Circ_0007535 upregulates TGFBR1 to promote pulmonary fibrosis in TGF-β1-treated lung fibroblasts via sequestering miR-18a-5p

Abstract

Circular RNAs (circRNAs) are functional molecules in all kinds of fibrosis diseases. The current study was performed for the exploration of circ_0007535 in pulmonary fibrosis. RNA levels for circ_0007535, miR-18a-5p, and transforming growth factor-β receptor 1 (TGFBR1) were assayed via a reverse transcription-quantitative polymerase chain reaction. Cell growth was determined by cell counting kit-8 assay for viability and ethynyl-2’-deoxyuridine assay for proliferation. Cell invasion and migration were examined by transwell assay and scratch assay. Western blot was performed for the detection of different proteins. Enzyme-linked immunosorbent assay was used to assess inflammatory response. The interaction analysis was conducted using dual-luciferase reporter assay, RNA immunoprecipitation assay, and biotin-coupled pull-down assay. Circ_0007535 was significantly upregulated by TGF-β1 in HFL1 cells. TGF-β1-induced proliferation, motility, ECM accumulation, and inflammatory reaction in HFL1 cells were alleviated by circ_0007535 knockdown. Circ_0007535 exhibited interaction with miR-18a-5p, and miR-18a-5p inhibition reversed all influences of circ_0007535 downregulation in TGF-β1-treated HFL1 cells. Circ_0007535 acted as a miR-18a-5p sponge to regulate the expression of downstream target TGFBR1. MiR-18a-5p induced TGFBR1 level inhibition to attenuate TGF-β1-mediated cell injury in HFL1 cells. This study evidenced that circ_0007535 facilitated TGF-β1-induced pulmonary fibrosis by depending on the absorption of miR-18a-5p to upregulate TGFBR1.

Keywords:

• Circ_0007535
• pulmonary fibrosis
• miR-18a-5p
• TGFBR1

Introduction

Pulmonary fibrosis is the end stage of heterogeneous interstitial lung diseases, and its risk factors are numerous [1]. A recent study has indicated that pulmonary fibrosis patients secondary to coronavirus disease 2019 are increasing [2]. Pulmonary fibrosis is known by progressive and irreversible cicatrices in the lung exhibiting poor treatment and prognosis [3]. Molecular pathways have been manifested to participate in the pathogenesis of pulmonary fibrosis, and biological regulators may be used for clinical therapy [4]. To find effective biomarkers that can contribute to the management of pulmonary fibrosis.

Circular RNAs (circRNAs) are newly defined noncoding RNAs (ncRNAs) taking on covalent loops without 5′ caps and 3′ tails [5]. CircRNAs are associated with organ fibrosis and can act as monitoring factors or therapeutic targets for fibrosis [6]. Bai et al. identified that circRNA_0026344 promoted the aberrant cross-talk of epithelium-fibroblasts in smoking-related pulmonary fibrosis [7]. Li et al. found that circTADA2A attenuated the pathological progression of pulmonary fibrosis [8]. A review of circRNA demonstrated that circ_0007535 was upregulated in patients with pulmonary fibrosis [9], but its detailed function remains to be researched.

CircRNAs are known to function as endogenous sponges to miRNAs, then mediating transcriptional and post-transcriptional gene levels in disease progression [10]. CircRNA/miRNA/mRNA crosstalk has also been discovered in pulmonary fibrosis [11]. Zhang et al. evidenced that miR-18a-5p impeded the development of pulmonary fibrosis [12]. Transforming growth factor-β receptor 1 (TGFBR1) has been shown to aggravate pulmonary fibrosis, and TGFBR1 served as a target for miR-770-5p [13]. Circ_0007535 interaction with miR-18a-5p and TGFBR1 is still unknown.

During this study, circ_0007535 or TGFBR1 target relation with miR-18a-5p was investigated. The purposes of this research were to address how circ_0007535 exerted its regulatory function in pulmonary fibrosis.

Materials and methods

Clinical specimens

Lung tissues were acquired from 27 pulmonary fibrosis patients who underwent surgical resection at the General Hospital of Angang Group Corporation. Meanwhile, normal lung tissues (tumor-adjacent tissues) were obtained and used as controls. Prior to the procedure, none of the patients had received any therapy. The Ethics Committee of the General Hospital of Angang Group Corporation approved this research. Informed consent was written by all participants.

