Icariside II ameliorates endothelial dysfunction by regulating the MAPK pathway via miR-126/SPRED1 in diabetic human cavernous endothelial cells

Figures & data

Table 1 The forward primers of miRNAs

miRNAs	Forward primer (5′-3′)
hsa-miR-126-3p	TCGTACCGTGAGTAATAATGCG
hsa-miR-126-5p	CATTATTACTTTTGGTACGCG
hsa-miR-15a-5p	TAGCAGCACATAATGGTTTGTG
hsa-miR-15a-3p	CAGGCCATATTGTGCTGCCTCA
hsa-miR-16-5p	TAGCAGCACGTAAATATTGGCG
hsa-miR-145-5p	GTCCAGTTTTCCCAGGAATCCCT
hsa-miR-155-5p	TTAATGCTAATCGTGATAGGGGT
hsa-miR-200b-3p	TAATACTGCCTGGTAATGATGA

Abbreviation: miRNA, microRNA.

Table 2 The primers of target gene mRNAs

mRNAs	Forward primer (5′–3′)	Reversed primer (5′–3′)
SPRED1	GAGACAGTTGTTACCAGTGAGCC	CCATACTTCTGCTCTGAATGTCC
PIK3R2	TTAAGGTCTATCACCAGCAGTACCA	ATCTCTTTCTCGTTGCCCTCAC
VCAM1	GCGGGAGTATATGAATGTGAATCTAA	GCTACACTTTTGACTTCTGTGCTTCT
GAPDH	ACGGATTTGGTCGTATTGGG	TGATTTTGGAGGGATCTCGC

Abbreviations: SPRED1, sprouty-related EVH1 domain-containing protein 1; PIK3R2, phosphoinositol-3 kinase regulatory subunit 2; VCAM1, vascular cell adhesion molecule 1.

Figure 1 Diabetic hCEC identification and the effect of ICA II on cell proliferation and migration in diabetic hCECs.

Notes: (A) The protein expression of eNOS and RAGE was assessed by Western blot. (B) The quantitative data of the eNOS and RAGE protein expression were normalized to GAPDH levels compared with the NC group as 1. (C) Ki-67 expression for cell proliferation ability was determined by immunofluorescence, and the cell nuclei were labeled with DAPI. (D) The cell proliferation ability was determined by a scratch migration assay, and the cell migration spans are shown. The data are presented as the mean ± SD of three independent experiments. *P<0.05 when compared with the DM group.
Abbreviations: hCEC, human cavernous endothelial cell; ICA II, icariside II; eNOS, endothelial nitric oxide synthase; RAGE, receptor for advanced glycation end products; NC, normal control; DAPI, 4′,6-diamidino-2-phenylindole; DM, diabetes mellitus; DM+ICA II, DM treated with ICA II.

Figure 2 Effect of ICA II on endothelial miRNAs and miR-126/SPRED1 expression in diabetic hCECs.

Notes: (A) Endothelial miRNA candidates (miR-126-3p, miR-126-5p, miR-15a-5p, miR-15a-3p, miR-16-5p, miR-145-5p, miR-155-5p, and miR-200b-3p) were assessed in a diabetic hCEC model with or without ICA II treatment by real-time PCR, and the quantitative data of the miRNAs were normalized to hsa-U6 levels. (B) The effect of ICA II on miR-126 and the expression of its target gene mRNAs (SPRED1, PIK3R2, and VCAM1) were assessed by real-time PCR, and the quantitative data of the target genes were normalized to GAPDH levels. The data are presented as the mean ± SD of three independent experiments. *P<0.05 when compared with the DM group.
Abbreviations: ICA II, icariside II; miRNA, microRNA; SPRED1, sprouty-related EVH1 domain-containing protein 1; hCEC, human cavernous endothelial cells; PIK3R2, phosphoinositol-3 kinase regulatory subunit 2; VCAM1, vascular cell adhesion molecule 1; NC, normal control; DM, diabetes mellitus; DM+ICA II, DM treated with ICA II.

Figure 3 Effects of ICA II on regulating protein expression levels in the MAPK pathway in diabetic hCECs.

Notes: (A) The protein expression of SPRED1, c-Raf, phosphorylated MEK1/2, MEK1/2, Erk1/2, and phosphorylated Erk1/2 in the MAPK pathway were assessed by Western blot. (B) The quantitative data of the protein expression levels in the MAPK pathway were compared with NC group as 1. The data are presented as the mean ± SD of three independent experiments. *P<0.05 when compared with the DM group.
Abbreviations: ICA II, icariside II; hCECs, human cavernous endothelial cells; SPRED1, sprouty-related EVH1 domain-containing protein 1; NC, normal control; DM, diabetes mellitus; DM+ICA II, DM treated with ICA II.

Figure 4 The influence of miR-126-3p on SPRED1 regulation and the hypothetical scheme of ICA II on endothelial cell function in diabetic hCECs.

Notes: (A and B) miR-126 and SPRED1 mRNA expression was assessed by real-time PCR. The quantitative data for miR-126 were normalized to the hsa-U6 level, and the quantitative data for SPRED1 mRNA were normalized to the GAPDH level. The data are presented as the mean ± SD of three independent experiments. *P<0.05 when compared with the miR-126 antagomir group or the DM group. (C) It is putative that miR-126 represses its target gene expression, SPRED1, which is a negative regulator of MAPK signaling. We suppose that ICA II may promote cell proliferation and migration by upregulating the MAPK signaling pathway via miR-126/SPRED1 in diabetic hCECs.
Abbreviations: SPRED1, sprouty-related EVH1 domain-containing protein 1; ICA II, icariside II; DM, diabetes mellitus; hCECs, human cavernous endothelial cells; NC, normal control.