Naringin ameliorates sodium arsenite-induced renal and hepatic toxicity in rats: decisive role of KIM-1, Caspase-3, TGF-β, and TNF-α

Figures & data

Table 1. Primer sequences for KIM-1, Caspase-3, TGF-β, TNF-α and β-actin.

	Sequence
Gene	Forward primer	Reverse primer	Size (bp)
KIM-1	ACTCCTGCAGACTGGAATGG	CAAAGCTCAGAGAGCCCATC	212
Caspase-3	CTCGGTCTGGTACAGATGTCGATG	GGTTAACCCGGGTAAGAATGTGCA	238
TGF-β	GTTCTTCAATACGTCAGACATTCG	CATTATCTTTGCTGTCACAAGAGC	309
TNF-α	AAGCCTGTAGCCCATGTTGT	CAGATAGATGGGCTCATACC	295
β-actin	GTCACCCACACTGTGCCCATCT	ACAGAGTACTTGCGCTCAGGAG	764

Table 2. Effect of naringin on sodium arsenite-induced alteration in body weight, kidney weight and liver weight.

Parameters	N	As	As + CoQ10 (10)	As + N (20)	As + N (40)	As + N (80)
Body weight (gm)	248.5 ± 8.14	179.7 ± 5.81###	228.6 ± 6.67***	181.1 ± 3.85	210.6 ± 9.99*	220.7 ± 9.74**
Relative kidney weight	0.50 ± 0.03	0.70 ± 0.02###	0.52 ± 0.02***	0.67 ± 0.02	0.59 ± 0.03*	0.55 ± 0.02**
Relative liver weight	3.16 ± 0.25	4.87 ± 0.43###	3.04 ± 0.16***	4.61 ± 0.26	4.15 ± 0.23*	3.62 ± 0.19**

Data are expressed as mean ± SEM (n = 5) and analyzed by one-way ANOVA followed by Dunnett’s test multiple range test. *p < 0.05, **p < 0.01 and ***p < 0.001 as compared with the Arsenic Control group. ###p < 0.001 as compared to normal group. N: Normal group; As: Arsenic Control group; CoQ10 (10): Coenzyme Q10 (10 mg/kg, p.o.) treated group; N (20): naringin (20 mg/kg, p.o.) treated group; N (40): naringin (40 mg/kg, p.o.) treated group and N (80): naringin (80 mg/kg, p.o.) treated group.

Table 3. Effect of naringin on sodium arsenite-induced alteration in kidney and liver function test.

Parameters	N	As	As + CoQ10 (10)	As + N (20)	As + N (40)	As + N (80)
Serum creatinine (mg/dL)	0.99 ± 0.12	4.25 ± 0.28###	2.46 ± 0.18***	3.91 ± 0.29	2.83 ± 0.29**	2.51 ± 0.30***
Urine creatinine (mg/dL)	64.26 ± 5.98	28.89 ± 3.67###	62.37 ± 2.37***	33.60 ± 3.05	47.89 ± 2.53**	51.98 ± 2.19***
Creatinine clearance (mL/min)	18.75 ± 2.89	7.98 ± 1.22###	16.84 ± 1.05***	8.78 ± 2.04	12.41 ± 2.41**	15.85 ± 1.78***
BUN (mg/dL)	18.19 ± 1.89	61.27 ± 4.81###	25.42 ± 2.45***	54.96 ± 3.43	45.63 ± 2.64**	32.13 ± 2.55***
Uric acid (mg/dL)	1.49 ± 0.24	4.32 ± 0.42###	2.08 ± 0.15***	4.00 ± 0.33	3.18 ± 0.31*	2.53 ± 0.24**
ALT (IU/I)	56.60 ± 6.00	219.7 ± 12.81###	88.46 ± 8.67***	200.5 ± 9.76	171.6 ± 12.55**	122.2 ± 8.16***
AST (IU/I)	97.35 ± 7.75	212.1 ± 8.22###	100.7 ± 7.51***	196.5 ± 10.56	160.6 ± 10.61**	120.2 ± 7.29***

Data are expressed as mean ± SEM (n = 5) and analyzed by one-way ANOVA followed by Dunnett’s test multiple range test. *p < 0.05, **p < 0.01 and ***p < 0.001 as compared with the Arsenic Control group. ###p < 0.001 as compared to normal group. N: Normal group; As: Arsenic Control group; CoQ10 (10): Coenzyme Q10 (10 mg/kg, p.o.) treated group; N (20): naringin (20 mg/kg, p.o.) treated group; N (40): naringin (40 mg/kg, p.o.) treated group and N (80): naringin (80 mg/kg, p.o.) treated group. BUN: Blood urea nitrogen; ALT: Alanine transaminase; AST: Aspartate Aminotransferase.

Table 4. Effect of naringin on sodium arsenite-induced alteration in oxido-nitrosative stress and membrane-bound enzyme.

