Brucella CβG induces a dual pro- and anti-inflammatory response leading to a transient neutrophil recruitment

Figures & data

Table 1. Fold changes in gene expression in CβG- versus E. coli LPS-treated human blood mDC. Table 1 lists 34 genes over-expressed at least 4.5-fold higher in CβG-stimulated cells compared to E. coli LPS-stimulated cells (at 6 h post-treatment). Data were normalized against cells treated for 6 h with culture media only

Fold change	Gene Symbol	Gene Description	Genbank number
16,2960457	DFNA5	deafness, autosomal dominant 5	NM_004403.2
14,0900781	CFB	complement factor B	NM_001710.4
13,60613	MAOA	monoamine oxidase A, nuclear gene encoding mitochondrial protein	NM_000240.2
13,1097147	IL6	interleukin 6	NM_000600.1
12,580871	ITGA9	integrin, α 9	NM_002207.2
11,9337847	TNIP3	TNFAIP3 interacting protein 3	NM_024873.3
11,8534761	GJB2	gap junction protein, β 2, 26kDa	NM_004004.4
9,83164123	PTGS2	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	NM_000963.1
9,7861406	BATF	basic leucine zipper ion factor, ATF-like	NM_006399.2
8,4711145	IL1F9	interleukin 1 family, member 9	NM_019618.2
8,45774549	IL2RA	interleukin 2 receptor, α	NM_000417.1
8,32768687	CXCR7	chemokine (C-X-C motif) receptor 7	NM_020311.2
8,239224	PLAT	plasminogen activator, tissue	NM_000930.2
8,18870443	ADARB1	adenosine deaminase, RNA-specific, B1	NM_001033049.1
7,96050487	CLGN	calmegin	NM_004362.1
6,77065691	KCNJ2	potassium inwardly-rectifying channel, subfamily J, member 2	NM_000891.2
6,63411098	TNFAIP6	tumor necrosis factor, α-induced protein 6	NM_007115.2
6,56358736	HEY1	hairy/enhancer-of-split related with YRPW motif 1	NM_001040708.1
6,22630244	PLAC8	placenta-specific 8	NM_016619.1
6,21326365	TFRC	transferrin receptor (p90, CD71)	NM_003234.1
5,7156289	UPB1	ureidopropionase, β	NM_016327.2
5,6420305	AQP9	aquaporin 9	NM_020980.2
5,63400352	ZP3	zona pellucida glycoprotein 3 (sperm receptor)	NM_007155.4
5,6153173	TNFRSF21	tumor necrosis factor receptor superfamily, member 21	NM_014452.3
5,38003118	LILRA3	leukocyte immunoglobulin-like receptor, subfamily A (without TM domain), member 3	NM_006865.2
5,29230455	ITM2C	integral membrane protein 2C	NM_001012516.1
5,22805328	SMPDL3A	sphingomyelin phosphodiesterase, acid-like 3A	NM_006714.2
5,16244294	RASGRP1	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	NM_005739.2
5,0282775	CXCL2	chemokine (C-X-C motif) ligand 2	NM_002089.3
4,92399264	SLC11A1	solute carrier family 11 (proton-coupled divalent metal ion transporters), member 1	NM_000578.3
4,89471027	TRAF3IP2	TRAF3 interacting protein 2	NM_147686.1
4,85717514	SOCS2	suppressor of cytokine signaling 2	NM_003877.3
4,84210367	PTX3	pentraxin-related gene, rapidly induced by IL-1 β	NM_002852.2
4,50411755	ADAMDEC1	ADAM-like, decysin 1	NM_014479.2

Figure 1. Transcriptional profiling of human blood mDC from healthy donors stimulated with CβG (n = 5) or LPS (n = 4), respectively.(A) Heatmap representing the transcriptional expression levels of 15 regulatory genes differentially expressed between CβG and medium control (Welch T-test, P < 0.05). Data are normalized to the 6 h medium control for each donor. (B) Heatmap representing the transcriptional expression levels of 18 chemokines differentially expressed in mDc treated with CβG, LPS or cell culture medium. (C) Barcharts representing the raw expression value of CXCL2, IL8, PTGS2, SOCS3 and TNFAIP6 for the average of the 4 donors. Error bars represent the standard deviation. Ordinary one-way ANOVA with Tukey post-hoc test was conducted (***: P < 0.001; **: P < 0.01; *: P < 0.05; n.s: not significant).

