A comparative assessment of reference genes in mouse brown adipocyte differentiation and thermogenesis in vitro

Figures & data

Figure 1. Brown adipocyte differentiation. (a) Induction scheme of brown adipocyte differentiation in vitro from immortalized brown preadipocytes. The details of differentiation process were described under ‘materials and methods’. Created by Biorender.com. (b) Phase-contrast images of cells at day − 2, day 0, day 4, and day 8 during the differentiation process. bar: 50 µm (c) phase-contrast and oil-red-O staining images at pre- adipocytes (day 0) and mature adipocytes (day 8). bar: 100 µm (d) quantification of the relative oil-red-O absorbance between mature adipocytes and preadipocytes. (e) Norepinephrine-induced UCP1 activity on mature adipocytes. Mature adipocytes (day 8) containing Ucp1-luc were incubated with DMSO for control and norepinephrine (1 µM) for 24 hours. The luciferase activity was determined by the method described in materials and methods section. ctr: control; Nore: norepinephrine. * p < 0.05, **** p < 0.0001.

Read the detailed description of this figure

A five-panel image represents the differentiation process of brown adipocytes in vitro. In Part A, a schematic timeline outlines the differentiation protocol from preadipocytes (day -2) to fully differentiated cells (day 8), with specific mediums indicated for each stage. Part B presents phase-contrast images at key stages (day 0, day 2, day 4, and day 8), revealing progressive changes in cell morphology, including lipid droplet accumulation on day 4 and day 8. Part C showcases microscope images of preadipocytes (day 0) and mature adipocytes (day 8), utilizing phase-contrast and Oil-Red-O staining to highlight lipid accumulation in the latter. The quantification graph in Part D depicts the Oil-Red-O absorbance measurement, demonstrating a significant increase in lipid accumulation during adipocyte maturation (day 8) compared to preadipocytes (day 0). Lastly, Part E features bar graphs illustrating enhanced Ucp1 promoter activity in mature adipocytes (day 8) upon norepinephrine stimulation, with notably higher luminescence intensity in the treated cells compared to those treated with DMSO.

Table 1. Summary of a pair of primers for 13 reference genes and two target genes.

Gene	Gene name (MGI)	NCBI Ref sequence	Primer	Tm (°C)	GC(%)	Amplicon
ActB	Actin, beta	NM_007393.5	F: TTACTGCTCTGGCTCCTAGC	F: 58.88	F: 55.00	198
			R: R:CAGCTCAGTAACAGTCCGC	R: 58.26	R: 57.89
B2m	Beta-2 microglobulin	NM_009735.3	F: TGACCGGCCTGTATGCTATC	F: 59.32	F: 55.00	115
			R: GGCGGGTGGAACTGTGTTAC	R: 61.23	R: 60.00
Gapdh	Glyceraldehyde-3-phosphate dehydrogenase	NM_001289726.2	F: AACCCTTAAGAGGGATGCTGC	F: 60.06	F: 52.38	120
			R: CAAATCCGTTCACACCGACC	R: 59.48	R: 55.00
Gusb	glucuronidase, beta	NM_010368.2	F: TGGCTGGGTGTGGTATGAAC	F: 59.96	F: 55.00	152
			R: GGTGACCTCCCTCATGTTCC	R: 59.75	R: 60.00
Hprt	Hypoxanthine phosphoribosyltransferase	NM_013556.2	F: GAGAGCGTTGGGCTTACCTC	F: 60.46	F: 60.00	132
			R: CTAATCACGACGCTGGGACT	R: 59.54	R: 55.00
Pgk1	Phosphoglycerate kinase 1	NM_008828.3	F: CCATAGCTCCATGGTGGGTG	F: 60.18	F: 60.00	168
			R: TTAGCGCCTCCCAAGATAGC	R: 59.61	R: 55.00
Rer1	Retention in endoplasmic reticulum sorting	NM_026395.2	F: GGAGCTGCGAGTTACAGAATGTC	F: 61.52	F: 52.17	164
	receptor 1		R: CCCAGTGTCACAACCCACC	R: 60.53	R: 53.16
Rpl13a	Ribosomal protein L13A	NM_009438.5	F: CCCACAAGACCAAGAGAGGC	F: 60.32	F: 60.00	131
			R: GGTAGGCTTCAGCCGAACAA	R: 60.32	R: 55.00
Rps18	Ribosomal Protein S18	NM_011296.3	F: AGTTCCAGCACATTTTGCGAG	F: 59.73	F: 47.62	155
			R: GAGTTCTCCAGCCCTCTTGG	R: 59.75	R: 60.00
Tbp	TATA box binding protein	NM_013684.3	F: ACCCTTCACCAATGACTCCTATG	F: 55.00	F: 48.00	186
			R: TGACTGCAGCAAATCGCTTGG	R: 54.00	R: 52.00
Tubb5	Tubulin, beta 5 class1	NM_011655.5	F: GTACCTACCACGGTGACAGC	F:60.11	F: 60.00	188
			R: CCCAGACTGACCGAAAACGA	R: 59.97	R: 55.00
Ubc	Ubiquitin C	NM_019639.4	F: CCCAGTGTTACCACCAAGAAG	F: 58.5	F: 52.38	103
			R: CCCATCACACCCAAGAACAAG	R: 59.11	R: 52.38
Sdha	Succinate dehydrogenase complex, subunit A	NM_023281.1	F: GTCGATGCAGAACCATGCTG	F: 59.62	F: 55.00	142
			R: CTCCACCAGGTCTGTGTTCC	R: 59.96	R: 60.00
Ucp1	Un-coupling Protein 1	NM 009463.3	F: CACCTTCCCGCTGGACACT	F: 55.00	F: 63.00	91
			R: CCCTAGGACACCTTTATACCTAATGG	R: 58.00	R: 46.00
Pparg	Peroxisome Proliferator-Activated Receptor	NM 001127330.3	F: GTGCCAGTTTCGATCCGTAGA	F: 59.00	F: 52.00	142
	Gamma		R: GGCCAGCATCGTGTAGATGA	R: 59.00	R: 55.00

