Mechanism of Polysaccharides from Dendrobium huoshanense. on Streptozotocin-Induced Diabetic Cataract

Figures & data

Table 1 Sequences of the primers used in RT-PCR.

Lens		Sequence (5′ to 3′)	Size (bp)
iNOS	Upstream primer	CGCCCTTCCGCAGTTCT	262
	Downstream primer	TCCAGGAGGACATGCAGCAC
β-Actin primer	Upstream	GAGACCTTCAACACCCAGCC	420
	Downstream primer	GCGGGGCATCGGAACCGCTCA

Table 2 Comparison of weight and blood sugar of rats after feeding for 45 days.

		5 days		45 days
Group	Number	Blood sugar (mmol L^− 1)	Weight (g)	Blood sugar (mmol L^− 1)	Weight (g)
NC	10	4.07 ± 0.46^a.	181.7 ± 10.0	4.33 ± 0.94^a.	233.0 ± 9.2^a.
DC	10	22.42 ± 2.27^b.	180.0 ± 8.2	24.72 ± 1.74^b.	144.7 ± 4.5^b.
I	10	22.17 ± 1.07^b.	181.7 ± 6.2	19.83 ± 1.48^c.	197.3 ± 7.9^c.
II	10	22.03 ± 1.06^b.	178.3 ± 8.5	14.73 ± 1.31^d.	205.7 ± 8.7^c.
III	10	23.03 ± 2.87^b.	179.3 ± 8.9	12.23 ± 0.83^d.	209.3 ± 7.1^c.

Values are given as mean ± SD for three independent experiments.

NC, normal control; DC: diabetic control.

Group I, 50 mg kg^{− 1}day^{− 1}; group II, 100 mg kg^{− 1}day^{− 1}; group III, 200 mg kg^{− 1}day^{− 1}. Diabetic control was compared with normal controls and treated group was compared with diabetic controls at corresponding time.

The data with different letters in the same item indicate significant difference at p = 0.05.

Figure 1 HPS retards the progression of diabetic cataract in vivo. in rats. (A) Normal rat eyes; (B) Generation of cataract in rat in vivo. by the administration of STZ without therapy; (C, D, E) the eyes of rats in 50 mg kg^{− 1}day^{− 1}, 100 mg kg^{− 1}day^{− 1}, and 200 mg kg^{− 1}day^{− 1} HPS-treated groups, respectively.

Table 3 The comparison of the NO content and NOS activities of lens epithelium cells in different groups at 45 days.

	Group
	NC	DC	Group I	Group II	Group III
Number	6	6	6	6	6
NO (μ mol mg^− 1 protein)	50.95 ± 2.2^a.	104.41 ± 6.2^b.	84.61 ± 2.8^c.	75.85 ± 3.6^cd.	70.12 ± 1.2^d.
NOS (U mg^− 1 protein)	14.55 ± 3.1^a.	35.20 ± 3.1^b.	30.33 ± 3.6^bc.	25.05 ± 2.4^c.	23.02 ± 1.2^ac.

Values are given as mean ± SD for three independent experiments.

NC, normal control; DC, diabetic control.

Group I, 50 mg kg^{− 1}day^{− 1}; group II, 100 mg kg^{− 1}day^{− 1}; group III, 200 mg kg^{− 1}day^{− 1}.

The data with different letters in the same item indicate significant difference at p = 0.05.

Figure 2 RT-PCR analysis using Multicolor Real time PCR Detection system. (A) The real-time PCR amplification chart of iNOS. (B) The real-time PCR amplification chart of β-actin. (C) The real-time melt peak chart of iNOS. NC, normal control; DC, diabetic control; I, group of 50 mg kg^{− 1}day^{− 1}; II, group of 100 mg kg^{− 1}day^{− 1}; III, group of 200 mg kg^{− 1}day^{− 1}.

Figure 3 mRNA levels of iNOS in rat lens treated with different concentrations of HPS detected by gelose gel electrophoresis. 1, diabetic cataract control group; 2, 50 mg kg^{− 1}day^{− 1} HPS-treated group; 3, 100 mg kg^{− 1}day^{− 1} HPS-treated group; 4, 200 mg kg^{− 1}day^{− 1} HPS-treated group; 5, normal control group. β-Actin expression at different treated groups is almost the same as that shown in the figure.

Table 4 The iNOS C._t., β-actin C._t. and opposite C._t.in different treatment groups.

	Group
	NC	DC	Group I	Group II	Group III
iNOS C.t	24.71	17.51	19.69	23.75	21.48
β-Actin C.t.	25.13	24.41	26.09	29.25	24.80
O-C.t	0.98	0.72	0.75	0.81	0.87
P	1.37	1.00	1.05	1.13	1.21

iNOS C._t., the crossing threshold of iNOS; β-actin C._t, the crossing threshold of β-actin; O-C._t: opposite C_t, the crossing threshold of iNOS is normalized to the crossing threshold of β-actin transcript in corresponding group; P, compared with the diabetic control group.

NC, normal control; DC, diabetic control.

Group I, 50 mg kg^{− 1}day^{− 1}; group II, 100 mg kg^{− 1}day^{− 1}; group III, 200 mg kg^{− 1}day^{− 1}.

Figure 4 The fluorescence intensity of AGEs (F-AGEs) in different treatment groups. Data are presented as the means ± standard deviations for three independent experiments. NC, normal control; DC, diabetic control. Group I, 50 mg kg^{− 1}day^{− 1}; group II: 100 mg kg^{− 1}day^{− 1}; group III, 200 mg kg^{− 1}day^{− 1}. The data with different letters in the same item indicate significant difference at p = 0.05.