Figure 2 (See previous page). Induction of gene expression in murine DC stimulated with Brucella CβG or E. coli LPS. (A) Murine BMDC were stimulated for 8 h and 24 h with E. coli LPS (black bars) or Brucella CβG (gray bars). mRNA was extracted from stimulated cells and qPCR performed to determine transcript expression levels of CXCL2, KC and PTGS2. Fold-increases were estimated by comparing with cells that had been stimulated with PBS as a negative control. Basal expression levels for each gene are indicated (dash line). HPRT was used as a housekeeping gene to normalize the data. An induction level of more than 2 is considered as significant. Mean ± standard deviation of 3 independent experiments is represented here. Mann-Whitney test, one-tailed (analysis on GraphPad Prism) has been done and P < 0.05 is denoted by “*."(B) Expression levels of SOCS3 and TNFAIP6 mRNA were assessed. Experiments were processed as described above. Three independent experiments were carried out. An induction level of more than 2 is considered as significant. Mean ± standard deviation of 3 independent experiments is represented here. (C) BMDC stimulated for 8 h or 24 h with PBS (control), E. coli LPS or Brucella CβG were lysed and protein purified. The expression of tsg-6 protein was assessed by western blot using 10 μg of recombinant tsg-6 as a positive control. β-actin expression was used as control. At least 3 independent experiments were carried out and one representative is shown here.

Figure 3. Brucella CβG induces the recruitment of CD11b⁺, LyG6⁺, and Gr1⁺ cells at the site on injection. (A) Mouse ears intradermally injected with PBS, E. coli LPS or Brucella CβG were recovered at 48 h post-injection and stained for hematoxylin and eosin. (B) Mouse ears injected with PBS, E. coli LPS or Brucella CβG were recovered at 48 h post-injection, embedded in tissueteck OCT compound and frozen in isopentan. 15 μm thick cryosections were then stained with CD11b (blue), Gr1 (red), Ly6G (green) and DAPI (gray) before observation under a Zeiss LSM 510. Bar: 0.25 mm.

Figure 4. Brucella CβG induces a transient neutrophil recruitment at 12 h post-injection. (A) Cells were extracted from mouse ears at 2 h, 6 h, 12 h, 24 h and 48 h following injection with PBS (white bars), E. coli LPS (black bars) or Brucella CβG (gray bars) (see Fig. 3) and neutrophils were quantified by flow cytometry. Mean ± SD of 3 independent experiments is represented here, Mann-Whitney test, one-tailed (analysis on GraphPad Prism) has been done and P < 0.05 is denoted by “*."(B) Dot-plots of neutrophil recruitment to the ear at 12 h post-injection with PBS, E. coli LPS or CβG. Cells were gated on CD45⁺, MHC II⁻, CD11b⁺, Ly6C⁺. Neutrophils represented in blue population are negative for F4/80 and positive for Ly6G. (C) Dot-plots of neutrophil recruitment to the ear at 24 h post-injection with PBS, E. coli LPS or CβG. Cells were gated on CD45⁺, MHC II⁻, CD11b⁺ and Ly6C⁺. Neutrophils (in blue) are negative for F4/80 and positive for Ly6G. Three independent experiments were carried out, and one representative is shown here.

Table 2. Sequence of the qPCR primers used

Name	Sens	Sequence
HPRT Forward	5′-3′	AGCCCTCTGTGTGCTCAAGG
HPRT Reverse	5′-3′	CTGATAAAATCTACAGTCATAGGAATGGA
Ptgs2 Forward	5′-3′	ACCTCTGCGATGCTCTTCC
Ptgs2 Reverse	5′-3′	TCATACATTCCCCACGGTTT
SOCS3 Forward	5′-3′	CCTTCAGCTCCAAAAGCGAGTAC
SOCS3 Reverse	5′-3′	GCTCTCCTGCAGCTTGCG
CXCL2 Forward	5′-3′	GCGGTCAAAAAGTTTGCCTTG
CXCL2 Reverse	5′-3′	CTCCTCCTTTCCAGGTCAGTT
KC Forward	5′-3′	CAGCCACCCGCTCGCTTCTC
KC Reverse	5′-3′	TCAAGGCAAGCCTCGCGACCAT
tnfaip6 Forward	5′-3′	TTCCATGTCTGTGCTGCTGGATGG
tnfaip6 Reverse	5′-3′	AGCCTGGATCATGTTCAAGGTCAAA