Development of a rapid isothermal amplification method for clinical detection of Pseudomonas aeruginosa

ABSTRACT

Background

Pseudomonas aeruginosa (P. aeruginosa) is widely distributed in air, soil, and water, human respiratory tract, intestinal tract, and skin. It can induce bloodstream infection, urinary tract infection, gastrointestinal tract infection, respiratory tract infection, etc. Conventional bacterial isolation, culture, and identification are time-consuming, and many false negative results, which cannot meet the needs of precise clinical diagnosis，and proper treatment. This study aims to develop a rapid isothermal amplification assay of Pseudomonas aeruginosa.

Methods

Specific primers were designed according to the National Center for Biotechnology Information (NCBI) database based on the highly conserved sequence of Pseudomonas aeruginosa virulence factor gene lecA, and a recombinase polymerase amplification (RPA) detection method was established. The sensitivity and specificity were calculated, as well as the collection and processing of clinical samples.

Results

The thermostatic amplification technique for Pseudomonas aeruginosa established in this paper allows nucleic acid detection within 10 minutes without cross-amplification with other bacterial strains. 27 P. aeruginosa infections were accurately detected in 300 clinical samples.

Conclusion

The rapid detection system based on thermostatic amplification had shown high sensitivity and specificity in this study, indicated that this method can effectively assist clinical bacterial detection.

KEYWORDS:

• Pseudomonas aeruginosa
• recombinase polymerase amplification
• detection
• leca
• diagnose

1. Introduction

Pseudomonas aeruginosa is widely distributed in air, soil and water, human respiratory tract, intestinal tract, and skin [1–3], and it is the most common opportunistic pathogen in clinical practice. It is usually pathogenic when the body’s resistance is decreased or mucosa and skin surface are damaged. It can induce bloodstream infection, urinary tract infection, gastro-intestinal tract infection, and respiratory tract infection, etc. [4–6]，and the clinical presentations of Pseudomonas aeruginosa may vary between systemic and local suppurative infections, which often endangers patients’ lives if not treated in time. Many strains are multiple drug resistant, while some strains are extensive drug resistant, which leads to failure of antibiotic therapy [7]. Conventional bacterial isolation, culture and identification are time-consuming and many false negative results, which cannot meet the needs of precise clinical diagnosis，and proper treatment. RPA is a new thermostatic amplification technology developed in recent years [8–10], which mainly relies on the functions of recombinant enzyme that can bind single stranded nucleic acid, single stranded DNA binding protein and DNA polymerase enzyme. The principle of this method is that at the beginning of the reaction, the recombinant enzyme first binds with the amplification primer to form protein-DNA complex, and target sequences homologous to primers are then identified. After positioning to the homologous target sequence, the recombinant enzyme unlocks the double-stranded structure, and promotes the chain exchange between the primer and the template to form the D-ring structure. Meanwhile, the single-stranded binding protein binds to the displaced single-stranded DNA, stabilizes the D-ring structure for ATP hydrolysis and supplies energy, changes the conformation of the recombinant enzyme-primer complex, and the recombinant enzyme dissociates the 3 ‘end of the primer. DNA polymerase binds to the primer to initiate DNA amplification. In the process of DNA polymerase extension, the single strand of DNA replaced binds to the single strand binding protein, stabilizes the single strand structure, and synchronizes the upstream and downstream primers to form a complete amplon. This method has been widely applied in the detection of pathogenic bacteria in recent years, for example, it shows a good application prospect in the clinical detection of Neulococcus albicans [11] and Brucella [12], Yersinia [13], Mycobacterium tuberculosis [14]. As one of the most common opportunistic pathogens of nosocomial infection in healthcare settings, especially with the wide application of broad-spectrum antibiotic (e.g. ampicillin), Pseudomonas aeruginosa mostly becomes drug-resistant bacteria or even multi-drug-resistant bacteria, posing a serious threat to Chinese and even global public health [15–17]. Existing molecular detection techniques for Pseudomonas aeruginosa include polymerase chain reaction (PCR), nested PCR and Dot blot [18,19], but these methods are relatively time-consuming. The complete amplification reaction usually requires at least 1.5 h, and low sensitivity for the relatively low concentration of Pseudomonas aeruginosa in the clinical samples (the usual detection limit should be 100 copies). In order to speed up the accurate diagnosis of Pseudomonas aeruginosa infection, this paper established a recombinase polymerase amplification (RPA) system, and sensitivity and specificity were calculated.

2. Materials and methods

2.1. Samples and sources

The strains used were 1 standard strain of Pseudomonas aeruginosa (ATCC 27,853) and 10 strains of Pseudomonas aeruginosa collected from urine of patients with hospital urinary tract infection after MALDI-TOF MS detection by stroma-assisted laser desorption ionization time-of-flight mass spectrometry.

