Lactation deficit in OFA hr/hr rats may be caused by differential sensitivity to stress compared with Wistar and Sprague Dawley rats

Figures & data

Table I.  Primer sequences and reaction conditions used in the PCR amplification of the various cDNAs.

Gene	Sense primer (5′-3′)	Antisense primer (5′-3′)	Added cDNA (ng)	No. of cycles	Gene Bank Access	Product size (pb)	References
PR	CCCACAGGAGTTTGTCAAGCTC	TAACTTCAGACATCATTTCCGG	100	30	NM0228471	325	Shin (1980)
ERα	AATTCTGACAATCGACGCCAG	GTGCTTCAACATTCTCCCTCCTC	100	30	X061098	344	Shin (1980)
ERβ	AAAGCCAAGAGAAACGGTGGGCAT	GCCAATCATGTGCACCAGTTCCT	100	30	U57439	352	Shin (1980)
PRLRlong	AAAGTATCTTGTCCAGACTCGCTG	AGCAGTTCTTCAGACTTGCCCTT	100	30	M74152	279	Shin (1980)
β-actin	CGTGGGCCGCCCTAGGCACCA	TTGGCCTTAGGGTTCAGAGGGG	50	25	BC063166	243	Shin (1980)

Table II.  Statistical parameters of the two-way ANOVAS corresponding to the results presented in Figures 1 and 2.

		Prolactin		Progesterone		Corticosterone
	DF	F	P-value	F	P-value	F	P-value
Diestrus I
Interaction	4	3.805	0.009	4.518	0.003	2.181	0.082
Strain	2	4.653	0.014	21.28	P < 0.0001	23.06	P < 0.0001
Ether exp.	2	8.232	0.0008	40.71	P < 0.0001	65.15	P < 0.0001
Diestrus II
Interaction	4	0.6591	0.62	3.778	0.008	0.6892	0.60
Strain	2	7.302	0.001	6.852	0.002	19.72	P < 0.0001
Ether exp.	2	11.08	P < 0.0001	7.301	0.0015	35.04	P < 0.0001
Proestrus
Interaction	4	2.024	0.10	1.135	0.35	3.518	0.012
Strain	2	3.700	0.030	10.62	0.0001	13.89	P < 0.0001
Ether exp.	2	20.26	P < 0.0001	47.36	P < 0.0001	37.05	P < 0.0001
Estrus
Interaction	4	11.13	P < 0.0001	0.8188	0.52	2.257	0.073
Strain	2	32.96	P < 0.0001	6.469	0.0027	40.93	P < 0.0001
Ether exp.	2	22.81	P < 0.0001	22.17	P < 0.0001	38.53	P < 0.0001
G19
Interaction	4	3.052	0.060	0.01136	0.99	1.517	0.23
Strain	2	6.579	0.004	3.298	0.049	1.387	0.26
Ether exp.	1	4.068	0.052	0.07431	0.79	2.741	0.10
L12
Interaction	4	9.611	P < 0.0001	0.6250	0.65	2.622	0.045
Strain	2	4.868	0.010	24.83	P < 0.0001	0.3443	0.71
Ether exp.	2	35.84	P < 0.0001	0.05843	0.94	25.07	P < 0.0001
OVX
Interaction	4	1.648	0.17	7.440	P < 0.0001	4.410	0.003
Strain	2	11.36	P < 0.0001	31.20	P < 0.0001	4.720	0.012
Ether exp.	2	10.06	0.0002	34.63	P < 0.0001	69.39	P < 0.0001
OVX + estrogen
Interaction	4	2.250	0.076	15.12	P < 0.0001	1.188	0.32
Strain	2	47.37	P < 0.0001	11.20	P < 0.0001	26.44	P < 0.0001
Ether exp.	2	9.803	0.0002	55.25	P < 0.0001	12.07	P < 0.0001
OVX + progesterone
Interaction	4	3.182	0.018			2.140	0.087
Strain	2	5.729	0.0045			8.410	0.0006
Ether exp.	2	2.447	0.094			32.58	P < 0.0001
OVX + estrogen and progesterone
Interaction	4	1.522	0.20			0.2687	0.890
Strain	2	20.47	P < 0.0001			4.430	0.016
Ether exp.	2	0.3929	0.68			82.56	P < 0.0001

exp, exposure; G, gestation day; L, lactation day; OVX, ovariectomized.

Figure 1.  Changes in serum concentrations of prolactin, progesterone, and corticosterone in response to ether exposure in OFA, SD, and Wistar rats during the estrous cycle, late pregnancy, and mid-lactation. Panel A: prolactin (PRL), Panel B: progesterone (P₄), Panel C: corticosterone. Groups of 8–10 rats were moved to an experimental room and exposed to ether vapor for 2 min. Tail vein blood samples were collected as indicated; basal samples were taken under light ether anesthesia. Hormones were measured by radioimmunoassay in serum. Values are mean ± SEM. *P < 0.05 vs. basal concentration in the same strain, #P < 0.05 vs. Wistar rats at same time point, ^‡P < 0.05 vs. SD rats at same time point; two-way ANOVA and τ-test.

