Metformin enhances epithelial cell growth inhibition via the protein kinase–insulin-like growth factor binding protein-1 pathway

Figures & data

Table 1. Homo gene primers for reverse transcription PCR.

Gene	Forward primer (5’–3’)	Reverse primer (3’–5’)
IGFBP1	AGCCAAGGCACAGGAGACATC	TTCCAAGGGTAGACGCACCAG
β-Actin	TGGCACCCAGCACAATGAA	CTAAGTCATAGTCCGCCTAGAAGCA

Figure 1. Normal stromal cells (NSCs) inhibit the growth of Ishikawa cells but not that of eutopic stromal cells (EuSCs) and ectopic stromal cells (EcSCs) (EdU A and B, CCK-8 C). NSCs exert a suppressive effect on Ishikawa cell proliferation compared to the controls; however, the effect of EcSCs and EuSCs was not significantly different from that of the control (p > .05). Scale bar: 50 μm. Values are mean ± SD (n = 3; ns, not significantly different; *, p < .05; ****, p < .0001).

Figure 2. IGFBP1 expression in EuSCs and EcSCs of patients with endometriosis was downregulated. (A) IGFBP1 levels in EuSCs and EcSCs were lower than those in NSCs, as determined using RT-qPCR. (B) IGFBP1 levels in EuSCs and EcSCs were lower than those in NSCs, as determined using western blotting. Values are mean ± SD (n = 3; **, p < .01; ***, p < .001; ****, p < .0001). (C) Immunohistochemistry of IGFBP1 expression in both EuSCs and EcSCs.

Data availability statement

Data will be made available on request.