Quercetin improves diabetic kidney disease by inhibiting ferroptosis and regulating the Nrf2 in streptozotocin-induced diabetic rats

Figures & data

Table 1. Primer sequences for qRT-PCR.

Gene (mouse)	Forward Primer (5’-3’)	Reverse Primer (5’-3’)
β-actin	TGGAATCCTGTGGCATCCAT	GCTAGGAGCCAGAGCAGTAA
GPX-4	GAGGCAAGACCGAAGTAAACTAC	CCGAACTGGTTACACGGGAA
ACSL4	CATCCCTGGAGCAGATACTCT	TCACTTAGGATTTCCCTGGTCC
xCT	TCTCCAAAGGAGGTTACCTGC	AGACTCCCCTCAGTAAAGTGAC
Nrf2	TCAGCGACGGAAAGAGTATGA	CCACTGGTTTCTGACTGGA

Figure 1. Quercetin’s effects on DKD rats’ renal function and tissue injury. (A) Diabetic kidney disease (DKD) rat model establishment with STZ and treatment regimen. (B) Post-12-week blood glucose level following quercetin or Fer-1 administration. Measurements at 12 weeks included urine albumin (C), creatinine (D), and UCAR (E). Kidney weight (F), body weight (G), and kidney/body weight ratio (H) were also assessed. (I) Kidney sections stained with HE (upper), and PAS (bottom) across groups (scale bar = 50 μm). Groups: CON (control), DKD (model), DKD + QCT (quercetin-treated), DKD + Fer-1 (Ferrostatin-1-treated). Mean data ± SD are shown. Significance levels: ****p < 0.0001; ***p < 0.001; **p < 0.01; *p < 0.05 via one-way ANOVA.

Figure 2. Quercetin mitigates ferroptosis-induced kidney damage in DKD rats. (A) Iron, MDA (B), and GSH (C) levels in rat kidney tissues were determined using biochemical assays. (D) Immunohistochemistry for GPX4, xCT, and ACSL4 in rat kidneys (scale bar = 50 μm). Quantitative analysis of GPX4 (E), xCT (F), and ACSL4 (G) expression from Figure 2(D). Groups: CON (control), DKD (DKD model), DKD + QCT (DKD rats treated with Quercetin), DKD + Fer-1 (DKD rats treated with Ferrostatin-1). Data represent means ± SD. Significance: ****p < 0.0001; ***p < 0.001, assessed by one-way ANOVA.

Figure 3. Quercetin activates Nrf2 to inhibit ferroptosis in DKD rats. (A) Western blot analyses of GPX4, xCT, ACSL4, and Nrf2 protein levels in kidney tissues. (B,D) Semi-quantitative assessments of GPX4, xCT, and ACSL4 from immunoblots. (E) Semi-quantitative analysis of Nrf2 from immunoblots. (F) Immunohistochemical staining for Nrf2 in kidney tissues (scale bar = 50 μm). (G) Quantification of Nrf2 expression from Figure 3(F). Groups: CON (control), DKD (DKD model), DKD + QCT (DKD rats treated with Quercetin), DKD + Fer-1 (DKD rats treated with Ferrostatin-1). Data are mean ± SD. Significance levels: ****p < 0.0001; ***p < 0.001; **p < 0.01; *p < 0.05, determined by one-way ANOVA.

Figure 4. Quercetin mitigates high glucose-induced damage in renal tubular epithelial cells. (A) HK-2 cell viability across various glucose concentrations (5.5 mM, 17.5 mM, 30 mM, 45 mM and 60 mM) assessed via CCK-8 assay. (B) The mRNA expression levels of ACSL4, GPX4, and xCT in HK-2 cells after treatment with varying glucose concentrations in Figure 4A. (C) Viability of HK-2 cells in high-glucose (HG, 30 mM) and control (CON, 5.5 mM) conditions over different incubation time points (0, 12h, 24h, 48h, 72h) measured by CCK-8 assay. (D) The mRNA expression levels of ACSL4, GPX4, and xCT in HK-2 cells exposed to high-glucose (30 mM) and control (CON, 5.5 mM) conditions over different incubation time in Figure 4C. (E) CCK-8 assay determining HK-2 cell viability post-quercetin treatment at different doses (0, 5 μM, 15 μM, 25 μM, 50 μM). (F) Cell viability comparison among HK-2 cells groups via CCK-8 assay. The MDA (G) and GSH (H) levels in HK-2 cells groups quantified using biochemical assays. (I) Transmission electron microscopy (TEM) used to observe mitochondrial ultrastructural changes in HK-2 cells (scale bar = 500 nm), with mitochondria indicated by red arrows. (J) Flow cytometry (FACS) quantification of reactive oxygen species (ROS) levels in HK-2 cell groups. (K) The ROS expression level in Figure 4(J). CON: control HK-2 cells; HM: control HK-2 cells receiving mannitol treatment; CON + QCT: control HK-2 cells receiving quercetin treatment; HM: HG: HK-2 cells under high-glucose (HG); HG + QCT: HK-2 cells under HG incubation receiving quercetin treatment; HG + Fer-1: HK-2 cells under HG incubation receiving Fer-1 treatment. Data are mean ± SD. Significance levels are indicated as follows: ****p < 0.0001; ***p < 0.001; **p < 0.01; *p < 0.05, determined by one-way ANOVA.

Figure 5. Quercetin alleviated aberrant ferroptosis activation in HK-2 cells. (A) Western blot analyses of GPX4, xCT, ACSL4, and Nrf2 protein levels in each group of HK-2 cells. (B–E) Semi-quantitative assessments of GPX4, xCT, ACSL4, and Nrf2 from immunoblots. (F–I) Quantitative PCR results showing relative mRNA expressions of GPX4, xCT, ACSL4, and Nrf2 in the cells from each group. CON: control HK-2 cells; CON + QCT: control HK-2 cells receiving quercetin treatment; HG: HK-2 cells under HG incubation; HG + QCT: HK-2 cells under HG incubation receiving quercetin treatment; HG + Fer-1: HK-2 cell under HG incubation receiving Fer-1 treatment. Data are mean ± SD. Significance levels are indicated as follows: ****p < 0.0001; ***p < 0.001; **p < 0.01; *p < 0.05, determined by one-way ANOVA.

Figure 6. QCT protected HK-2 cells against ferroptosis via Nrf2. (A) Western blot analyses of GPX4, xCT and ACSL4 in each group of HK-2 cells. (B–D) Semi-quantitative assessments of GPX4, xCT, and ACSL4 from immunoblots. (E) HK-2 cell viability across various treatment groups (CON, HG, HG + QCT, HG + Fer-1 and HG + QCT + ML385) assessed via CCK-8 assay. (F–I) Quantitative PCR results showing relative mRNA expressions of GPX4, xCT, ACSL4, and Nrf2 in the cells from each group. CON: control HK-2 cells; HG: HK-2 cells under HG incubation; HG + QCT: HK-2 cells under HG incubation receiving quercetin treatment; HG + QCT + ML385: HK-2 cell under HG incubation receiving quercetin and ML385 treatment. Data are mean ± SD. Significance levels are indicated as follows: ****p < 0.0001; ***p < 0.001; **p < 0.01; *p < 0.05, determined by one-way ANOVA.