Cell culture and TGF-β1 stimulation

Human foetal lung fibroblast 1 (HFL1) cell line (BioVector NTCC Inc., Beijing, China) was used for research on pulmonary fibrosis. Cell incubation was performed with Dulbecco’s modified Eagle’s medium containing 1% streptomycin/penicillin and 10% foetal bovine serum, followed by subsequent cell culture in a 5% CO₂ incubator at 37 °C. The reagents were obtained from Gibco (Carlsbad, CA, USA). To establish in vitro model for pulmonary fibrosis, HFL1 cells were stimulated with TGF-β1 (10 ng/mL; Sigma, St. Louis, MO, USA).

Transient transfection

The expression changes of molecules was achieved by transient transfection via Lipofectamine™ 3000 (Invitrogen, Carlsbad, CA, USA). GenePharma (Shanghai, China) has provided various oligonucleotides: small interfering RNA against circ_0007535/negative control (si-circ_0007535/si-NC), mimic targeting miR-18a-5p/negative control (miR-18a-5p/miR-NC), an inhibitor targeting miR-18a-5p/negative control (anti-miR-18a-5p/anti-miR-NC). For overexpression of TGFBR1, pcDNA (GENESEED, Guangzhou, China) was cloned with TGFBR1 sequence to construct pcDNA-TGFBR1 (TGFBR1) vector.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) assay

Cells were lysed with TRIZOL Reagent (Beyotime, Shanghai, China), and total RNAs were performed with reverse transcription through BeyoRT™ III First Strand cDNA Synthesis Kit (Beyotime). BeyoFast™ SYBR Green qPCR Mix (Beyotime) was applied for the amplification reaction, and specific primers were displayed in Table 1. Ct values were collected, followed by level analysis using the 2^-ΔΔCt method [14]. Total RNAs were digested with RNase R (GENESEED), then circ_0007535 stability was assessed via RT-qPCR. In addition, the circular structure of circ_0007535 was validated by RT-qPCR after Random primers or Oligo (dT)₁₈ primers (combined with 3′ ploy end of linear RNAs) were used in reverse transfection. RNAs were isolated from the cytoplasm and nucleus via PARIS™ Kit (Invitrogen), then RT-qPCR was employed to analyse circ_0007535 localisation. U6 and glyceraldehyde-phosphate dehydrogenase (GAPDH) were selected as control genes.

Table 1. Primer sequences for RT-qPCR.

Name	Primer sequences (5’-3’)
hsa_circ_0007535	Forward	GTATCAGCAGGTGGCCTTTC
	Reverse	CTGCCCATTCCACTCCTCTA
TGFBR1	Forward	GCTTAGGGGTGTGGGTCTTC
	Reverse	AAGCCAAGTTTTCACCCCCA
miR-18a-5p	Forward	GTATGAGTAAGGTGCATCTAGTGCA
	Reverse	CTCAACTGGTGTCGTGGAG
GAPDH	Forward	AGAAGGCTGGGGCTCATTTG
	Reverse	AGGGGCCATCCACAGTCTTC
U6	Forward	GCTTCGGCAGCACATATACTAA
	Reverse	AACGCTTCACGAATTTGCGT

Cell viability assay

HFL1 cells were incubated with 10 μL/well Cell Counting Kit-8 (CCK-8) reagent (Beyotime). After 4 h, optical values at 450 nm were determined under a microplate reader followed by a calculation of cell viability (%).

Cell proliferation assay

The proliferation ability was examined via Ethynyl-2′-deoxyuridine (EdU) Detection Kit (Sigma). HFL1 cells were stained with EdU working solution and diamidino phenylindole (DAPI; Beyotime) according to the guidelines for users. Cell observation was carried out via a fluorescence microscope (Olympus, Tokyo, Japan), and EdU-positive cells (EdU + DAPI) were counted.

