Biofilm development by clinical isolates of Staphylococcus spp. from retrieved orthopedic prostheses

Figures & data

Table 1. Sequences of the primers used, sizes of the expected PCR products, and references

Gene	Primer	Sequence (5'-3')	PCR product (bp)	Reference strain	Reference
icaA	icaA-F	TCTCTTGCAGGAGCAATCAA		ATCC35984	Arciola et al. (2002)
	icaA-R	TCAGGCACTAACATCCAGCA	188
icaD	icaD-F	ATGGTCAAGCCCAGACAGAG		ATCC35984	Arciola et al. (2002)
	icaD-R	CGTGTTTTCAACATTTAATGCAA	198
icaB	icaB-F	ATGGCTTAAAGCACACGACGC		ATCC35984	Cafiso et al. (2004)
	icaB-R	TATCGGCATCTGGTGTGACAG	526
icaC	icaC-F	ATCATCGTGACACACTTACTAACG		ATCC35984	Cafiso et al. (2004)
	icaC-R	CTCTCTTAACATCATTCCGACGCC	934
icaR	icaR-F	TACTGTCCTCAATAATCCCGAA		ATCC35984	Cafiso et al. (2004)
	icaR-R	GGTACGATGGTACTACACTTGATG	453

Table 2. Results obtained with each technique

Patient no.	Sample no.	Strain	Species	Isolated in conventional culture	MP/OD (SD) ^a	STEP ^b	CLSM (%) ^c	ica ^d	icaR
1	1	P-1	S. aureus	Yes	0.232 (0.071)	1+	+ (49.9)	+	+
2	2	P-2	S. aureus	Yes	0.139 (0.040)	1+	+ (35.2)	+	–
6	4	P-4	S. aureus	No	0.196 (0.065)	2+	-	+	–
10	18	P-18	S. aureus	Yes	0.128 (0.043)	1+	+ (58.1)	+	–
11	19	P-19	S. aureus	No	0.134 (0.034)	1+	–	+	–
20	38	P-38	S. aureus	No	0.153 (0.048)	1+	+ (43.7)	+	–
45	41	P-41	S. aureus	Yes	0.122 (0.024)	1+	–	+	–
30	61	P-61.3	S. aureus	Yes	0.172 (0.043)	0+	–	+	–
30	61	P-61.4	S. aureus	Yes	0.151 (0.040)	1+	–	+	–
30	62	P-62.1	S. aureus	Yes	0.161 (0.054)	1+	+ (77.1)	+	–
33	68	P-68	S. aureus	Yes	0.155 (0.041)	1+	–	+	–
39	82	P-82.1	S. aureus	Yes	0.160 (0.056)	1+	–	+	–
49	95	P-95	S. aureus	Yes	1.109 (0.361)	0+	–	+	+
4	6	P-6.2	S. epidermidis	No	0.171 (0.122)	1+	–	+	–
4	6	P-6.5	S. epidermidis	No	0.234 (0.052)	3+	+ (51.2)	+	–
12	23	P-23.2	S. epidermidis	Yes	0.136 (0.024)	1+	–	–	–
18	33	P-33.1	S. epidermidis	Yes	0.256 (0.054)	3+	+ (54.6)	–	–
26	53	P-53.2	S. epidermidis	Yes	0.206 (0.090)	2+	+ (50.0)	+	+
27	55	P-55	S. epidermidis	No	0.209 (0.031)	1+	+ (51.6)	+	+
30	61	P-61.1	S. epidermidis	No	0.146 (0.027)	1+	–	–	–
30	61	P-61.2	S. epidermidis	No	0.139 (0.040)	1+	–	–	–
35	74	P-74	S. epidermidis	Yes	0.297 (0.052)	1+	–	+	+
52	101	P-101	S. epidermidis	Yes	0.236 (0.138)	0+	+ (49.7)	–	–
12	23	P-23.1	S. warneri	No	0.160 (0.035)	1+	–	–	–
26	53	P-53.7	S. hominis	No	0.219 (0.069)	2+	–	+	+
31	65	P-65	S. lugdunensis	Yes	0.139 (0.033)	1+	–	–	–

^a MP/OD: microtiter plate assay / mean optical density (SD);

^b STEP: Stepanovic test: 0+ (no biofilm), 1+: weak biofilm producer, 2+: moderate biofilm producer, 3+: strong biofilm producer;

^c CLSM: confocal laser scanning microscopy assay (percentage of live bacteria inside the biofilm).

^dica: PCR detection of icaA and/or icaD genes.

Figure 1. CLSM images. A. Biofilm-positive S. aureus (strain P-1). B. Biofilm-positive S. epidermidis (strain P-6.5). C. Biofilm-negative S. aureus (strain P-41).

Figure 2. Agarose gel electrophoresis of PCR products. Each PCR run included the reference ATCC 35984 ica-positive strain, and a positive and a negative strain from our collection.

Arciola CR, Campoccia D, Cervellati M, Donati E, Montanaro L. Detection of slime production by means of an optimised Congo red agar plate test based on a colourimetric scale in Staphylococcus epidermidis clinical isolates genotyped for ica locus. Biomaterials 2002; 23:4233-9.

 PubMed Web of Science ®Google Scholar

Cafiso V, Bertuccio T, Santagati M, Campanile F, Amicosante G, Perilli MG, . Presence of the ica operon in clinical isolates of Staphylococcus epidermidis and its role in biofilm production. Clin Microbiol Infect 2004; 10(12):1081-8.

 PubMedGoogle Scholar