The 300 samples for clinical validation of urinary tract infection were taken from hospitalized patients with suspected urinary tract infection, including 189 males and 111 females aged 19–73. Other bacterial strains used in the experiment were isolated from the laboratory of the First Affiliated Hospital, Zhejiang University School of Medicine and verified by stroma-assisted laser desorption ionization time-of-flight mass spectrometry.

2.2. Bacterial transformation and identification

The above 10 pure culture strains (Labeled from PA-1 to PA-10) and 1 standard strain (Table 1) were transferred together with other 9 clinical/standard strains on blood AGAR plates for prim-specific testing, respectively, and cultured at 37°C for 24 h, then identified by MALDI-TOF MS.

Table 1. Specific detection results of the RPA detection system.

Name	Results	Name	Results
PA-1	+	Streptococcus pneumoniae	–
PA-2	+	Proteusbacillus vulgaris	–
PA-3	+	Haemophilus influenzae	–
PA-4	+	Staphylococcus aureus	–
PA-5	+	Pseudomonas putida	–
PA-6	+	Pseudomonas pseudomallei	–
PA-7	+	Staphylococcus epidermidis	–
PA-8	+	Pseudomonas fluorescens	–
PA-9	+	Klebsiella pneumoniae	–
PA-10	+	Pseudomonas aeruginosa standard strain	+

2.3. Bacterial genome DNA extraction

The bacterial genomic DNA was extracted rapidly according to the instructions of the bacterial genomic DNA extraction kit, and the concentration of nucleic acid was determined by Nanodrop2000 ultra micro spectrophotometer. DNA samples from standard strains of Pseudomonas aeruginosa for positive control group were diluted by a 10-fold series dilution, The final concentration includes 1 copy/μL, 10 copy/μL, 10² copy/μL, 10³copy/μL, 10⁴copy/μL, 10⁵copy/μL, and 10⁶copy/μL for backup. For other bacteria (see Table 2) for their negative control group, genomic DNA was extracted in the same way as the above steps, but the final concentration was uniformly adjusted to 104 copy/μL for reserve.

Table 2. Primers for the detection of Pseudomonas aeruginosa.

Name	Sequence
TL-LecA-R	TGGGCCAGTTACGGACCTACCCAGAAATGGGG
TL-LecA-F	CCGCTGTTGCCAATCTTCATGACCAGCGCACC
TL-LecA-P	CATCCGGACCAAGGGCTGATCTGCCACGA [dT-FAM]G[THF]G[BHQ-1] TTTGTGGTGCGCTG-C3-spacer

2.4. Design of RPA primers and establishment of thermostatic amplification detection system

2.4.1. Primer design

Based on the highly conserved lecA sequence of the Pseudomonas aeruginosa virulence factor gene (lectin) published in the National center for biotechnology information (NCBI) database of the United States, primers for thermostatic amplification were designed (Table 2). And sent to Shanghai Gerui Biological Engineering Co., Ltd. for synthesis.

2.4.2. Establishment of reaction system

Add each reagent, establish the reaction system, accumulated 50 μL: DNA 10 μL, forward primer 2.1 μL, reverse primer 2.1 μL, probe primer 0.6 μL (primer concentration all 10 μmol), rehydration buffer 29.5 μL (commercial kit), RNase-free water sterilization deionized water 3.2 μL and magnesium acetate 2.5 μL were added to the amplification tube containing recombinant enzyme, amplification enzyme and other dry powder enzymes.

2.4.3. Sensitivity and specificity

Positive control group: Add 10 μL of extracted DNA template to the reaction tube, perform instantaneous centrifugation at 2,000rpm, add activator magnesium acetate at 2.5 μL, immediately place the reaction tube in an instrument set in advance to collect fluorescence signals at 39°C for 10 min, and collect fluorescence signals every 30 seconds.

Negative control group: Specific validation of primers was conducted according to the reaction system and reaction conditions. Specifically, according to the reaction system described above, the extracted bacterial template with a concentration of 10⁴copy/μL in above was added to the amplification tube respectively, and placed in the instrument set in advance to collect fluorescence signals under the reaction condition of 39°C for 10 min, and fluorescence signals were collected every 30S.

2.5. Clinical sample detection and application

Urine samples of 300 inpatients in urology department were collected for bacterial isolation and confirmed to contain pseudomonas aeruginosa by mass spectrometry. Then, the effectiveness of the Pseudomonas aeruginosa detection method established in this study was tested.

3. Results and discussion

3.1. Sensitivity and specificity of RPA detection

In this paper, a thermostatic detection system for Pseudomonas aeruginosa was established, which could complete DNA amplification and nucleic acid detection of Pseudomonas aeruginosa within 10 min, and the sensitivity was single copy/μL, as shown in Figure 1. The DNA of clinical isolates of Pseudomonas aeruginosa, standard strains and common bacteria of infection were used as the specific evaluation template of the RPA detection system. The results showed that the primers used in the system could only amplify Pseudomonas aeruginosa, and other strains showed amplification signals, indicating that the detection technology had good specificity, as shown in Table 1.