Cell invasion assay

Cell invasion was detected in transwell chambers (Corning Inc., Corning, NY, USA) with matrigel (Corning Inc.). The upper chamber was seeded with 1 × 10⁴ HFL1 cells, and the lower chamber was supplemented with 600 μL cell medium. After incubation of the chamber for 24 h, 0.1% crystal violet (Sigma) was used to stain invaded cells through the membranes. Through the inverted microscope (Olympus), cells were photographed at 100 × magnification and counted under 3 fields of view.

Cell migration assay

Cell migration was evaluated through scratch assay. The 12-well plates were inoculated with 2 × 10⁵/well, followed by cell culture overnight and generation of two straight scratches. After washing with phosphate buffer solution (PBS; Sigma), cells were incubated with serum-free medium for 24 h. Wound width was measured at 0 h and 24 h, then migration distance was expressed as the width at 0 h-width at 24 h.

Western blot

Radioimmunoprecipitation assay buffer and BCA Assay Kit (Beyotime) were purchased for protein extraction and concentration examination. Subsequently, protein blot analysis was performed as previously depicted [15,16]. The primary antibodies for E-cadherin (ab76319, 1:1000, Abcam, Cambridge, MA, USA), N-cadherin (ab76011, 1:1000, Abcam), α-SMA (SAB5500002, 1:1000, Sigma), Collagen I (ab138492, 1:1000, Abcam), Fibronectin (ab2413, 1:1000, Abcam), GAPDH (ab191602, 1:3000, Abcam), and HRP&IgG secondary antibody (ab205718, 1:5000, Abcam) were used in this study. Electrochemiluminescence (ECL) reagent (Beyotime) was employed for observation of black bands, then level analysis was carried out using Image J software (NIH, Bethesda, MD, USA).

Enzyme-linked immunosorbent assay (ELISA)

The supernatants of HFL1 cells were harvested for ELISA analysis. Interleukin-6 (IL-6) and interleukin-1beta (IL-1β) concentrations were measured through IL-6 Human ELISA Kit (Invitrogen) and IL-1 beta Human ELISA Kit (Invitrogen), respectively. The operating steps were following the manufacturer’s specification.

Flow cytometry

Cell apoptosis assay was carried out using a commercial Annexin V-FITC/PI Apoptosis kit (Bender Med System, Vienna, Austria). In short, HFL1 cells were trypsinized, washed, and re-suspend in a binding buffer. After being stained with Annexin V-FITC and PI for 15 min in the dark, the cell apoptotic rate was analysed using FACS CantoII flow cytometer (BD Biosciences, Heidelberg, Germany).

Dual-luciferase reporter assay

The pmirGLO (Promega, Madison, WI, USA) was applied for the construction of luciferase plasmids. Circ_0007535 sequence of wild-type (WT, with miR-18a-5p binding sites) or mutant-type (MUT, with mutated miR-18a-5p sites) was inserted into pmirGLO. The positive plasmids were named WT-circ_0007535 and MUT-circ_0007535. Additionally, WT-TGFBR1 3′UTR and MUT-TGFBR1 3’UTR were constructed. These reporters were co-transfected with miRNA mimic (miR-NC, miR-18a-5p) for 48 h, then luciferase intensity was assayed via Dual-Luciferase Reporter Kit (GeneCopoeia, Rockville, MA, USA).

RNA immunoprecipitation (RIP) assay

Circ_0007535 or TGFBR1 interaction with miR-18a-5p was analysed via Imprint® RNA Immunoprecipitation Kit (Sigma). Briefly, HFL1 cells were incubated with anti-Argonaute-2 (anti-Ago2) or anti-immunoglobulin G (anti-IgG)-coated Protein A magnetic beads at 4 °C overnight. Afterward, total RNAs were extracted for level detection of circ_0007535, miR-18a-5p, and TGFBR1.

RNA pull-down assay

Target analysis was further affirmed by pull-down assay with biotin-coupled miR-18a-5p mimic (bio-miR-18a-5p, GenePharma). Biotin-coupled miRNA mimic (bio-miR-NC) was used as the control group. Transfected cells were incubated with magnetic beads (Sigma) for 48 h, then circ_0007535 or TGFBR1 enrichment was assessed by RT-qPCR.

