Repeated administration of bone marrow-derived mesenchymal stem cells improved the protective effects on a remnant kidney model

Figures & data

FIGURE 1. Mesenchymal stem cells (MSCs) were characterized by their canonical ability to differentiate into adipocytes and osteocytes. (a) MSCs on second passage growing in spindle-shaped morphology (rat MSCs ×100). (b) MSC cultured for 8 days with osteogenic supplements (von Kossa stain ×100). Osteogenic differentiation is shown by the formation of calcium-hydroxyapatite-positive area (von Kossa staining). (c) MSC cultured for 12 days with adipogenic supplements (Oil Red O stain ×100). Adipogenic differentiation is visualization by Oil Red O staining for intracellular lipid vacuoles.

TABLE 1. Sequences of primers for real-time PCR

	Sequence (5′/3′) for sense/antisense
Cyclophilin	ACCCCACCGTGTTCTTCGAC/GCATTTGCCATGGACAAGATG
BMP-7	CCAAGAGGCACTGAGGATGG/TGGTGGCGTTCATGTAGGAG
EGF	CGTCTCAGTGGTCATGGATTT/TCAGAAGAACACGGGAATTGT
TGF-α	CACTTCAACAAGTGCCCAGA/AGCAGTGGACAGCACACAG
TGF-β1	AAGAAGTCACCCGCGTGCTA/TGTGTGATGTCTTTGGTTTTGTCA
IL-1β	GGACCCAAGCACCTTCTTTT/AGACAGCACGAGGCATTTTT
IL-6	GAGCCCACCAGGAACGAAAG/TCTGACAGTGCATCATCGCTG
IL-10	CACTGCTATGTTGCCTGCTC/TGTCCAGCTGGTCCTTCTTT
VEGF-A	GCACTGGACCCTGGCTTT/CGGGGTACTCCTGGAAGATG
VEGF-B	GCACTGGACCCTGGCTTT/CGGGGTACTCCTGGAAGATG

TABLE 2. Systolic blood pressure, urine volume, and urine protein excretion in studied animals

	Control	MCs	Once MSCs	Weekly MSCs
Systolic BP (mmHg)
0 week	115.1 ± 6.5	114.5 ± 5.6	118.4 ± 6.1	117.9 ± 6.1
1 week	113.2 ± 5.8	113.1 ± 5.4	115.1 ± 5.7	116.5 ± 4.9
5 weeks	132.1 ± 6.5	129.8 ± 5.6	126.6 ± 5.2	120.7 ± 5.1^†
Urine protein (mg/day)
0 week	13.9 ± 4.9	13.8 ± 4.6	13.3 ± 4.5	14.1 ± 4.9
1 week	14.9 ± 5.1	15.2 ± 4.7	14.5 ± 4.2	14.9 ± 4.5
5 weeks	22.8 ± 6.7	23.9± 6.4	19.7 ± 5.9	17.1 ± 5.5^†
Serum creatinine (mg/dL)
1 week	0.42 ± 0.05	0.40 ± 0.05	0.41 ± 0.06	0.42 ± 0.06
5 weeks	0.55 ± 0.06**	0.58 ± 0.11**	0.49 ± 0.07	0.45 ± 0.08^†

Note: *p < 0.05 as compared with baseline at 0 week.

**p < 0.05 as compared with 1 week.

^†p < 0.05 as compared with saline and MCs control.

FIGURE 2. Renal histology in remnant kidney rats about glomerular sclerosis between the groups after 5 weeks. (a) Saline control group, (b) MCs control group, (c) once MSCs group, and (d) weekly MSCs group. Magnification ×100 (PAS staining). *p < 0.05 as compared with saline and MCs, **p < 0.05 as compared with once MSCs.

FIGURE 3. Renal histology in remnant kidney rats about glomerular and interstitial fibrosis between the groups after 5 weeks. (a) Saline control group, (b) MCs control group, (c) once MSCs group, and (d) weekly MSCs group. Magnification ×100 (Masson's Trichrome staining). *p < 0.05 as compared with saline and MCs, *p < 0.05 as compared with once MSCs.

FIGURE 4. Infiltration of ED-1 positive cells between the groups after 5 weeks. (a) Saline control group, (b) MCs control group, (c) once MSCs group, and (d) weekly MSCs group. Magnification ×100 (Immunohistochemical staining with anti-ED-1 antibody). *p < 0.05 as compared with saline and MCs control. **p < 0.05 as compared with once MSCs.

FIGURE 5. Cortical SRY gene expression of a male rat kidney: (a) positive control at 5 weeks, (b) weekly MSCs at 5 weeks, (c) once MSCs at 5 weeks, (d) MSCs at 1 week, and (e) once MCs at 1 week.

FIGURE 6. A fluorescence microscopy of MSC-labeled by CM-Dil: (a) weekly MSCs at 5 weeks, (b) once MSCs at 5 weeks, (c) MCs at 5 weeks, (d) once MSCs at 1 week, (e) MCs control at 1 week, and (f) saline control at 1 week.

FIGURE 7. Relative mRNA expression of cytokines. (a) *p < 0.05 as compared with MCs control (1 week); and (b) *p < 0.05 as compared with once MSCs (5 weeks in each group).