Renal Microvascular Injury in Chronic Aristolochic Acid Nephropathy and Protective Effects of Cozaar

Figures & data

Table 1. Primer sequences of amplified genes.

Gene	Forward primer	Reverse primer	TaqMan probe
GAPDH	TGGAGTCTACTGGCGTCTT	TGTCATATTTCTCGTGGTTCA	CTGAAGGGTGGGGCCAAAAG
Ang-1	TGATGAGGAGAAGAGGCCTAACC	GCCCTTGTTGCCATGGATAA	CGCCCTGCAAAGAGGTCAACACC
Ang-2	GCGCCCTCTGTTGTTGGTT	CGTCCTGAGCCAGAGTTGAAG	TTGTGCTGAGTCTGGTTGCGA
Tie-2	GGGCCTAGAGCCAGAGACTACA	GCTGGGTTGCTTGATCCTATG	ACCATGTGGATATTTTTGCTGAGAA
VEGF	GTTCGAGGAAAGGGAAAGGGTC	GCGAGTCTGTTTTTGCAGGA	AGCGCAAGAAATCCCGGTTTAAATC
BMP7	GAAAACAGCAGCAGTGACCA	CCAGTGTCTGGACGATAGCA	CACCTCCTTCGGCTGCAGCA

Note: Primer sequence is in accordance with the 5′–3′ direction; probe 5′ end FAM modified and 3′ end TAMRA modified.

Table 2. Differences of body weight (BW), 24 h urine protein, and urine NAG between different groups ().

Group	BW (g)	Urine protein (mg/24 h)	Urine NAG (μg/24 h)	Urine β2-MG (μg/24 h)
Control	546.00 ± 37.26	5.23 ± 1.30	2.54 ± 2.42	0.89 ± 1.46
Model	368.5 ± 29.74**	20.90 ± 2.85**	7.91 ± 2.02**	16.31 ± 9.75*
Cozaar	394.33 ± 29.49	9.03 ± 2.10***	3.35 ± 1.58***	6.95 ± 5.31

Note: *p < 0.05, **p < 0.01 versus control group; ***p < 0.01 versus model group.

Table 3. Differences of Scr, BUN, Hb, and RBC between different groups ().

Group	Scr (μmol/L)	BUN (mmol/L)	Hb (g/L)	RBC (10^12/L)
Control	29.43 ± 2.64	8.37 ± 0.88	129.57 ± 10.88	7.07 ± 0.84
Model	50.00 ± 7.16*	13.63 ± 2.04*	89.83 ± 10.36*	4.71 ± 0.58*
Cozaar	45.50 ± 10.50	9.76 ± 0.89**	95.67 ± 18.36	5.08 ± 0.78

Note: *p < 0.01 versus control group; **p < 0.01 versus model group.

Figure 1. Hematoxylin–eosin staining in rat renal tissue samples at week 21 (×400). (A) There was no significant histological abnormality in the control group. (B) Degenerated, necrotic, and sloughed tubule epithelial cells and an exposed basement membrane were seen, and some of the tubule structures were atrophied and lost. (C) In Cozaar group, only local mild tubular epithelial lesions were observed.

Figure 2. Masion staining in rat renal tissue samples at week 21 (×400). (A) There was no fibrosis of the interstitium in the control group. (B) A moderate fibrosis of the interstitium was seen in the model group. (C) A less severe interstitial fibrosis was observed in Cozaar group.

Figure 3. Electron microscopy of glomerulus at week 21 (×4200). (A) The ultrastructure of intact glomerulus was seen in the control group. (B) An ischemic shrinkage of the glomerular basement membrane was found in the model group. (C) A less severe ischemic shrinkage of the glomerular basement membrane was observed in Cozaar group.

Figure 4. Electron microscopy of rat renal tubule at week 21 (×11,500). (A) The normal tubule epithelial cells and basement membrane were seen in the control group. (B) Thickening and collapse of the tubule basement membrane were found in the model group. (C) A mild thickening and collapse of the tubule basement membrane was observed in Cozaar group.

Figure 5. Electron microscopy of rat renal interstitium at week 21 (×11,500). (A) The normal ultrastructure of renal interstitium was seen in the control group. (B) A significant amount of fasciculation of collagen fibers at the affected interstitium was found in the model group. (C) Less fasciculations of collagen fibers at the affected interstitium were observed in Cozaar group.

Figure 6. BMP-7 expression in rat renal tissue at week 21 (×250). (A) BMP-7 was largely expressed in the renal tubular epithelial cells and renal interstitium, especially in the medulla area in the control group. (B) A decreased BMP-7 expression was found in the renal tubular epithelial cells and renal interstitium. (C) BMP-7 expression in the renal tissue was significantly increased in Cozaar group.

Table 4. Differences of relative positive area of BMP-7, caspase-3, and CD34 expressions in rat renal tissue between different groups ().

Group	BMP-7	Caspase-3	CD34
Control	6.75 ± 1.83	3.18 ± 2.57	9.14 ± 3.09
Model	2.57 ± 0.89**	9.17 ± 2.67*	3.05 ± 0.88**
Cozaar	4.28 ± 0.78***	3.22 ± 0.83***	5.48 ± 0.94***

Note: *p < 0.05, **p < 0.01 versus control group; ***p < 0.05 versus model group.

Figure 7. Caspase-3 expression in rat renal tissue (×250). (A) Caspase-3 was less expressed in the renal tubular interstitium in the control group. (B) An increased caspase-3 expression was found in the renal interstitium in the model group. (C) Caspase-3 expression in the renal tissue was significantly decreased in Cozaar group.

Figure 8. CD34 expression in rat renal tissue (×250). (A) CD34 was largely expressed in the renal tubular interstitium in the control group. (B) A decreased CD34 expression was found in the renal interstitium in the model group. (C) CD34 expression in the renal tissue was significantly increased in Cozaar group as compared with the model group.

Table 5. Differences of Ang-1, Ang-2, Tie-2, and VEGF mRNA expressions between different groups ().

Group	Ang-1	Ang-2	Tie-2	VEGF	BMP-7
Control	0.0089 ± 0.0037	0.0025 ± 0.0019	0.0015 ± 0.0004	0.0058 ± 0.0029	0.0216 ± 0.0081
Model	0.0014 ± 0.0004**	0.0076 ± 0.0031**	0.0005 ± 0.0002*	0.0007 ± 0.0003*	0.0054 ± 0.0020*
Cozaar	0.0077 ± 0.0022****	0.0073 ± 0.0032	0.0015 ± 0.0008****	0.0046 ± 0.0014****	0.0122 ± 0.0028***

Note: *p < 0.05, **p < 0.01 versus control group; ***p < 0.05, ****p < 0.01 versus model group.