Glucocorticoids retard skeletal muscle development and myoblast protein synthesis through a mechanistic target of rapamycin (mTOR)-signaling pathway in broilers (Gallus gallus domesticus)

Figures & data

Figure 1. Schematic diagrams of experimental design. DEX, dexamethasone; LEU, leucine.

Table 1. Gene-specific primers of related genes.

Gene name	Genbank number	Primer position	Primer sequences (5′→3′)	Product size (bp)
mTOR	XM_417614	Forward	gaagtcctgcgcgagcataag	92
		Reverse	tttgtgtccatcagcctccagt
p70S6K	NM_001030721.1	Forward	attcgatcacctcgcagattcatag	111
		Reverse	agtatttgatgcgctggcagaag
4EBP1	XM_424384	Forward	ttcccaccagccaggcttac	142
		Reverse	gtgtattcacacccacacggaga
Akt1	NM_205055.1	Forward	cattcccgccattatgaatgaagta	130
		Reverse	cttgtagccaatgaatgtgccatc
AMPKα2	NM_001039605.1	Forward	gggacctgaaaccagagaacg	215
		Reverse	acagaggagggcatagaggatg
GAPDH	NM_204305	Forward	ctacacacggacacttcaag	244
		Reverse	acaaacatgggggcatcag

AMPKα2, AMP-activated protein kinase α2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; mTOR, mechanistic target of rapamycin; p70S6K, ribosomal protein S6 protein kinase; 4EBP1, eukaryotic initiation factor 4E-binding protein1.

Table 2. The effect of dexamethasone (2 mg/kg body mass) and dietary treatments on the growth performance of broiler chickens.

Item	Treat	LEU	ALA	Mean	p value
BM (g)	DEX	1445 ± 20.0	1434 ± 10.9	1440	<0.001 (DEX)
	Control	1636 ± 30.5	1628 ± 8.67	1632	0.63 (AA)
	Mean	1540	1531		0.96 (DEX × AA)
BM gain (g/d)	DEX	−17.2 ± 2.96	−18.3 ± 3.43	−17.8^b	<0.001 (DEX)
	Control	62.5 ± 2.82	66.0 ± 3.10	64.3^a	0.71 (AA)
	Mean	28.4	23.9		0.48 (DEX × AA)
Feed intake (g/d)	DEX	131.0 ± 10.8	119.8 ± 2.76	125.4	0.076 (DEX)
	Control	133.5 ± 4.20	140.9 ± 2.65	137.2	0.76 (AA)
	Mean	132.3	130.3		0.15 (DEX × AA)
Feed:gain (g/g)	DEX	−7.49 ± 1.44	−7.22 ± 1.24	−7.33^b	<0.001 (DEX)
	Control	2.14 ± 0.05	2.14 ± 0.07	2.14^a	0.89 (AA)
	mean	−1.99	−2.54		0.88 (DEX × AA)

Values are mean ± SEM (n = 4). ^a,bMeans with different letters differ significantly (p < 0.05), by ANOVA and Duncan’s multiple test. AA, amino acid; ALA, alanine; BM, body mass; DEX, dexamethasone; LEU, leucine.

Table 3. The effect of dexamethasone (2 mg/kg body mass) and dietary treatments on skeletal muscle growth in broiler chickens.

Item	Treat	LEU	ALA	Mean	p value
Breast muscle mass (g)	DEX	128.3 ± 2.69	117.5 ± 2.86	122.9^b	<0.001 (DEX)
	Control	142.7 ± 2.12	143.6 ± 3.49	143.1^a	0.085 (AA)
	Mean	135.5	130.5		0.042 (DEX × AA)
Thigh muscle mass (g)	DEX	100.7 ± 2.28	101.6 ± 3.08	101.2^b	<0.001 (DEX)
	Control	111.6 ± 2.31	110.9 ± 2.82	111.2^a	0.98 (AA)
	Mean	106.2	106.2		0.75 (DEX × AA)
Breast yield (% BM)	DEX	18.4 ± 0.39	17.0 ± 0.32	17.7	0.38 (DEX)
	Control	18.1 ± 0.25	18.0 ± 0.36	18.0	0.023 (AA)
	mean	18.3^m	17.5^n		0.066 (DEX × AA)
Thigh yield (% BM)	DEX	14.5 ± 0.30	14.7 ± 0.38	14.6^a	0.025 (DEX)
	Control	14.0 ± 0.21	13.8 ± 0.25	13.9^b	0.83 (AA)
	mean	14.2	14.3		0.49 (DEX × AA)

