Dexamethasone facilitates lipid accumulation in chicken skeletal muscle

Figures & data

Table I.  Gene-specific primer of related genes.

Gene name	Genebank number	Primers position	Primers sequences (5′ → 3′)	Product size (bp)
GAPDH	NM_204305	Forward	ctacacacggacacttcaag	244
		Reverse	acaaacatgggggcatcag
18SrRNA	AF173612	Forward	ataacgaacgagactctggca	136
		Reverse	cggacatctaagggcatcaca
GR	DQ227738	Forward	catgaacctcgaagctcgcaaga	159
		Reverse	acctccagcagtgacaccag
VLDLR	NM_205229	Forward	actgtgaggatgggtctgacga	101
		Reverse	tgggatacactgggttgactgag
LPL	NM_205282	Forward	cagtgcaacttcaaccatacca	150
		Reverse	aaccagccagtccacaacaa
FATP1	DQ352834	Forward	tcaggagatgtgttggtgatggat	138
		Reverse	cgtctggttgaggatgtgactc
H-FABP	NM_001030889	Forward	tgaccaaacccaccaccatca	203
		Reverse	tgtctccttcccatcccacttc
L-CPT1	AY675193	Forward	ggagaacccaagtgaaagtaatgaa	135
		Reverse	gaaacgacataaaggcagaacaga
LCAD	NM_001006511	Forward	cgtggtgattgtggttacggtta	203
		Reverse	tgttctctttcccaagcaaggc
AMPKα2	DQ340396	Forward	gggacctgaaaccagagaacg	215
		Reverse	acagaggagggcatagaggatg

Note: AMPKα2, AMP-activated protein kinase α2; FATP1, fatty acid transport protein 1; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GR, glucocorticoid receptor; H-FABP, heart fatty acid-binding protein; LCAD, long-chain acyl-CoA dehydrogenase; L-CPT1, liver carnitine palmitoyltransferase 1; LPL, lipoprotein lipase; VLDLR, very low-density lipoprotein receptor; 18SrRNA, 18S ribosomal RNA.

Figure 1.  Oil Red O staining of skeletal muscle for cytoplasmic lipid droplets (indicated by arrows) showing effect of dexamethasone treatment (DEX, daily subcutaneous injection of 2 mg/kg body weight for 3 days, B,D) on lipid accumulation in myocytes of PM (A,B) and BF (C,D) from broiler chickens in Trial 1. The scale bar in (A) represents 50 μm. (E) Indicates the volume density (V_v × 40) of Oil Red O positive muscle fibres in skeletal muscle. Values are means ± SE (n = 5). Different superscripts (a,b) indicate significant differences (P < 0.05) in the means, by ANOVA and Duncan's multiple test.

Figure 2.  Effect of dexamethasone treatment (DEX, daily subcutaneous injection of 2 mg/kg body weight for 3 days) on protein levels of β-actin (A) and phospho-AMPK αThr172 (B) in PM and BF from broiler chickens in Trial 1. Values are means ± SE (n = 4). Different superscripts (a,b) indicate significant differences (P < 0.05) in the means, by ANOVA and Duncan's multiple test.

Figure 3.  Effect of dexamethasone treatment (DEX, daily subcutaneous injection of 2 mg/kg body weight for 3 days) on CPT1 activity (nmol/min/mg protein) in PM and BF from broiler chickens in Trial 1. Values are means ± SE (n = 8). Different superscripts (a,b) indicate significant differences (P < 0.05) in the means, by ANOVA and Duncan's multiple test.

Table II.  Effect of dexamethasone treatment (daily subcutaneous injection, 2 mg/kg body weight for 3 days) on body weight gain, skeletal muscle growth and lipid accumulation in skeletal muscle of broiler chickens.

	Control	Dexamethasone	Pair-fed	P
Body weight gain (g/day)	41.38 ± 2.15^a	− 27.99 ± 0.91^c	18.35 ± 1.68^b	< 0.0001
Muscle yield (g)
Breast	344.46 ± 14.40^a	291.51 ± 11.33^b	343.01 ± 10.57^a	0.007
Thigh	242.81 ± 10.88	214.46 ± 6.27	239.04 ± 11.21	NS
Fat content in breast muscle (%)
Feeding status	2.97 ± 0.18^b	5.64 ± 0.26^a	3.42 ± 0.20^b	< 0.0001
Fasting status	3.00 ± 0.30^a,b	3.44 ± 0.12^a	2.72 ± 0.11^b	0.055
Fat content in thigh muscle (%)
Feeding status	3.13 ± 0.14^b	6.11 ± 0.32^a	3.71 ± 0.16^b	< 0.0001
Fasting status	3.29 ± 0.29^a,b	4.05 ± 0.36^a	2.80 ± 0.32^b	0.038
Abdominal fat (g)	22.09 ± 2.16	23.51 ± 2.22	21.39 ± 1.99	NS
Cervical fat (g)	6.95 ± 0.90	7.93 ± 0.68	6.75 ± 0.63	NS
Thigh fat (g)	7.65 ± 0.88	9.68 ± 1.02	7.14 ± 0.78	NS

Note: Values are means ± SE (n = 8 per group); NS, not significant, P>0.05; means within the same line with different superscripts (a,b,c) differ significantly, P < 0.05, by ANOVA and Duncan's multiple test.

Figure 4.  Effect of vehicle (control), dexamethasone (DEX, daily subcutaneous injection of 2 mg/kg body weight for 3 days) or vehicle and pair-feeding (pair-fed) on the activity of LPL (U/mg protein) and AMPK (10 CPM/ng protein) in PM (A) and BF (B) from broiler chickens during feeding or fasting. CPM, count per minute. Values are means ± SE (n = 8). Different superscripts (a,b) indicate significant differences (P < 0.05) in the means, by ANOVA and Duncan's multiple test.

Figure 5.  Effect of vehicle (control), dexamethasone (DEX, daily subcutaneous injection of 2 mg/kg body weight for 3 days) or vehicle and pair-feeding (pair-fed) on mRNA expression in PM. mRNAs from broiler chickens during feeding (A,B) and fasting (C,D). Values are means ± SE (n = 8). Different superscripts (a,b) indicate significant differences (P < 0.05) in the means, by ANOVA and Duncan's multiple test.

Figure 6.  Effect of vehicle (control), dexamethasone (DEX, daily subcutaneous injection of 2 mg/kg body weight for 3 days) or vehicle and pair-feeding (pair-fed) on mRNA expression in BF. mRNA levels from broiler chickens during feeding (A,B) and fasting (C,D). Values are means ± SE (n = 8). Different superscripts (a,b) indicate significant differences (P < 0.05) in the means, by ANOVA and Duncan's multiple test.

Figure 7.  Effect of vehicle (control), dexamethasone (DEX, daily subcutaneous injection of 2 mg/kg body weight for 3 days) or vehicle and pair-feeding (pair-fed) on protein levels of ATGL in PM and BF from broiler chickens during feeding (A) and fasting (B). Values are means ± SE (n = 4). Different superscripts (a,b) indicate significant differences (P < 0.05) in the means, by ANOVA and Duncan's multiple test.