Statistical analysis

SPSS 22.0 (SPSS Inc., Chicago, IL, USA) was exploited for analysis of data (mean ± standard deviation) from three independent repetitions. Group difference was compared through Student’s t-test and analysis of variance followed by Tukey’s test. Statistically, p < 0.05 represented that difference was conspicuous.

Results

TGF-β1 induced upregulation of circ_0007535 in HFL1 cells

First of all, the expression of circ_0007535 in lung tissues was determined by RT-qPCR. As presented in Figure 1A, circ_0007535 mRNA was highly expressed in lung tissues of pulmonary fibrosis patients compared with the control group. HFL1 cells were exposed to 10 ng/mL TGF-β1. Relative to the control group, circ_0007535 was highly expressed in the TGF-β1 group after RT-qPCR detection (Figure 1B). Circ_0007535 was more stable than GAPDH after RNase R digestion in total RNA from HFL1 cells (Figure 1C). Then, we detected the existence of circ_0007535 in the reverse transcription products using random primers or Oligo (dT)₁₈ primers, and results suggested that circ_0007535 was almost undetectable when Oligo (dT)₁₈ primers were used, validating the circular structure of circ_0007535 without 3’end (Figure 1D). Cell localisation was analysed with U6 and GAPDH as nuclear and cytoplasmic controls. High level of circ_0007535 in the cytoplasm but not nucleus demonstrated that circ_0007535 was localised in the cytoplasm of HFL1 cells (Figure 1E). Circ_0007535 was upregulated in the TGF-β1-induced cell model of pulmonary fibrosis.

Figure 1. TGF-β1 induced upregulation of Circ_0007535 in HFL1 cells. (A) RT-qPCR analysis of circ_0007535 expression in lung tissues from 27 pulmonary fibrosis patients and 27 normal controls. (B) Circ_0007535 level was determined by RT-qPCR after HFL1 cells were treated with 10 ng/mL TGF-β1. (C,D) Circ_0007535 and GAPDH levels were analysed using RT-qPCR after total RNA was digested with RNase R (C) or reverse transcription by Oligo (dT)₁₈ primers/random primers (D). (E) RT-qPCR was used for expression analysis of circ_0007535, U6, and GAPDH after RNA isolation from cytoplasm and nucleus. ***p < 0.001, ****p < 0.0001, n = 3.

Circ_0007535 inhibition reversed TGF-β1-induced proliferation, motility, ECM accumulation and inflammation in HFL1 cells

TGF-β1-treated HFL1 cells were transfected with si-NC or si-circ_0007535. As RT-qPCR data in Figure 2A, circ_0007535 expression was significantly downregulated in the TGF-β1 + si-circ_0007535 group relative to TGF-β1 + si-NC group. In response to circ_0007535 downregulation, cell viability (Figure 2B) by CCK-8 assay and proliferation (Figure 2C,D) by EdU assay was reduced in TGF-β1-treated HFL1 cells. Cell motility detection showed that TGF-β1 promoted cell invasion (Figure 2E) and migration (Figure 2F), whereas these effects were relieved after the knockdown of circ_0007535. E-cadherin downregulation and N-cadherin upregulation caused by TGF-β1 were abated following transfection with si-circ_0007535, showing that circ_0007535 inhibited epithelial-mesenchymal transition (EMT) after TGF-β1 treatment (Figure 2G). Also, extracellular matrix (ECM) was detected via western blot. Silence of circ_0007535 counteracted TGF-β1-mediated protein overexpression of α-SMA, Collagen I, and Fibronectin (Figure 2H). By performing ELISA, IL-6, and IL-1β concentrations were suppressed by circ_0007535 level reduction in TGF-β1-disposed HFL1 cells (Figure 2I). In addition, our data verified that the downregulation of circ_0007535 might promote HFL1 cell apoptosis rate (Figure S1). These outcomes demonstrated that TGF-β1-induced proliferation, migration, and invasion was attenuated via circ_0007535 downregulation in HFL1 cells.

