of OA on DHCR24 protein expression in HepG2 cells. Statistics: values are means±SEM (n=3), *p < .05, ** p <.01, *** p < .001. OA, oleanolic acid.

3.3. OA inhibits HMGCR expression through SREBP2

According to literature, 25HC lowers intracellular cholesterol synthesis by inhibiting the transcription process of SREBP2 (Giordano Attianese & Desvergne, 2015). To validate this observation, we first starved HepG2 cells for 16 hours using serum-free high-glucose medium to deplete endogenous cholesterol (Tang et al., 2011). Then, we added 20 μM of 25HC to the positive control group. Different concentrations of OA (0 μM, 1 μM, 10 μM, 20 μM) were added to the drug treatment groups and cultured for 1 hour. The results showed that compared to the blank control group, with an increase in OA concentration, the expression levels of HMGCR and SREBP2 proteins gradually decreased and displayed a linear correlation. At a concentration of 10 μΜ, OA significantly inhibited the protein levels of SREBP2 (Figure 3(a)) and HMGCR (Figure 3(b)) (p < .001). Further RT-PCR experiment results were consistent with protein expression findings (Figure 3(c)), confirming that OA had a similar effect on the gene expression of SREBP2 and HMGCR. In conclusion, our experimental results show that OA is capable of inhibiting the protein and gene expression of SREBP2 and HMGCR in HepG2 cells.

Figure 3. The influence of OA on SREBP2/HMGCR protein levels. (a) Effect and quantification of OA on HMGCR protein expression in HepG2 cells. (b) Effect and quantification of OA on SREBP-2 protein expression in HepG2 cells. (c) Influence of OA on HMGCR gene expression in HepG2 cells. (d) Impact of OA on SREBP2 protein expression in HepG2 cells. Statistics: values are means±SEM (n=3), *p < .05, **p < .01, ***p < .001. OA, oleanolic acid.

3.4. OA inhibits HMGCR enzyme activity

The level of HMGCR activity directly affects the efficiency of cholesterol synthesis. Besides physiological regulation of negative feedback in steroid metabolism, HMGCR activity can also be regulated by targeted drugs, which are used for AS clinical treatment. Therefore, not only did we verify the restrictive effect of OA on HMGCR synthesis, but we also explored its impact on HMGCR activity. We used the HMG-CoA reductase assay kit to determine the effect of OA on the oxidation level of the catalytic subunit NADPH of HMGCR. Under the condition of 100% of 10 μM lovastatin as the positive control group, the results showed (Figure 4(a)) that at a concentration of 10 μM, OA could inhibit about 20% of HMGCR enzyme activity. As OA concentration increased, the inhibition rate gradually increased and reached nearly 76% inhibition at 100 μM. The WB experiment detected the protein expression of HMGCR and p-HMGCR. The results showed that as the action time increased, the expression level of HMGCR decreased, while p-HMGCR showed the opposite trend (Figure 4(b)). Cholesterol metabolism strictly regulates the changes in the phosphorylation status of HMGCR. Normally, phosphorylation of HMGCR would reduce its binding ability with NADPH, thus decreasing the cholesterol synthesis efficiency of liver cells. The ratio of phosphorylated content to total content reflects the inactivation state of HMGCR. AMP kinase in the liver is the main kinase regulating HMGCR phosphorylation (Yap et al., 2020). When intracellular cholesterol levels reach saturation, AMPK is activated, leading to an increase in HMGCR phosphorylation, thereby reducing its activity and terminating cholesterol synthesis. Therefore, we further examined the protein expression levels of AMPK and p-AMPK. The results showed (Figure 4(c)), with a constant total protein level of AMPK, that the protein expression level of p-AMPK increased, indicating that the phosphorylation level of AMPK increased over time. In conclusion, with the passage of time, OA stimulation significantly enhanced the phosphorylation modification of HMGCR in HepG2 cells, putting it into an inactive state, which may be achieved by regulating the phosphorylation of AMPK.

Figure 4. OA reduces HMGCR enzyme activity through the AMPK signaling pathway. (a) Influence of different concentrations of OA compared to lovastatin on the inhibition rate of HMGCR enzyme activity. (b) Impact of OA on HMGCR and p-HMGCR protein levels in HepG2 cells. (c) Effect of OA on AMPK and p-AMPK protein levels in HepG2 cells. Statistics: *p < .05, **p < .01, ***p < .001 versus the control group; ns, not significant (p > .05). OA, oleanolic acid; HMGCR, 3-hydroxy-3-methylglutaryl-coenzyme a reductase.

