TNF-α stimulated exosome derived from fibroblast-like synoviocytes isolated from rheumatoid arthritis patients promotes HUVEC migration, invasion and angiogenesis by targeting the miR-200a-3p/KLF6/VEGFA axis

Abstract

The pathogenesis of rheumatoid arthritis (RA) is heavily impacted by the inflammation and activation of fibroblast-like synoviocytes (FLS). The objective of this investigation is to clarify the involvement of exosomes derived from FLS stimulated by tumour necrosis factor α (TNF-α) in angiogenesis and the underlying mechanisms. FLS cells were obtained from synovial fluid of RA patients and exosomes were obtained from FLS cell supernatant with TNF-α stimulation by ultracentrifugation. Exosomes were subsequently analysed using transmission electron microscopy, nanoparticle tracking analysis, and western blotting. The functional effects of exosomes with TNF-α stimulation on human umbilical vein endothelial cells (HUVEC) migration, invasion, and angiogenesis was evaluated using wound scratch healing test, transwell invasion assay, and tube formation assay. DNA nanoball-seq (DNBSEQ) sequencing platform was utilised to analysis different expression miRNA from exosomes, miRNA and mRNA from HUVEC. The expression level of miR-200a-3p was determined through quantitative real-time polymerase chain reaction (qRT-PCR). The quantification of KLF6 and VEGFA expression levels were performed by qRT-PCR and western blot analysis. The validation of the association between miR-200a-3p and KLF6 was established through a fluorescence enzyme reporting assay. In comparison to exosome induced by PBS, exosome induced by TNF-α exhibited a substantial exacerbation of invasion, migration, and angiogenesis in HUVEC. 4 miRNAs in exosomes and HUVEC cells, namely miR-1246, miR-200a-3p, miR-30a-3p, and miR-99b-3p was obtained. MiR-200a-3p maintained high consistency with the sequencing results. We obtained 5 gene symbols, and KLF6 was chose for further investigation. The expression of miR-200a-3p in exosomes induced by TNF-α and in HUVEC treated with these exosomes demonstrated a significantly increase. Additionally, HUVEC cells displayed a notable decrease in KLF6 expression and a significant elevation in VEGFA expression. This was further confirmed by the fluorescence enzyme report assay, which provided evidence of the direct targeting of KLF6 by miR-200a-3p. Exosomes induced by TNF-α have the ability to enhance the migration, invasion, and angiogenesis of HUVEC cells via the miR-200a-3p/KLF6/VEGFA axis.

Keywords:

• TNF-α
• exosomes
• angiogenesis
• miR-200a-3p
• KLF6

Introduction

Rheumatoid arthritis (RA) is a chronic, systemic, and autoimmune disease characterised by symmetrical joint inflammation and pain, leading to joint impairment and decreased work capacity [1]. Pannus, a common pathological manifestation of rheumatoid arthritis-affected joints, consists of newly formed microvessels, hypertrophic synovial cells, inflammatory cells, and cellulose. The tumour-like characteristics of pannus contribute to the localised destruction of cartilage and bone in the joints. Neovascularization plays a critical role in the development and persistence of pannus in RA. According to current, the formation of new blood vessels may be associated with local inflammation and increased oxygen demands, although the exact mechanism is not yet fully understood [2].

Extracellular vesicles, which vary in size from nanometres to micrometres, are actively released by cells and possess a phospholipid bilayer structure. These vesicles plays a vital role in intercellular communication, as they contain RNA, lipids, proteins, and DNA that can significantly influence the characteristics of recipient cells. Exosomes, with a size range of approximately 100-150nm, are generated through the fusion of multivesicular bodies (MVBs) and the plasma membrane [3]. Extensive research conducted over the past decade has provided substantial evidence regarding the significant role of exosomes, specifically those originating from fibroblast-like synoviocytes (FLS), in the pathogenesis of rheumatoid arthritis [4–6]. The abnormal behaviour of fibroblast-like synoviocytes plays a crucial role in the progression of RA. Moreover, exosomes derived from these cells have been demostrated to induce the degradation of joint cartilage and bone via various LncRNAs and miRNAs [7–9].

MicroRNA, a type of non-coding single-stranded RNA molecules consisting of approximately 22 nucleotides, is encoded by endogenous genes and serves as a crucial component in regulating post-transcriptional gene expression and contributing to epigenetics. MiR-200a-3p holds significance in numerous biological processes such as proliferation, apoptosis, inflammation and angiogenesis [10–14]. However, there is currently a lack of comprehensive research on the involvement of miR-200-3p in RA.

