Role of luxS in Bacillus anthracis growth and virulence factor expression

Figures & data

Figure 1 Induction of bioluminescence in V. harveyi reporter strain by CFM from B. anthracis cells. V. harveyi strain BB170 only upregulates the expression of the lux operon [measured as relative light units (RLU)], when AI-2 or AI-2-like molecules are present in its milieu. Cell free medium (CFM) obtained from AI-2-synthesizing bacteria can induce expression of the bioluminescence-generating luxCDABE operon in BB170. (A) In the experiments shown, CFM from 5-h cultures of B. anthracis strains 34F₂ and 34F₂ΔluxS and sterile CFM alone were used as positive and negative controls. The baseline is the value when uninoculated (sterile) CFM alone at 5 h were used. Each bar represents the mean (±SD) of triplicate experiments. Compared to the negative and positive controls, 34F₂ΔluxS:comp showed restored AI-2 activity compared to wild-type 34F₂. (B) In the experiment shown, CFM from 5-h cultures of wild-type 34F₂ and 34F₂ΔluxS:comp were serially diluted 1:1, 1:10 and 1:100. Each bar represents the mean (±SD) of triplicate experiments.

Figure 2 Growth rate analysis of B. anthracis 34F₂ΔluxS:comp. B. anthracis strains 34F₂, 34F₂ΔluxS, and 34F₂ΔluxS:comp were grown overnight and diluted in sterile BHI media to an optical density (OD₆₀₀) of ≈0.01. Cell growth was monitored, CFM removed and passed through a 0.2 µm filter for use in the V. harveyi bioassay. The graph represents the mean (±SD) of triplicate experiments performed on the same day. Solid line with filled diamonds represent strain 34F₂, dotted line with filled squares represent strain 34F₂ΔluxS and short dash line with filled triangles represents strain 34F₂ΔluxS:comp.

Figure 3 Analysis of pXO1 pathogenicity island gene expression in B. anthracis strain 34F₂ΔluxS compared to strain 34F₂ using Linear Expression Map (LEM) viewer. Time points are indicated at the top of each column. Arrows indicate the direction of gene orientation. The color scale indicates the log₂ changes in expression, according to the scale shown above. Locus ID based on B. anthracis Florida strain A2012. ^aGenes bolded relate to production or regulation of toxins. ^bRed asterisk indicates virulence genes.

Figure 4 Analysis of respiratory nitrate genes in strain 34F₂ΔluxS compared to strain 34F₂ and strain 34F₂ exposed to 20 µg/ml of fur-2 using LEM. Time points (left-most 4 columns) and sample (exposure to fur-2 for one hour; right-most column) are indicated at the top of each column. Arrows indicate the direction of gene orientation. The color scale indicates the log₂ changes in expression, according to the scale shown above. Locus ID based on B. anthracis strain Ames.

Figure 5 Analysis of small non-coding RNA of strain 34F₂ΔluxS compared to strain 34F₂ using an Affymetrix tiled array. A select region (between BXA0122 and BXA0124) based on pXO1 from B. anthracis strain A2012, demonstrating transcriptional activity in intergenic regions. Red indicates the transcriptional activity of the parental strain and blue represents strain 34F₂ΔluxS.

Table 1 Oligonucleotide primers used in this study

Primer designation	Nucleotide sequence (5′ → 3′)a
P1F	TTTGAACGTGCGATGAAAG
P2R	GATTGTGGAACTGATGTAACAG
P3F	GCGGATCCATTGAAGAAACTGCTGAAGCTC
P4R	GCGGATCCAGGAATAGATGTATATCAGAAC
P5F	CGTTAAAGCCTGATGTAAGCA
P6R	GGTTACGTGGTTGCTTAC
P9F	GCGGATCCTTAAAGTATTATAGCACGACTG
P10R	GCTCTACAATATCCAGTGTCGAAACGTC
P11F	GCGGTACCTTTGAACGTGCGATGAAAG
P12R	GCGGTACCGATTGTGGAACTGATGTAACAG
BAluxSF	ATGCATCAGTAGAAAGCTTTG
BAluxSR	TTATCCAAATACTTTCTCAAGTTC

a Restriction sites underlined; BamHI (GGATCC) and KpnI (GGTACC).

