CYP450 polymorphisms predict clinic outcomes to vinorelbine-based chemotherapy in patients with non-small-cell lung cancer

Figures & data

Table IA.  Primer sequence ,anneal temperature and length of PCR fragment.

SNP	Primer Sequence	Anneal temperature	Length of PCR Fragment
2C19*2(G681A)	Upstream:5′caataaaaatttccccatcaaga3′Downstream: 5′gcttttcctatcctgacatcctt3′	50°C	575bp
2C19*3(G636A)	Upstream:5′aaattgtttccaatcatttact 3′Downstream: 5′acttcaggcttggtcaata3′	54°C	271bp
2D6*4(C188T)	Upstream:5′ctgggtaagggcctggag3′Downstream: 5′acctggtcgaagcatatgg3′	65°C	442bp
2D6*2(C2938T)	Upstream:5′ggcagagatggagaaggtga3′Downstream: 5′ggtgtcccagcaaagttcat3′	65°C	427bp
2D6*2(G4268C)	Upstream:5′cgacactcatcaccaacctg3′Downstream: 5′ggacccgagttggaactacc3′	54°C	499bp
3AP1*3(G−44A)	Upstream:5′caggtgagaggatatttaagaggc3′Downstream: 5′catcgccacttgccttcttcaac3′	54°C	335bp

Table IB.  The restriction enzymes correspond to the polymorphism sites.

SNP	Restriction Enzyme	Reaction Temperature	Length of restriction product
2C19*2(G681A)	Sma I	30°C	399bp + 176bp
2C19*3(G636A)	Bam H I	30°C	177bp + 94bp
2D6*4(C188T)	Hph I	37°C	352bp + 90bp
2D6*2(C2938T)	Hha I	37°C	250bp + 177bp
2D6*2(G4268C)	Bst E II	60°C	377bp + 122bp
3AP1*3(G−44A)	Fau I	37°C	188bp + 147bp

Table IIA.  Baseline characteristic and response for all 59 patients.

Baseline factors	n	Percent (%)
Total Patients Age
≤ 55	29	49
≥ 55	30	51
Median(Range)	55 (30–70)
Gender
Female	17	29
Male	42	71
Histology
Squamous cell carcinoma	20	34
Adenocarcinoma	39	66
Response to chemotherapy
Complete response	1	2
Partial response	23	39
Progressive disease	10	17
No change	25	42

Table IIB.  Single nucleotide polymorphism(SNP) genotype distribution and allele frequencies.

SNP genotyping	n (%)	Allele frequencies
CYP2C19*2(G 681A)
G	28 (50)
G/A	21 (37.5)	G (0.68)
A	7 (12.5)	A (0.32)
CYP2C19*3(G636A)
G	52 (88)
G/A	7 (12)	G (0.96)
A	0 (0)	A (0.04)
CYP2D6*4(C188T)
C	32 (54)
C/T	27 (46)	C (0.77)
T	0 (0)	T (0.23)
CYP2D6*2(C2938T)
C	38 (64)
C/T	20 (34)	C (0.81)
T	1 (2)	T (0.19)
CYP2D6*2(G4268C)
G	0 (0)
G/C	33 (56)	G (0.28)
C	26 (44)	C (0.72)
CYP3AP1 A-44G
A	42 (71)	A (0.82)
A/G	13 (22)	G (0.18)
G	4 (7)

Table III.  Comparison of response rate according to baseline characteristics of patients.

Baseline factors	CR + PR	SD + PD	Response rate (%)	p
Age
> 55	13	16	45	0.524
< 55	11	19	37
Gender
Male	17	25	40	0.96
Female	7	10	41
Histology
Adenocarcinoma	16	23	41	0.94
Squamous cell carcinoma	8	12	40
Phase
IIIB	8	10	44	0.7
IV	16	25	39

Table IV.  Response according to SNP genotypes.

	PR[n(%)]	SD + PD[n(%)]	P
CYP2C19*2			0.102
G/G	15	13
G/A + A/A	8	20
CYP2C19*3			0.293
G/G	20	32
G/A	4	3
A/A	0	0
CYP2D6*4			0.016
C/C	18	14
C/T	6	21
T/T	0	0
CYP2D6*2( C2938T)			0.268
C/C	13	25
C/T + T/T	11	10
CYP3AP1A-44G			0.004
A/A	12	30
A/G + G/G	12	5
CYP3A5*3			0.004
A/A + A/G	12	5
G/G	12	30

Figure 1.  Overall survival and survival according to CYP3A5 genotype.

Table VA.  The overall analysis of toxicity of 59 patients.

Total 59	0	I	II	III	IV
Anemia	14	23	13	9	0
Leukopenia	52	7	0	0	0
Thrombocytopenia	52	3	4	0	0
Nausea/vomiting	14	33	7	5	0

Table VB.  Toxicity according to single nucleotide polymorphism genotype (presented as percent).

	GRADE	CYP3A5*3			CYP2c19*2			CYP2C19*3			CYP2D6*4			CYP2D6*2-2938			CYP2D6*24268
		A/A + A/G	G/G	P	G	G/A + A	P	G	G/A	P	C/C	C/T	P	C/C	C/T + T/T	P	G/C	C/C	P
Anemia	≥I	24	14	0.45	7	14	0.67	10	29	0.19	15	7	0.44	5	24	0.09	15	8	0.45
Leukopenia		77	71	0.76	75	75	1	77	71	0.67	84	67	0.13	84	62	0.07	76	77	1
Thrombocytopenia		6	10	1	7	14	0.67	10	29	0.19	15	7	0.44	7.9	19	0.23	15	8	0.45
Nausea/vomiting		77	71	0.76	64	86	0.12	73	100	0.18	72	82	0.54	74	81	0.75	73	81	0.55
Anemia	≥II	0	0	–	0	0	–	0	0	–	0	0	–	0	0	–	0	0	–
Leukopenia		41	45	1	25	43	0.26	40	14	0.24	35	41	0.78	45	24	0.16	36	38	1
Thrombocytopenia		6	5	1	4	7	1	6	14	0.1	9.4	3.7	0.6	5.3	10	0.6	18	4	0.12
Nausea/vomiting		12	24	0.5	21	14	0.73	17	43	0.14	16	26	0.35	21	19	1	18	23	0.75