3.5. OA directly binds HMGCR through hydrophobic interaction to inhibit enzyme activity

To further determine the specific mechanism of OA inhibiting HMGCR enzyme activity, we first confirmed through surface plasmon resonance technology (SPR) that OA (3.125–100 μM) (Figure 5(a)) can bind to HMGCR with a KD value of 79.44 μM. Following this, we used ligand-receptor docking models to explore the molecular recognition mechanism between OA and HMGCR. We performed docking simulations with fixed docking sites on HMGCR according to reference (Istvan & Deisenhofer, 2001). The results showed that the stable complex formed by OA and HMGCR was an induced-fit model, with the binding free energy size between the receptor and ligand being −1.91 cal/mol. Further analysis of OA’s molecular docking results with HMGCR revealed that the chemical structure of OA contains five aromatic rings, which fit perfectly within the catalytic domain of HMGCR, thereby reducing HMGCR’s ability to catalyse substrates. In addition, using Ligplot⁺ software to calculate the interaction mode of the small molecule OA with HMGCR, the results showed hydrophobic interactions occurring between OA and hydrophobic amino acid residues of HMGCR such as Gln679, Glu726, Glu677, Met678, Pro676. By using Discovery Studio™ for calculation, we obtained similar results, namely, numerous hydrophobic bonds exist between OA and HMGCR protein. In conclusion, OA mainly binds to HMGCR through hydrophobic interactions, and these interactions might be the primary reason for inhibiting HMGCR enzyme activity.

Figure 5. OA inhibits enzyme activity by directly binding to HMGCR through hydrophobic interactions. (a) Binding/dissociation/dissociation curves of different concentrations of OA with HMGCR. (b) Affinity size between OA and HMGCR. (c) The 3D docking result of OA with HMGCR. (d) Analysis of the internal forces of OA-HMGCR using Ligplot⁺ software. (e) Analysis of the internal forces of OA-HMGCR using discovery Studio™ software.

4. Discussion

Research has found that excess endogenous cholesterol acts as one of the primary causes of various metabolic diseases, particularly atherosclerosis (AS) and cardiovascular diseases (CVD) (Ruparelia & Choudhury, 2020). The control of cholesterol synthesis is currently considered an important method for treating AS and CVD. Among these, HMGCR, as the rate-limiting enzyme in cholesterol synthesis, plays a key role in statin drugs. However, despite the widespread use of statins in primary and secondary prevention of AS (Muscoli et al., 2022), their efficacy is constrained by compensatory increase in HMGCR protein levels, which may also lead to adverse reactions such as skeletal muscle injury. Therefore, searching for natural bioactive compounds as inhibitors has become a hot topic in functional food research.

Oleanolic acid (OA) is a pentacyclic triterpenoid natural small molecule compound widely distributed in nature (Castellano et al., 2022). Early studies have shown that OA can improve AS in ApoE^−/− mice (Buus et al., 2011) and has vasodilatory effects on isolated aorta of spontaneously hypertensive rats, showing dose-dependency (Rodriguez-Rodriguez et al., 2007). Based on these findings, we further studied the effects of OA on cholesterol synthesis, especially its influence on the risk marker of AS – cholesterol.

Firstly, we evaluated the toxicity of OA to HepG2 cells and found that when the concentration of OA was less than 20 μM, there was no significant impact on the survival rate of HepG2 cells. Cholesterol is a main component of the cell membrane (Liscum & Munn, 1999), with functions of regulating cell membrane fluidity, permeability and resilience, and also participates in signal transduction and material transport (Wong et al., 2019). Therefore, when OA inhibits cholesterol synthesis in HepG2 cells, it leads to a decrease in cell membrane cholesterol content, damage to the cell membrane skeleton, disruption of cell boundaries, inability to complete material exchange, organelle damage, cytoplasmic matrix flowing out from the damaged cell membrane, eventually leading to cell death.

In this regard, we studied the effect of OA on cholesterol synthesis in HepG2 cells through experiments such as measuring intracellular cholesterol content, cell proliferation, and morphological observation (Figure 1). After confirming that OA can inhibit cholesterol synthesis in HepG2 cells, we further investigated the effect of OA on HMGCR and other related enzymes in the cholesterol synthesis pathway. ATP citrate lyase (ACLY) catalyzes the formation of acetyl coenzyme A, the source material for cholesterol synthesis (Feng et al., 2020), and is a key upstream enzyme for HMGCR-catalyzed cholesterol synthesis. Squalene epoxidase (SQLE) catalyzes the formation of 2,3-epoxysqualene from squalene (Yoshioka et al., 2020). Because it catalyzes the first oxygenation reaction in cholesterol synthesis, it is referred to as a key rate-limiting enzyme in cholesterol synthesis along with HMGCR. DHCR7 and DHCR24 are two terminal enzymes in the cholesterol synthesis pathway, capable of reducing 7-dehydrocholesterol and 24-dehydrocholesterol to cholesterol (Kandutsch & Russell, 1960), playing an important role in the final pathway of cholesterol synthesis, and are key downstream enzymes for the HMGCR-catalyzed cholesterol synthesis pathway (Luu et al., 2015). Based on this, we tested the protein effects of OA on ACLY, HMGCR, DHCR7, and DHCR24.