Table 2 B. anthracis chromosomal genes upregulated in the 34F₂ΔluxS strain as determined by microarray analysis, sorted by locus

Locusc	Gene Nameb	30 mina	60 min	90 min	120 min
BA0194	oligopeptide ABC transporter, oligopeptide-binding protein	1.42	5.03	4.44	7.67
BA0369	methyl-accepting chemotaxis protein	6.15	11.47	6.68	6.28
BA0558	methyl-accepting chemotaxis protein	12.47	11.47	11.00	9.85
BA0575	methyl-accepting chemotaxis protein	4.86	7.16	6.45	8.51
BA0677	phospholipase C (plc)	4.14	7.06	5.28	6.54
BA0682	hypothetical protein	3.46	5.70	7.06	6.36
BA0796	conserved hypothetical protein	2.20	5.39	6.82	16.56
BA2025	hypothetical protein	9.32	14.22	10.85	12.73
BA2114	RNA polymerase sigma-70 factor, ECF subfamily	1.17	3.61	6.82	12.21
BA2115	hypothetical protein	1.68	3.48	7.84	9.99
BA2363	transcriptional regulator, ArsR family	3.78	11.63	12.38	7.67
BA2606	hypothetical protein	7.52	11.63	7.94	6.41
BA2732	RNA polymerase sigma factor SigX, putative	1.35	2.77	15.67	64.00
BA3029	succinylornithine transaminase, putative	1.23	4.89	7.41	7.78
BA3034	hypothetical protein	1.55	5.06	4.23	8.22
BA3114	membrane protein, putative	13.45	10.78	7.36	11.24
BA3305	transcriptional regulator, ArsR family	3.76	7.67	5.06	10.34
BA3405	ABC transporter, permease protein	1.28	1.83	8.57	11.63
BA3406	ABC transporter, ATP-binding protein	0.71	2.46	6.77	18.13
BA3407	hypothetical protein	1.08	2.22	7.11	8.28
BA4264	nitroreductase family protein	1.52	2.81	3.97	7.16
BA5481	conserved domain protein	7.31	14.03	4.89	7.26
BA5628	iron compound ABC transporter	1.85	4.11	3.76	7.01

a Numbers represent fold change over the 120 min time course of the experiments;

b Functional annotations were obtained from the B. anthracis complete genome sequence (www.jcvi.org);

c Locus based on Ames strain of B. anthracis.

Table 3 B. anthracis chromosomal genes downregulated in the 34F₂ΔluxS strain as determined by microarray analysis, sorted by locus

Locusc	Gene nameb	30 mina	60 min	90 min	120 min
BA0238	hypothetical protein	−3.41	−29.65	−5.78	−15.78
BA0239	hypothetical protein	−3.86	−22.16	−5.86	−19.29
BA0240	4-hydroxyphenylpyruvate dioxygenase (hppD)	NaN	−11.63	−9.51	−6.41
BA0509	formate acetyltransferase (pfl)	−33.13	−125.37	−56.89	−35.51
BA0510	pyruvate formate-lyase-activating enzyme (pflA)	−1.26	−23.26	−36.00	−21.71
BA0668	ribose ABC transporter, permease protein (rbsC)	−1.42	−14.42	−12.91	−7.94
BA0669	ribose ABC transporter, ribose-binding protein (rbsB)	−1.58	−15.89	−11.88	−6.96
BA0887	S-layer protein EA1 (eag)	−7.26	−25.63	−46.85	−3.97
BA1086	sugar-binding transcriptional regulator, LacI family	−3.14	−19.29	−11.08	−4.20
BA2125	respiratory nitrate reductase, alpha subunit (narG)	−6.68	−4.20	−52.71	−42.22
BA2126	respiratory nitrate reductase, beta subunit (narH)	−1.13	−3.18	−29.24	−17.39
BA2128	respiratory nitrate reductase, gamma subunit (narI)	−1.25	−3.12	−38.59	−18.13
BA2133	molybdenum cofactor biosynthesis protein A (narA-1)	−1.84	−6.36	−45.25	−14.83
BA2134	molybdopterin biosynthesis protein MoeB, putative	−1.07	−5.06	−103.97	−13.55
BA2135	molybdopterin biosynthesis protein MoeA (moeA-1)	−1.12	−2.19	−35.26	−13.64
BA2136	molybdopterin converting factor, subunit 2 (moaE-1)	−1.13	−2.95	−48.84	−20.53
BA2137	molybdopterin converting factor, subunit 1 (moaD-1)	−1.36	−1.91	−22.78	−29.86
BA2138	nitrate transporter (narK)	−1.24	−1.92	−37.53	−21.11
BA2146	nitrite reductase [NAD(P)H], large subunit (nirB)	−1.33	−76.11	−60.97	−210.84
BA2267	alcohol dehydrogenase, zinc-containing	−3.61	−12.91	−6.45	−9.19
BA2295	acetate CoA-transferase, subunit A (atoD)	−1.01	NaN	−8.11	−22.16
BA2350	carboxyvinyl-carboxyphosphonate phosphorylmutase (yqiQ)	−1.52	−5.24	−12.13	−19.16
BA2547	acyl-CoA dehydrogenase	−2.01	−13.36	−19.70	−10.48
BA2548	acetyl-CoA carboxylase, biotin carboxylase, putative	−1.66	−7.06	−17.27	−9.99
BA2552	carboxyl transferase domain protein	−1.24	−16.45	−11.39	−10.27
BA3479	transcriptional regulator, ArsR family	−36.00	−44.94	−37.27	−136.24
BA3481	hypothetical protein	−38.85	−315.17	−137.19	−69.55
BA3482	conserved hypothetical protein	−32.67	−36.00	−64.45	−140.07
BA3483	conserved hypothetical protein	−30.48	−67.18	−53.82	−219.79
BA3663	anaerobic ribonucleoside-triphosphate reductase	NaN	−14.03	−4.66	−9.92
BA5047	autoinducer-2 production protein LuxS (luxS)	−14.72	−28.84	−29.86	−494.56
BA5696	superoxide dismutase, Mn (sodA-2)	−1.77	−7.62	−14.62	−7.11