Values are mean ± SEM (n = 16). ^a,b,m,nMeans with different letters differ significantly (p < 0.05), by ANOVA and Duncan’s multiple test. AA, amino acid; ALA, alanine; BM, body mass; DEX, dexamethasone; LEU, leucine.

Table 4. The effect of dexamethasone (2 mg/kg body mass) and dietary treatments on plasma concentrations of glucose, urate, and insulin in broiler chickens in the fasting state.

Item	Treat	LEU	ALA	Mean	p value
Glucose (mmol/L)	DEX	14.7 ± 0.37	14.3 ± 0.72	14.5^a	<0.001 (DEX)
	Control	10.4 ± 0.49	13.1 ± 0.39	11.8^b	0.027 (AA)
	Mean	12.5^n	13.7^m		0.003 (DEX × AA)
Urate (µmol/L)	DEX	512.1 ± 45.2	539.2 ± 69.2	525.6^a	<0.001 (DEX)
	Control	218.6 ± 25.2	229.5 ± 19.2	223.6^b	0.67 (AA)
	Mean	359.0	391.7		0.86 (DEX × AA)
Insulin (µIU/mL)	DEX	13.1 ± 2.42	10.4 ± 1.90	11.8^a	<0.001 (DEX)
	Control	4.38 ± 0.70	4.34 ± 0.44	4.36^b	0.41 (AA)
	mean	9.04	7.37		0.42 (DEX × AA)

Values are mean ± SEM (n = 12). ^a,b,m,nMeans with different letters differ significantly (p < 0.05), by ANOVA and Duncan’s multiple test. AA, amino acid; ALA, alanine; DEX, dexamethasone; LEU, leucine.

Table 5. The effect of dexamethasone (2 mg/kg body mass) and dietary treatments on plasma concentrations of glucose, urate, and insulin in broiler chickens in the re-feeding state.

Item	Treat	LEU	ALA	Mean	p value
Glucose (mmol/L)	DEX	15.7 ± 0.86	17.3 ± 0.93	16.5^a	<0.001 (DEX)
	Control	14.1 ± 0.16	14.3 ± 0.33	14.2^b	0.19 (AA)
	Mean	14.9	15.7		0.29 (DEX × AA)
Urate (µmol/L)	DEX	785.1 ± 65.9	803.6 ± 78.7	794.7^a	0.004 (DEX)
	Control	547.5 ± 47.7	658.3 ± 50.9	605.3^b	0.31 (AA)
	Mean	666.3	730.9		0.46 (DEX × AA)
Insulin (µIU/mL)	DEX	18.6 ± 2.59	21.1 ± 3.02	19.9^a	0.035 (DEX)
	Control	15.2 ± 1.79	13.9 ± 1.77	14.5^b	0.79 (AA)
	Mean	17.0	17.5		0.43 (DEX × AA)

Values are mean ± SEM (n = 12). ^a,bMeans with different letters differ significantly (p < 0.05), by ANOVA and Duncan’s multiple test. AA, amino acid; ALA, alanine; DEX, dexamethasone; LEU, leucine.

Figure 5. The effect of dexamethasone (daily subcutaneous injection of 2 mg/kg body mass for 4 d) and dietary leucine supplement (1%) on the phosphorylation of mTOR, p70S6K, Akt, and AMPK in PM of broiler chickens in the re-feeding state. The values shown are mean ± SEM (n = 6); ^a,b,cmeans with different letters are significantly different (p < 0.05); *p < 0.05 and **p < 0.01, by ANOVA and Duncan’s multiple test. AMPK, AMP-activated protein kinase; DEX, dexamethasone; LEU, leucine; mTOR, mechanistic target of rapamycin; PM, M. pectoralis major; p70S6K, ribosomal protein S6 protein kinase.