Figure 2. Circ_0007535 inhibition reversed TGF-β1-induced proliferation, motility, ECM accumulation, and inflammation in HFL1 cells. HFL1 cells were performed with the treatment of control, TGF-β1, TGF-β1 + si-NC, TGF-β1 + si-circ_0007535. (A) Expression detection for circ_0007535 was carried out by RT-qPCR. (B) Cell viability examination was conducted using CCK-8 assay. (C,D) The proliferation analysis was performed via EdU assay. (E-F) The assessment of invasion (E) and migration (F) was implemented through transwell assay and scratch assay. (G-H) EMT-associated markers (G) and ECM proteins (H) were measured by western blot. (I) Inflammation evaluation was administrated using ELISA. **p < 0.01, ***p < 0.001, ****p < 0.0001, n = 3.

Circ_0007535 was affirmed to interact with miR-18a-5p

The binding sites with miR-18a-5p were predicted in circ_0007535 sequence through starbase (http://starbase.sysu.edu.cn) (Figure 3A). Transfection of miR-18a-5p resulted in successful overexpression of miR-18a-5p in HFL1 cells, compared with miR-NC group (Figure 3B). After analysis of dual-luciferase reporter assay, there was an inhibitory regulation of luciferase activity by co-transfection with WT-circ_0007535 (not MUT-circ_0007535) and miR-18a-5p in HFL1 cells (Figure 3C). In addition, miR-18a-5p and circ_0007535 levels were much higher in Ago2 group than IgG group in RIP assay (Figure 3D). Also, bio-miR-18a-5p could pull down circ_0007535 in HFL1 cells (Figure 3E). RT-qPCR analysis suggested that miR-18a-5p was lower expressed in pulmonary fibrosis patients (Figure 3F) and was negatively correlated to circ_0007535 expression (Figure 3G) In addition, the expression of miR-18a-5p was downregulated in TGF-β1-treated HFL1 cells relative to control cells (Figure 3H). These results identified the interaction between miR-18a-5p and circ_0007535.

Figure 3. Circ_0007535 was affirmed to interact with miR-18a-5p. (A) The binding regions between circ_0007535 and miR-18a-5p in starbase. (B) The transfection efficiency of miR-18a-5p was assessed via RT-qPCR. (C–E) Target binding between circ_0007535 and miR-18a-5p was analysed via dual-luciferase reporter assay (C), RIP assay (D) and pull-down assay (E). (F) miR-18a-5p level was detected using RT-qPCR in lung tissues from 27 pulmonary fibrosis patients and 27 normal controls. (G) Pearson correlation analysis was applied to evaluate the expression association between circ_0007535 and miR-18a-5p in pulmonary fibrosis patients. (H) RT-qPCR was performed for miR-18a-5p quantification after TGF-β1 treatment in HFL1 cells. **p < 0.01, ****p < 0.0001, n = 3.

Circ_0007535/miR-18a-5p network affected biological behaviours in TGF-β1-treated HFL1 cells

RT-qPCR analysis indicated that anti-miR-18a-5p transfection eliminated si-circ_0007535-mediated expression upregulation of miR-18a-5p in TGF-β1-treated HFL1 cells, suggesting the effective transfection of anti-miR-18a-5p (Figure 4A). The reverse regulation of si-circ_0007535 for TGF-β1 in cell viability (Figure 4B), proliferation (Figure 4C,D), invasion (Figure 4E), migration (Figure 4F) or EMT process (Figure 4G) was offset with the expression inhibition of miR-18a-5p. Meanwhile, miR-18a-5p inhibitor counterbalanced si-circ_0007535-evoked ECM degradation (Figure 4H) and inflammation inhibition (Figure 4I) in TGF-β1-treated HFL1 cells. Thus, circ_0007535 function in the TGF-β1-induced cell model was related to the miR-18a-5p sponging role.

Figure 4. Circ_0007535/miR-18a-5p network affected biological behaviours in TGF-β1-treated HFL1 cells. Control, TGF-β1, TGF-β1 + si-NC, TGF-β1 + si-circ_0007535, TGF-β1 + si-circ_0007535 + anti-miR-NC, and TGF-β1 + si-circ_0007535 + anti-miR-18a-5p groups were designed in HFL1 cells. (A) The miR-18a-5p expression was examined using RT-qPCR. (B) Cell viability was tested via CCK-8 assay. (C,D) Cell proliferation was evaluated through EdU assay. (E-F) Cell invasion (E) and migration (F) were determined by transwell assay and scratch assay. (G,H) Western blot was used for EMT (G) and ECM (H) associated protein detection. (I) Inflammatory cytokines were detected by ELISA. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n = 3.