Table 2. The PCR amplification efficiency of reference and target genes.

No.	Gene	R^2	Slope	E %
1	Actb	0.9974	−3.7914	83.55018
2	B2m	0.9951	−3.839	82.17321
3	Gapdh	0.9974	−3.8724	81.23321
4	Gusb	0.9854	−3.9038	80.36849
5	Hprt	0.9865	−3.5644	90.78847
6	Pgk1	0.995	−3.8873	80.82062
7	Rer1	0.9889	−3.3788	97.68015
8	Rpl13a	0.9927	−3.8489	81.89237
9	Rps18	0.991	−3.6672	87.36463
10	Tbp	0.9904	−3.6892	86.66439
11	Tubb5	0.9834	−3.8364	82.24727
12	Ubc	0.9977	−3.9781	78.39237
13	Sdha	0.9978	−3.6775	87.03542
14	Ucp	0.9938	−3.9055	80.32219
15	Pparg	0.9962	−3.9157	80.04546

Figure 2. Stability scores and ranking of 13 candidate housekeeping genes in the adipogenesis and thermogenesis panel. (a,b) Stability scores from Delta CT algorithms; (c,d) Stability scores from BestKeeper algorithms; (e,f) Stability scores from NormFinder algorithms; (g,h) Stability scores from GeNorm algorithms at an adipogenesis (left) or thermogenesis (right) panel, respectively. For the adipogenesis panel, cells were collected at day 0, day 2, day 4, and day 8 during adipocyte differentiation. For the thermogenesis panel, cells at day 0 and day 8 were treated with norepinephrine (1 µM) or DMSO and incubated for 24 hours. All experiments were performed at three biological replications. The mRNA expression of reference genes underwent examination through RT-qPCR and the RefFinder tool was utilized for calculating stability scores. Original Ct values, including biological replications, from all time points in adipogenesis condition or all treatments in thermogenesis were inputted into the RefFinder tool for analysis. The stability score of individual candidate gene, determined by each algorithm, was displayed as bar-graphs. Lower (left) and higher (right) scores indicate more and less stable genes, respectively.

An extensive eight-panel bar graph depicts stability scores of 13 housekeeping genes in the context of adipogenesis (A, C, E, G) and thermogenesis (B, D, F, H). These scores are computed using four distinct algorithms (Delta CT, BestKeeper, NormFinder, and GeNorm). Each panel provides a visual ranking of genes, arranged from most to least stable, as determined by their respective algorithmic stability evaluations. Lower scores within the graph indicate higher stability, while higher scores signify lower stability.

Figure 3. Geometric mean of rankings (GMR) from all four algorithms scores of 13 candidate housekeeping genes in the (a) adipogenesis and (b) thermogenesis panel. The GMR values were calculated by the Refinder algorithm using the original ct values of each gene as input, considering all experimental designs. Lower (left) and higher (right) scores indicate more and less stable genes, respectively.

In part A and part B of a two-horizontal bar graph, the Geometric Mean of Rank (GMR) for 13 housekeeping genes is visually presented under adipogenic and thermogenic conditions, respectively. Within each panel, the bars are organized from the most stable (located on the left with a lower GMR) to the least stable (positioned on the right with a higher GMR).

Table 3. The comparative summary of gene stability for 13 reference genes in the adipogenesis panel.

