Synergistic effect of emodin in combination with ampicillin or oxacillin against methicillin-resistant Staphylococcus aureus

Figures & data

Table 1.  Sequences of the primers used in PCR.

Lens		Sequence (5′ to 3′)
mecA	forward primer	ATGAGATTAGGCATCGTTTC
	reverse primer	TGGATGACAGTACCTGAGCC

Table 2.  The S. aureus strains used in the experiments.

S. aureus strain		mecA gene*	Antibioticresistance pattern†
MSSA	ATCC 25923	–	–
MRSA	ATCC 33591	+	AM, OX
Clinical isolates	DPS 1^‡	+	AM, OX
	DPS 2	+	AM, OX
	DPS 3	+	AM, OX
	DPS 4	+	AM, OX
	DPS 5	+	AM, OX
	DPS 6	+	AM, OX
	DPS 7	+	AM, OX
	DPS 8	+	AM, OX
	DPS 9	+	AM, OX
	DPS 10	+	AM, OX
	DPS 11	+	AM, OX
	DPS 12	+	AM, OX
	DPS 13	+	AM, OX
	DPS 14	+	AM, OX
	DPS 15	+	AM, OX

^†AM, ampicillin; OX, oxacillin.

^‡DPS indicates staphylococcal strains from the Department of Plastic Surgery, Wonkwang University Hospital.

Figure 1.   Determination of antibacterial activity by the disc diffusion method.

Table 3.  The antimicrobial activity (as inhibition zone diameters) of EM, AM and OX against S. aureus strains.

S.aureus strain		Zone of inhibition (mm)
		Emodin		Ampicillin^†	Oxacillin
		10 μg	50 μg	10 μg	1 μg
MSSA	ATCC 25923	12	19	30	16
MRSA	ATCC 33591	26	30	20	–
Clinical isolates	DPS 1^*	15	18	13	–
	DPS 2	18	23	14	7
	DPS 3	18	23	14	–
	DPS 4	18	22	13	–
	DPS 5	18	19	11	–
	DPS 6	16	20	8	–
	DPS 7	19	20	12	–
	DPS 8	14	21	15	–
	DPS 9	24	24	11	–
	DPS 10	18	26	16	8
	DPS 11	17	22	12	–
	DPS 12	19	22	19	–
	DPS 13	17	20	13	–
	DPS 14	20	23	17	–
	DPS 15	21	23	18	–

^*DPS indicates staphylococcal strains from the Department of Plastic Surgery, Wonkwang University Hospital.

^†AM resistance ≤ 28 mm, OX resistance ≤ 10 mm; –, absence of inhibition.

Table 4.  The MICs of EM, AM, OX against S. aureus strain.

S.aureus strain		MIC (μg/mL)
		Emodin	Ampicillin	Oxacillin
MSSA	ATCC 25923	25	0.9	1.9
MRSA	ATCC 33591	25	62.5	1000
Clinical isolates	DPS 1 ^*	25	31.25	500
	DPS 2	1.56	31.25	1000
	DPS 3	1.56	31.25	1000
	DPS 4	25	31.25	1000
	DPS 5	6.25	31.25	1000
	DPS 6	1.56	31.25	250
	DPS 7	1.56	62.5	500
	DPS 8	1.56	125	500
	DPS 9	1.56	125	500
	DPS 10	1.56	62.5	500
	DPS 11	1.56	125	500
	DPS 12	1.56	125	500
	DPS 13	1.56	125	500
	DPS 14	12.5	62.5	1000
	DPS 15	1.56	125	500

^*DPS indicates staphylococcal strains from the Department of Plastic Surgery, Wonkwang University Hospital.

Table 5.  Result of the combined effect of EM and AM against S. aureus.

S.aureus strain		MIC (μg/mL)				FICI
		EM Alone^¶	With AM^§	AM Alone	With EM
MSSA	ATCC 25923	25	6.25	0.9	0.22	0.5
MRSA	ATCC 33591	25	6.25	62.5	15.62	0.5
Clinical isolates	DPS 1^*	25	6.25	31.25	7.81	0.5
	DPS 2	1.56	0.39	31.25	7.81	0.5
	DPS 3	1.56	0.39	31.25	7.81	0.5
	DPS 4	25	3.12	31.25	7.81	0.37
	DPS 5	6.25	1.56	31.25	7.81	0.5
	DPS 6	1.56	0.39	31.25	7.81	0.5
	DPS 7	1.56	0.39	62.5	15.31	0.5
	DPS 8	1.56	0.39	125	31.25	0.5
	DPS 9	1.56	0.39	125	15.31	0.37
	DPS 10	1.56	0.39	62.5	15.31	0.5
	DPS 11	1.56	0.39	125	15.31	0.37
	DPS 12	1.56	0.39	125	15.31	0.37
	DPS 13	1.56	0.39	125	15.31	0.37
	DPS 14	12.5	3.12	62.5	15.31	0.5
	DPS 15	1.56	0.39	125	15.31	0.37

^*DPS indicates staphylococcal strains from the Department of Plastic Surgery, Wonkwang University Hospital.

MIC, Minimum Inhibitory Concentration; FICI, Fractional Inhibitory Concentration Index: <0.5, synergy; 0.5–0.75, partial synergy; 0.76–1, additive effect; >1–4, indifference; and >4, antagonism (Choi et al., 2008).

^¶Alone, not combinated with EM or AM.

^§With AM, EM + AM.

Table 6.  Result of the combined effect of EM and OX against S. aureus.

S.aureus strain		MIC (μg/mL)				FICI
		EM Alone^¶	With OX^§	OX Alone	With EM
MSSA	ATCC 25923	25	6.25	1.9	0.47	0.5
MRSA	ATCC 33591	25	6.25	1000	250	0.5
Clinical isolates	DPS 1^*	25	6.25	500	125	0.5
	DPS 2	1.56	0.39	1000	250	0.5
	DPS 3	1.56	0.39	1000	250	0.5
	DPS 4	25	6.25	1000	250	0.5
	DPS 5	6.25	1.56	1000	250	0.5
	DPS 6	1.56	0.39	250	125	0.75
	DPS 7	1.56	0.39	500	125	0.5
	DPS 8	1.56	0.39	500	125	0.5
	DPS 9	1.56	0.39	500	125	0.5
	DPS 10	1.56	0.39	500	125	0.5
	DPS 11	1.56	0.39	500	125	0.5
	DPS 12	1.56	0.39	500	125	0.5
	DPS 13	1.56	0.39	500	250	0.5
	DPS 14	12.5	0.39	1000	125	0.37
	DPS 15	1.56	0.39	500	125	0.5

^*DPS indicates staphylococcal strains from the Department of Plastic Surgery, Wonkwang University Hospital.

MIC, Minimum Inhibitory Concentration; FICI, Fractional Inhibitory Concentration Index: <0.5, synergy; 0.5–0.75, partial synergy; 0.76–1, additive effect; >1–4, indifference; and >4, antagonism (Choi et al., 2008).

^¶Alone, alone compound.

^§With OX, EM + OX.

Choi JG, Kang OH, Lee YS, Oh YC, Chae HS, Jang HJ, Kim JH, Sohn DH, Shin DW, Park H, Kwon DY (2008): In vitro activity of methyl gallate isolated from Galla Rhois alone and in combination with ciprofloxacin against clinical isolates of Salmonella. J Microbiol Biotechnol 18: 1848–1852.

 PubMed Web of Science ®Google Scholar