Circ_0007535 induced TGFBR1 upregulation by targeting miR-18a-5p

Starbase showed that there was one binding region between TGFBR1 3’UTR and miR-18a-5p sequences (Figure 5A). The upregulation of miR-18a-5p resulted in luciferase activity reduction of WT-TGFBR1 3’UTR group, but no significant difference was observed in MUT-TGFBR1 3’UTR group (Figure 5B). Then, miR-18a-5p and TGFBR1 interaction was verified by RIP assay (Figure 5C) and biotin-coupled pull-down assay (Figure 5D) in HFL1 cells. Furthermore, RT-qPCR results displayed that TGFBR1 expression was obviously enhanced in pulmonary fibrosis patients (Figure 5E) and negatively correlated with miR-18a-5p level (Figure 5F). TGFBR1 protein expression was increased by TGF-β1 treatment in HFL1 cells (Figure 5G). The efficiency of anti-miR-18a-5p transfection was excellent contrasted with the anti-miR-NC group (Figure 5H). Transfection with miR-18a-5p downregulated the protein level of TGFBR1, while anti-miR-18a-5p induced TGFBR1 protein upregulation in TGF-β1-treated cells (Figure 5I). Moreover, si-circ_0007535-mediated protein inhibition for TGFBR1 was alleviated by miR-18a-5p inhibitor (Figure 5G). Taken together, TGFBR1 was positively regulated by the circ_0007535/miR-18a-5p axis.

Figure 5. Circ_0007535 induced TGFBR1 upregulation by targeting miR-18a-5p. (A) Starbase was used for binding prediction between miR-18a-5p and TGFBR1. (B-D) Dual-luciferase reporter assay (B), RIP assay (C) and pull-down assay (D) were applied to confirm miR-18a-5p interaction with TGFBR1. (E) TGFBR1 level was measured in lung tissues from 27 pulmonary fibrosis patients and 27 normal controls via using RT-qPCR. (F) The expression correlation between miR-18a-5p and TGFBR1 in pulmonary fibrosis patients was analysed by Pearson correlation analysis. (G) Western blot was performed for protein analysis of TGFBR1 in TGF-β1-treated HFL1 cells. (H) RT-qPCR was used to determine miR-18a-5p level after anti-miR-NC or anti-miR-18a-5p transfection. (I) TGFBR1 protein level was examined by western blot after miR-18a-5p, anti-miR-18a-5p or control transfection. (J) TGFBR1 protein determination was performed via western blot after TGF-β1-treated HFL1 cells were transfected with si-circ_0007535, si-circ_0007535 + anti-miR-18a-5p or relative control groups. ***p < 0.001, ****p < 0.0001, n = 3.

Overexpression of miR-18a-5p relieved TGF-β1-evoked regulation in HFL1 cells via downregulating TGFBR1

After treatment of TGF-β1, HFL1 cells were transfected with miR-18a-5p, miR-18a-5p + TGFBR1 or corresponding controls. Western blot analysis exhibited that TGFBR1 protein level was upregulated in the TGF-β1 + miR-18a-5p + TGFBR1 group by comparison with the TGF-β1 + miR-18a-5p + pcDNA group (Figure 6A). TGF-β1-mediated promotion of cell viability (Figure 6B), proliferation (Figure 6C,D), invasion/migration (Figure 6E,F) or EMT process (Figure 6G) was countervailed by miR-18a-5p via downregulating TGFBR1 expression. The results of western blot and ELISA demonstrated that miR-18a-5p overexpression reversed ECM accumulation (Figure 6H) and inflammatory reaction (Figure 6I) by TGF-β1, while these effects were removed after TGFBR1 upregulation. All in all, miR-18a-5p downregulated TGFBR1 to inhibit TGF-β1-induced pulmonary fibrosis.