Figure 1. Sensitivity analysis of the thermostatic amplification detection system for Pseudomonas aeruginosa.

3.2. Clinical application effect of RPA system

The presence of Pseudomonas aeruginosa was detected in 27 urine samples from 300 hospitalized patients with urinary tract infection. The results were consistent with the results of urine culture and mass spectrometry, which confirmed that the method can effectively improve the detection result of Pseudomonas aeruginosa in clinical samples.

4. Conclusion

In this paper, a thermostatic amplification detection system for Pseudomonas aeruginosa was established based on recombinant enzyme polymerase amplification technology. This method does not require expensive equipment to change temperature, but only requires a thermostatic amplification instrument that can recognize fluorescence signals to complete the amplification of nucleic acid samples. From the experimental results, pseudomonas aeruginosa nucleic acid detection sensitivity of single copy/μL, and other negative control bacteria did not produce nonspecific amplification phenomenon, proved that the method has high sensitivity and specificity. At the same time, compared with the long consumption time of conventional bacterial isolation, culture and identification, the thermostatic detection technology of Pseudomonas aeruginosa established in this paper can directly complete the detection of clinical samples within 10 min, breaking the bottleneck of culture and greatly shortening the detection time. In clinical sample test, this method can detect Pseudomonas aeruginosa in 27 out of 300 urine samples. In summary, this method can effectively assist clinical bacterial detection.

Abbreviation

MDR	=	Multiple Drug Resistant strains
PCR	=	Polymerase chain reaction
RPA	=	Recombinase polymerase amplification

Authors’ contribution statement

Li-Guo Liang & Yan Shen designed the study; Li-Guo Liang, Yan Shen, Si-Ming Lu, and Dan-feng Zheng writing-original draft preparation and revised; Data analysis, Qian-da Zou, Yi Tang, Sheng-chao Li; Supervision, Li-Guo Liang, Dan-feng Zheng; Funding acquisition, Li-Guo Liang. All authors reviewed the manuscript and all authors have read and agreed to the published version of the manuscript.

Ethical standards

The ethics committee number is IRB2023495. All samples are discarded samples and do not require informed consent from patients. The clinical research ethics committee of the first affiliated hospital, college of medicine, Zhejiang/IRB that approved the study and the protocol was approved by the first affiliated hospital, college of medicine, Zhejiang in accordance with the relevant guidelines and regulations.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Additional information

Funding

This work was supported by Zhejiang Provincial Natural Science Foundation of China (#LTGY23H160001, #2018ZX10711001), and Zhejiang Provincial Health Major Science and Technology Program (WKJ-ZJ-2434), Zhejiang Provincial Key Research and Development Program (#2021C03043), and Key Laboratory of Biomarkers and In Vitro Diagnosis Translation of Zhejiang province (KFJJ2023012).

Notes on contributors

Yan Shen

Yan Shen, received her BE degree in Medical Laboratory Technology from Zhejiang Chinese Medical University, China. Now she is working in the Department of Laboratory Medicine, the First Affiliated Hospital, Zhejiang University School of Medicine.

Si-ming Lu

Si-ming Lu, received her BE degree in Medical Laboratory Technology from Zhejiang Chinese Medical University, China in 2016, and, earning her Master of Clinical Laboratory Diagnostics degrees from Zhejiang University, China, in 2019. Now she is working in the Department of Laboratory Medicine, the First Affiliated Hospital, Zhejiang University School of Medicine.

Qian-da Zou

Qian-da Zou, graduated from Medical Laboratory Medicine at Zhejiang University in 2019, working in the Department of Laboratory Medicine, the First Affiliated Hospital, Zhejiang University School of Medicine.

Yi Tang

Yi Tang, received her BE degree in Medical Laboratory Technology from Zhejiang Chinese Medical University, China. Now she is working in the Department of Laboratory Medicine, the First Affiliated Hospital, Zhejiang University School of Medicine.

Sheng-chao Li

Sheng-chao Li, graduated from the Department of Medical Laboratory Technology at Zhejiang Chinese Medical University. Now she is working in the Department of Laboratory Medicine, the First Affiliated Hospital, Zhejiang University School of Medicine.

Dan-feng Zheng

Dan-feng Zheng, received her Ph. D degree from Peking University, now she is working in the Department of Laboratory Medicine, the First Affiliated Hospital, Zhejiang University School of Medicine.

Li-guo Liang

Dr. Li-guo Liang, received his BE degree in Biochemistry & Molecular Biology from Zhejiang University, China, in 2019. Since the beginning of his career, he has been mainly engaged in research on pathogenic diagnostic techniques for major and new outbreaks of infectious diseases.