Results showed that OA does not change the protein levels of ACLY, the upstream enzyme of HMGCR, or the downstream enzymes DHCR7, DHCR24, and the second rate-limiting enzyme in the cholesterol synthesis pathway, SQLE, but only reduces the protein expression of HMGCR (Figure 2). These results indicate that HMGCR might be the main target of OA regulation in cholesterol synthesis.

To further explore the mechanism by which OA reduces HMGCR protein expression, we performed Western Blot and RT-PCR analysis and found that OA reduces the protein and gene levels of SREBP2 as well as HMGCR (Figure 3). SREBP2 is a crucial nuclear transcription factor for cholesterol synthesis metabolism enzymes, capable of translocating into the cell nucleus to activate related genes, including HMGCR. Thus, we preliminarily speculate that OA can inhibit cholesterol synthesis in HepG2 cells by suppressing the SREBP2/HMGCR signaling pathway. HMGCR is not only a protein but also has catalytic activity. Its activity is not only restricted by its expression level but also regulated by enzymatic activity. Therefore, we further investigated the effect of OA on HMGCR catalytic activity and found that OA not only inhibits HMGCR expression but also reduces its enzymatic activity (Figure 4(a)). HMGCR activity is closely related to its phosphorylation state. When HMGCR is phosphorylated, its activity is lost; after dephosphorylation, its activity is restored (Luo et al., 2020). AMPK and PP2A are key kinases regulating HMGCR phosphorylation (Ouyang et al., 2019; Soto-Acosta et al., 2017), and the p-HMGCR/HMGCR ratio reflects the inactivation state of HMGCR (X. Zhang et al., 2015). Experimental results show that OA increases HMGCR phosphorylation, rendering HMGCR inactive, which may be achieved by activating the phosphorylation of AMPK (Figures 4(b,c)). These observations are consistent with the study conducted by Jia Liu et al. (2014), wherein OA was reported to impede fatty acid synthesis by activating AMPK, a process involving the phosphorylation of ACC1 and HMGCR in cancer cell lines.

To delve deeper into the mechanism of OA inhibition of HMGCR enzymatic activity, we also conducted molecular docking simulation and molecular interaction experiments. In addition, when the catalytic structure of HMGCR binds with drugs, it cannot react with the substrate HMGC-CoA, leading to decreased enzymatic activity and reaction efficiency. Therefore, we explored whether OA could bind with HMGCR to reduce its enzymatic activity. The results of molecular docking simulation show that OA can bind with HMGCR via hydrophobic interactions (Figures 5(b–d)), possibly related to the chemical structure of OA as a pentacyclic triterpenoid compound. Moreover, molecular interaction experiments confirmed that the affinity between OA and HMGCR is 79.44 μM (Figure 5(a)). Thus, we concluded that OA suppresses enzymatic activity by promoting HMGCR phosphorylation and directly binding with its active site.

Despite the promising findings regarding the inhibitory effects of OA on cholesterol synthesis and its potential implications for AS, it is important to acknowledge the limitations of our current study. Primarily, our investigation has focused on the molecular mechanisms underlying OA’s influence on cholesterol metabolism in HepG2 cells. This in vitro approach, while valuable for elucidating cellular-level effects, may not fully capture the complex interplay of factors involved in AS development in living organisms. Therefore, future studies should aim to assess the direct impact of OA on AS progression using relevant animal models or clinical trials.

In conclusion, this study validated that OA inhibits cholesterol synthesis in HepG2 cells by reducing the expression and inhibiting the activity of HMGCR, and this inhibition is achieved through multiple mechanisms. These findings provide new insights for the development of HMGCR inhibitors and suggest combining OA with statins to overcome the issue of compensatory increase in HMGCR protein levels. Furthermore, this study has clarified that our findings contribute to a better understanding of the molecular mechanisms by which OA may influence AS risk factors. Our research sheds light on the potential of OA as a valuable natural compound for modulating cholesterol synthesis and HMGCR activity, offering insights into novel therapeutic strategies for addressing AS and related cardiovascular conditions.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This study was supported by Yunnan Science and Technology Talents support plan [YNWR-QNBJ-2018-083] and Basic Research Program of Yunnan Province [202301BD070001-029].