Figure 6. Overexpression of miR-18a-5p relieved TGF-β1-evoked regulation in HFL1 cells via downregulating TGFBR1. HFL1 cells were treated with control, TGF-β1, TGF-β1 + miR-NC, TGF-β1 + miR-18a-5p, TGF-β1 + miR-18a-5p + pcDNA, and TGF-β1+ miR-18a-5p + TGFBR1. (A) Western blot was used to measure TGBR1 protein expression. (B) CCK-8 assay was performed to determine cell viability. (C,D) EdU assay was applied to analyse cell proliferation. (E,F) Transwell assay and scratch assay were performed for the assessment of cell invasion (E) and migration (F). (G,H) the protein detection related to EMT (G) and ECM (H) was carried out using a western blot. (I) ELISA was employed to assess inflammatory response. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, n = 3.

Discussion

High expression of circ_0007535 has been reported in pulmonary fibrosis [9]. Herein, we also affirmed the aberrant level of circ_0007535 in the TGF-β1-induced cell model. More importantly, circ_0007535 contributed to the progression of pulmonary fibrosis by interacting with the miR-18a-5p/TGFBR1 axis.

CircRNAs have played pivotal roles in the pathological processes of fibrosis diseases [17]. For example, circRNA_010567 accelerated myocardial fibrosis in vitro model via inhibiting miR-141 by inducing upregulation of TGF-β1 [18]. CircPVT1 downregulation relieved hypoxia-stimulated bladder fibrosis through upregulating SOSC3 via absorbing miR-203 [19]. CircRNA_30032 induced renal fibrosis in mice model via acting on miRNA-96-5p/HBEGF axis [20]. CircFBXW4 repressed hepatic fibrosis through miR-18b-3p-related overexpression of FBXW7 [21]. In the current research, TGF-β1-induced promoting effects on lung fibroblasts (including cell viability, proliferation, invasion, migration, and ECM protein levels, inflammation) were all reversed after the silence of circ_0007535. Altogether, circ_0007535 overexpression could contribute to cell development in pulmonary fibrosis.

CircRNA with miRNA sponging function has been discovered in various kinds of human diseases [22]. Ge et al. stated that circ_0000064 enhanced mesangial cell proliferation and fibrosis in diabetic nephropathy via sequestering miR-143 [22]. Liu et al. proved that circ-PWWP2A facilitated hepatic fibrosis activation and proliferation by functioning as a sponge for miR-203 or miR-223 [23]. CircRSF1 induced inflammatory response and fibrotic phenotypes by controlling miR-146a-5p in hepatic stellate cells [24]. The target relation of circ_0007535/miR-18a-5p was discovered in this study. MiR-18a-5p inhibition ameliorated inhibiting regulation of circ_0007535 knockdown in the pulmonary fibrosis cell model, suggesting that circ_0007535 promoted pulmonary fibrosis progression via sponging miR-18a-5p.

Wang et al. discovered that miR-166-5p downregulated GSK-3β to suppress cell metastasis in pulmonary fibrosis induced by radiation [25]. Wu et al. demonstrated that miR-138 reduced the progression of silica-induced pulmonary fibrosis via inhibiting ZEB2 [26]. Our further analysis manifested that TGFBR1 worked as a target for miR-18a-5p. Additionally, miR-18a-5p attenuated cell behaviours in TGF-β1-treated lung fibroblasts by downregulating the TGFBR1 level. Moreover, TGFBR1 was upregulated by circ_0007535 via reducing miR-18a-5p. Circ_406961 interacted with miR-21 to upregulate Smad7, thus involving the progression of pulmonary fibrosis [7]. CircCDR1as targeted miR-1/TGFBR2 to regulate the development of pulmonary fibrosis [27]. Our evidence showed that circ_0007535 contributed to pulmonary fibrosis by mediating the miR-18a-5p/TGFBR1 network.

Conclusion

In conclusion, circ_0007535/miR-18a-5p/TGFBR1 axis was associated with the progression of pulmonary fibrosis in the TGF-β1-induced cell model. Circ_0007535 might be applied as a biological molecule for pulmonary fibrosis.

Disclosure statement

The authors declare that they have no conflicts of interest.