Method	1	2	3	4	5	6	7	8	9	10	11	12	13
Delta CT	Tbp	Rer1	Rpl13a	Rps18	B2m	Ubc	Gusb	Tubb5	Hprt	Actb	Pgk1	Gapdh	Sdha
BestKeeper	Tbp	Rer1	Rps18	Rpl13a	Ubc	B2m	Hprt	Gusb	Tubb5	Actb	Gapdh	Pgk1	Sdha
Normfinder	Tbp	Rer1	Rps18	Rpl13a	B2m	Ubc	Gusb	Hprt	Tubb5	Actb	Pgk1	Gapdh	Sdha
Genorm	Rpl13a\Ubc		Rer1	Tbp	Rps18	B2m	Gusb	Tubb5	Actb	Hprt	Pgk1	Gapdh	Sdha
Comprehensive ranking	Tbp	Rer1	Rpl13a	Rps18	Ubc	B2m	Gusb	Hprt	Tubb5	Actb	Pgk1	Gapdh	Sdha

Ranking Order 1 => 13 (Better – Good – Average).

Table 4. The comparative summary of gene stability for 13 reference genes in the thermogenesis panel.

Method	1	2	3	4	5	6	7	8	9	10	11	12	13
Delta CT	Rer1	Ubc	Rpl13a	Tbp	B2m	Rps18	Hprt	Gapdh	Tubb5	Gusb	Pgk1	Actb	Sdha
BestKeeper	Ubc	Rer1	Tbp	B2m	Rpl13a	Rps18	Hprt	Gapdh	Tubb5	Pgk1	Gusb	Actb	Sdha
Normfinder	Rps18	Tbp	Ubc	Rpl13a	Rer1	B2m	Hprt	Gapdh	Tubb5	Gusb	Pgk1	Actb	Sdha
Genorm	Tbp\\Ubc		Rer1	Rpl13a	B2m	Rps18	Hprt	Gapdh	Tubb5	Gusb	Pgk1	Actb	Sdha
Comprehensive ranking	Ubc	Tbp	Rer1	Rps18	Rpl13a	B2m	Hprt	Gapdh	Tubb5	Gusb	Pgk1	Actb	Sdha

Ranking Order 1 => 13 (Better – Good – Average).

Figure 4. The relative gene expression of adipogenic markers based on four specific reference genes during the brown adipocyte differentiation. The relative expression levels of Ucp1 (a) and pparg (b) normalized to each reference gene (Tbp, Ubc, Rer1 and Sdha) were represented as graphs. Cells were collected at each differentiation time (day 0 (D0), day 2 (D2), day 4 (D4), and day 8 (D8)), followed by an RT-qPCR assay to assess the mRNA expression of Ucp1 and Pparg. The relative expression of the two target genes was normalized using various reference genes and calculated relative to the control. All experiments were performed at three replications. * < 0.05, ** < 0.01, *** < 0.005, **** < 0.001, ns: non-significant, p value. Orange, green, cyan, and purple represent Tbp, Ubc, Rer1 and Sdha, respectively.

A two-panel bar graph depicts the mRNA expression changes of the Ucp1 gene in part A and the Pparg gene in part B throughout each stage of brown adipocyte differentiation (D0, D2, D4, D8). The gene expression levels are standardized using four reference genes—Tbp, Ubc, Rer1, and Sdha—each represented by a distinct colour. In part A, a noteworthy surge in Ucp1 expression is observed during the later differentiation stages, with variations in presentation depending on the reference gene employed for normalization. Part B also reveals an augmentation in Pparg expression across the differentiation stages, emphasizing the impact of reference gene stability on expression analysis.

Figure 5. The relative gene expression of adipogenic markers based on four specific reference genes in norepinephrine-induced thermogenesis. The relative expression levels of Ucp1 (a) and pparg (b) normalized to each reference gene (tbp, Ubc, Rer1, and sdha) were represented as graphs. Cells were treated with norepinephrine (1 µM) or DMSO (control) at day 0 (D0, preadipocytes) and day 8 (D8, differentiated adipocytes) and incubated for 24 hours, and subsequently subjected to to RT-qPCR assay to examine the mRNA expression of Ucp1 and Pparg. The relative expression of the two target genes were normalized using various reference genes and calculated in relation to the control. All experiments were performed at three replications. * < 0.05, ** < 0.01, *** < 0.005, **** < 0.001, ns: non-significant. Nore, norepinephrine. Orange, green, cyan, and purple represent Tbp, Ubc, Rer1, and Sdha, respectively.

A two-panel bar graph represents the relative expressions of the Ucp1 gene (part A) and Pparg gene (part B) during preadipocyte (day 0) and mature adipocyte (day 8) stages, influenced by the presence or absence of norepinephrine-induced thermogenesis. The gene expression levels are standardized using four reference genes—Tbp, Ubc, Rer1, and Sdha—each distinguished by a unique colour. At day 8, both Ucp1 and Pparg gene expressions exhibit a significant increase, particularly when subjected to norepinephrine treatment. The influence of reference genes on the expression levels of these target genes manifests distinct patterns, reflecting variations in gene stability.

Data availability statement

The reference sequences used for designing primers in this study can be found in the NCBI Reference Sequences (NM007393.5; NM009735.3; NM001289726.2; NM010368.2; NM013556.2; NM008828.3; NM026395.2; NM009438.5; NM011296.3; NM013684.3; NM011655.5; NM019639.4; NM023281.1; NM009463.3; NM001127330.3).