Figure 2.  Changes in serum concentrations of prolactin, progesterone, and corticosterone in response to ether exposure in ovariectomized rats after steroid hormone administration. Panel A: prolactin (PRL), Panel B: progesterone (P₄), Panel C: corticosterone. Two weeks after ovariectomy rats were divided into four groups: ovariectomized with oil administration (OVX); ovariectomized treated with estradiol benzoate (5 μg/rat s.c. 48 h previously, OVX+E₂); ovariectomized treated with progesterone (5 mg/rat s.c. 14 and 2 h previously, OVX + P₄); ovariectomized treated with estradiol and progesterone (OVX + E₂P₄). Groups of eight rats were moved to an experimental room and exposed to ether vapor for 2 min. Tail vein blood samples were collected as indicated; basal samples were taken under light ether anesthesia. Hormones were measured by radioimmunoassay in serum. Values are mean ± SEM. *P < 0.05 vs. basal concentrations of the same strain, #P < 0.05 vs. Wistar rats at the same time point, ^‡P < 0.05 vs. SD rats at the same time point; two-way ANOVA and τ-test.

Figure 3.  Effect of ether exposure on suckling-induced milk ejection and circulating hormones. Panel A: effect of stress on suckling-induced hormone release in lactating Wistar (Wi), SD, and OFA rats. Litters were separated from the mothers at 08.00 h for 8 h on 3 days. On day 2, dams were exposed to ether vapor for 2 min before reunion. Tail vein blood samples were collected under light ether anesthesia before pups were returned and after suckling for 30 min. Hormones were measured by radioimmunoassay in serum. Panel B: amount of milk drawn per pup nursed by non-stressed (day 1 and 3) and stressed mothers (day 2). The litters were weighed before reunion with their mothers at 16.00 h (0) and after 0.5, 2, and 4 h of suckling. Data are weight change between weighings. Panel C: total amount of milk obtained per pup in the 4 h suckling period. Data are mean ± SEM; n = 8–10 rats per group. Data were analyzed by two-way ANOVA and τ-test.

Table III.  Statistical parameters of the two-way ANOVAS corresponding to the results presented in Figures 3 and 4.

		Prolactin		Oxytocin		Progesterone
	DF	F	P-value	F	P-value	F	P-value
Effect of stress on suckling-induced hormone release in lactating rats
Interaction	6	9.128	P < 0.0001	2.647	0.038	2.074	0.095
Rat strain	2	1.872	0.16	2.063	0.13	0.0642	0.94
Suckling and stress	3	13.97	P < 0.0001	20.28	P < 0.0001	36.01	P < 0.0001
		OFA		Wistar		SD
Rat strain	DF	F	P-value	F	P-value	F	P-value
Effect of stress on the amount of milk drawn per pup
Interaction	4	9.128	P < 0.0001	2.647	0.038	2.074	0.095
Stress	2	1.872	0.16	2.063	0.13	0.0642	0.94
Time	2	13.97	P < 0.0001	20.28	P < 0.0001	36.01	P < 0.0001
Effect of stress on the amount of milk drawn per pup in the 4-h suckling period
Interaction	4	1.115	0.36
Stress	2	4.244	0.017
Rat strain	2	65.35	P < 0.0001
		Prolactin		No. of surviving pups
	DF	F	P-value	DF	F	P-value
Effect of diazepam treatment on pup survival and circulating prolactin
Interaction	3	1.732	0.17	11	0.714	0.73
Treatment	1	22.75	P < 0.0001	1	82.25	P < 0.0001
Time	3	18.70	P < 0.0001	11	21.95	P < 0.0001

Figure 4.  Effect of diazepam on the lactation performance of OFA hr/hr rats. Panel A: the percentage of surviving litters. Panel B: number of surviving pups per litter. Panel C: pup weight gain. Panel D: serum prolactin concentrations on days 2 (L2) and 7 (L7) and after 8 h separation (separated) and 30 min suckling (suckled) on day 12 of lactation (L12). Lactating OFA rats were given diazepam (DZP) in the drinking water or water alone (Co) from day 19 of pregnancy until day 15 of lactation. OFA dams nursed eight SD foster pups. Data are mean ± SEM of groups of 18 rats for panels A–C and 8–10 rats for panel D. *P < 0.05 vs. control rats; two-way ANOVA and τ-test.

Figure 5.  Hypothalamic prolactin (long form, PRLR_long), estradiol (ER), and progesterone (PR) receptor mRNA abundance by RT PCR and progesterone receptor protein by Western blot at the end of pregnancy in OFA, SD, and Wistar rats. Panel A: representative photograph of RT-PCR products run in 1.5% agarose gel of three samples of each strain of rats. Panel B: semiquantitative PCR analysis of total PR, ERα, ERβ, and PRLR_long mRNA abundance relative to β-actin in mediobasal hypothalamus (MBH). Panel C: representative immunoblots of hypothalamic PR isoforms and β-actin in the three rat strains. Panel D: expression relative to β-actin of PR isoforms A and B, PR isoform ratio, and total PR. Data are mean ± SEM; n = 8 rats of each strain. #P < 0.05 vs. Wistar and SD rats, *P < 0.05 vs. Wistar rats, ^‡P < 0.05 vs. SD rats; two-way ANOVA and τ-test.

Shin SH. 1980. Physiological evidence for the existence of prolactin releasing factor: Stress-induced prolactin secretion is not linked to dopaminergic receptors. Neuroendocrinology. 31:375–379.

 PubMed Web of Science ®Google Scholar