Parameters	N	As	As + CoQ10 (10)	As + N (20)	As + N (40)	As + N (80)
Renal SOD (U/mg of protein)	11.07 ± 0.86	4.68 ± 0.42###	9.61 ± 0.74***	6.51 ± 0.80	8.20 ± 0.44**	9.17 ± 0.58***
Renal GSH (µg/mg protein)	46.88 ± 2.84	21.88 ± 1.55###	43.22 ± 2.61***	28.87 ± 2.22	33.88 ± 2.63**	38.92 ± 1.92***
Renal MDA (nM/mg of protein)	2.89 ± 0.29	6.53 ± 0.66###	3.13 ± 0.33***	5.87 ± 0.42	4.57 ± 0.40**	3.57 ± 0.32***
Renal NO (µg/mL)	108.2 ± 6.043	286.2 ± 12.30###	177.0 ± 9.56***	264.2 ± 11.60	230.1 ± 11.02**	188.4 ± 11.38***
Renal Na-K-ATPase (µmol/mg of protein)	13.53 ± 0.91	3.63 ± 0.57	10.44 ± 0.96***	4.90 ± 0.72	7.02 ± 0.55*	8.66 ± 1.21**
Hepatic SOD (U/mg of protein)	12.17 ± 1.11	4.60 ± 0.89###	10.62 ± 0.90***	5.39 ± 0.56	8.25 ± 0.92*	10.04 ± 0.98**
Hepatic GSH (µg/mg protein)	13.58 ± 0.65	3.57 ± 0.59###	11.04 ± 0.64***	5.21 ± 0.48	6.60 ± 0.75**	8.69 ± 0.52***
Hepatic MDA (nM/mg of protein)	0.45 ± 0.13	3.13 ± 0.22###	1.89 ± 0.19***	2.58 ± 0.17	2.11 ± 0.07**	1.89 ± 0.19***
Hepatic NO (µg/mL)	111.7 ± 9.05	282.4 ± 13.92###	141.5 ± 9.92***	259.6 ± 13.59	216.5 ± 12.10**	164.3 ± 9.87***

Data are expressed as mean ± SEM (n = 5) and analyzed by one-way ANOVA followed by Dunnett’s test multiple range test. *p < 0.05, **p < 0.01 and ***p < 0.001 as compared with the Arsenic Control group. ###p < 0.001 as compared to normal group. N: Normal group; As: Arsenic Control group; CoQ10 (10): Coenzyme Q10 (10 mg/kg, p.o.) treated group; N (20): naringin (20 mg/kg, p.o.) treated group; N (40): naringin (40 mg/kg, p.o.) treated group and N (80): naringin (80 mg/kg, p.o.) treated group.

Figure 1. Effect of naringin on sodium arsenite-induced alteration in renal mRNA expression of KIM-1, Caspase-3, TGF-β and TNF-α in rats (A), quantitative representation of mRNA expression of KIM-1 (B), Caspase-3 (C), TGF-β (D) and TNF-α (E). Results are represented as mean ± SEM, (n = 4) Data was analyzed by One-way ANOVA followed by post hoc Dunnett’s tests. *p < 0.05, **p < 0.01 and ***p < 0.001 as compared with the Arsenic Control group. ###p < 0.001 as compared to normal group. N: Normal group; As: Arsenic Control group; CoQ10 (10): Coenzyme Q10 (10 mg/kg, p.o.) treated group; N (20): naringin (20 mg/kg, p.o.) treated group; N (40): naringin (40 mg/kg, p.o.) treated group and N (80): naringin (80 mg/kg, p.o.) treated group.

Figure 2. Effect of naringin on sodium arsenite-induced alteration in kidney histology of rats. Photomicrograph of sections of kidney from normal group (A); Arsenic Control group (B); Coenzyme Q10 (10 mg/kg, p.o.) treated group (C); Naringin (20 mg/kg, p.o.) treated group (D); Naringin (40 mg/kg, p.o.) treated group (E) and Naringin (80 mg/kg, p.o.) treated group (F). H & E staining at 100× and respective inset at 400×.

Figure 3. Effect of naringin on sodium arsenite-induced alteration in kidney histology of rats. Photomicrograph of sections of kidney from normal group (A); Arsenic Control group (B); Coenzyme Q10 (10 mg/kg, p.o.) treated group (C); Naringin (20 mg/kg, p.o.) treated group (D); Naringin (40 mg/kg, p.o.) treated group (E) and Naringin (80 mg/kg, p.o.) treated group (F). MT staining at 100×.

Figure 4. Effect of naringin on sodium arsenite-induced alteration in liver histology of rats. Photomicrograph of sections of liver from normal group (A); Arsenic Control group (B); Coenzyme Q10 (10 mg/kg, p.o.) treated group (C); Naringin (20 mg/kg, p.o.) treated group (D); Naringin (40 mg/kg, p.o.) treated group (E) and Naringin (80 mg/kg, p.o.) treated group (F). H & E staining at 100×.