a Numbers represent fold change over the 120 min time course of the experiments;

b Functional annotations were obtained from the B. anthracis complete genome sequence (www.jcvi.org);

c Locus based on Ames strain of B. anthracis;

d NaN indicates a miss data point.

Table 4 Select genes downregulated on pXO1 in B. anthracis 34F₂ΔluxS as determined by microarray analysis, sorted by locus

Locusc	Gene nameb	30 mina	60 min	90 min	120 min
BXA0142	calmodulin-sensitive adenylate cyclase (cya)	1.03	−2.00	−3.46	−4.69
BXA0146	transcriptional activator AtxA (atxA)	−1.34	−1.16	−1.25	−1.83
BXA0164	protective antigen (pagA)	−1.02	−1.53	−7.21	−26.17
BXA0165	hypothetical protein	1.21	−1.74	−7.52	−20.97
BXA0166	transcriptional repressor PagR (pagR)	−1.13	−2.13	−6.11	−13.36
BXA0167	hypothetical protein	1.36	−1.39	−5.70	−10.27
BXA0168	hypothetical protein	−1.20	−1.13	−2.46	−2.62
BXA0169	hypothetical protein	−1.23	−1.20	−2.10	−2.89
BXA0170	hypothetical protein	−1.24	1.16	−1.71	−4.23
BXA0171	ribonuclease domain protein	−1.59	−1.49	−2.99	−7.62
BXA0172	lethal factor (lef)	−1.02	1.05	−2.71	−4.92

a Numbers represent fold change over the 120 min time course of the experiments; Bolded genes indicate genes involved in B. anthracis toxin production or its regulation;

b Functional annotations were obtained from the B. anthracis complete genome sequence (www.jcvi.org);

c Locus based on Ames strain of B. anthracis.

Table 5 Select virulence genes downregulated on pXO1 in 34F₂ΔluxS compared to 34F₂luxS:comp

Locusc	Gene nameb	120 mina
BXA0124	S-layer protein	−5.16
BXA0142	calmodulin-sensitive adenylate cyclase	−3.97
BXA0146	transcriptional activator AtxA	−2.9
BXA0164	protective antigen	−13.78
BXA0165	hypothetical protein	−16.83
BXA0166	transcriptional repressor PagR	−14.66
BXA0172	lethal factor	−4.32

a Numbers represent fold change over; Bolded genes indicate genes involved in B. anthracis toxin production or its regulation

b Functional annotations were obtained from the B. anthracis complete genome sequence (www.jcvi.org);

c Locus based on B. anthracis strain A2012.

Table 6 Select B. anthracis genes on pXO1 downregulated by fur-2

Locusc	Gene nameb	Symbol	120 mina
BXA0124	S-layer protein		−16.63
BXA0142	calmodulin-sensitive adenylate cyclase	cyaA	−1.41
BXA0146	transcriptional activator AtxA	atxA	−1.34
BXA0164	protective antigen	pagA	−13.48
BXA0166	transcriptional repressor PagR	pagR	−5.81
BXA0172	lethal factor	lef	−2.03

a Numbers represent fold change;

b Functional annotations were obtained from the B. anthracis complete genome sequence (www.jcvi.org);

c Locus based on B. anthracis strain A2012.