During the pathological progression of rheumatoid arthritis, the process of synovial inflammation and excessive proliferation plays a crucial role in promoting angiogenesis, which in turn leads to the development of synovial pannus and exacerbation of synovial inflammation, thus establishing a detrimental cycle [10]. FLSs are integral constituents of proliferative synovium, while proangiogenic factors are predominantly generated by macrophages and fibroblasts within RA synovial tissue. The lining layer of RA synovial tissue plays a crucial role in sustaining synovitis via neovascularization. Recent research has demonstrated a strong association between RA FLSs and synovial angiogenesis [15]. However, the specific role and mechanism by which exosomes derived from FLS contributed to angiogenesis are not yet fully understood. Therefore, the objective of this study is to provide a comprehensive understanding of the involvement of FLS-derived exosomes stimulated by TNF-α in angiogenesis and to elucidate the underlying mechanisms.

Materials and methods

Cell culture and treatment

FLS were obtained from synovial tissue of RA patients and identification according to previous study [9,16]. This study was ethically approved by the Ethics Committee of The First Hospital of Jiaxing (Approve number: LS2020-073). Cells were resuscitated using DMEM supplemented with 10% FBS. The cells were incubated at a temperature of 37 °C and 5% CO₂ until the convergence rate reached approximately 90%. Subsequently, the cells were treated with pancreatic enzymes and transferred to a 6-well plate at a density of 5 × 10⁵ cells/ml. Once the cells reached a confluence of 60-70%, they were transferred to a 10 cm dish and cultured in DMEM medium supplemented with 10% exosome-depleted FBS (System Biosciences, EXO-FBS-50A-1). TNF-α (PeproTech, 300-01 A) was added at a concentration of 20 ng/ml or PBS for 48 h to induce the cells, and the supernatant of the cell culture was collected.

Human umbilical vein endothelial cells (HUVEC) were obtained from the Chinese Academy of Sciences Shanghai Cell Bank (Shanghai, China), resuscitated, cultivated, and propageted using H-DMEM supplemented with 10% exosome-depleted FBS. Following this, the exosomes originating from FLS were co-cultivated with the HUVEC cells for 48 h. Simultaneously, a control group was established.

Exosome isolation

FLS cells (2 × 10⁷/disc) culture supernatant underwent filtration using a microporous filter membrane with a pore size of 0.22 μm, followed by concentration using an Amicon Ultra-15 ultrafiltration tube (Millipore, UFC901096). The resulting solution was then subjected to overspeed centrifugation at 120,000 g for 2h, at 4 °C, leading to the removal of the supernatant. The resulting pellet was subsequently resuspended in 10 ml of pre-cooled PBS and subjected to ultracentrifugation again at 120,000 g for 2h at 4 °C). The supernatant was once again discarded, and the resulting pellet was resuspended in 200 μl of PBS.

RNA sequencing

The total RNA content was extracted from the experiment following the manufacturer’s protocol, utilising the Trizol reagent kit (TaKaRa, Dalian, China). The purity and quantity of RNA from each sample were assessed using Agilent 2100 and NanoDrop instruments. Subsequently, the total RNA underwent mRNA enrichment through the utilisation of polyA tail connected magnetic beads and Oligo (dT). Double stranded DNA synthesis was then performed, followed by PCR amplification of the resulting products using specific primers. The PCR product derived from the preceding step is subjected to thermal denaturation, resulting in the formation of single stranded DNA. Subsequently, the single stranded DNA is cyclized into a circular DNA library through the utilisation of bridge primers. To construct a miRNA library, a length distribution of about 20 nt bands were selected strip and recycle, which also contained non coding RNAs such as rRNA, siRNA, tRNA, etc. Sequencing was conducted employing the DNBSEQ platform (BGI Genomics Co., Ltd. Shenzhen, China).

Enzyme linked immunosorbent assay (ELISA)

The Human IL-6 ELISA kit (Abcam, ab178013) was employed to analyse the cell culture supernatant in accordance with the instructions provided in the user manual.

Exosome characteristics

The exosome samples were diluted with 1× PBS buffer and subsequently subjected to analysis of their particle size characteristics using a nanoparticle tracker.

To precipitate the exosome, the samples were dripped onto a copper mesh for a duration of 1 min, followed by the removal the floating liquid using filter paper. Similarly, uranium acetate drops were allowed to precipitate on a copper mesh for 1 min, and the floating liquid was eliminated using filter paper. After air- drying at room temperature for a brief period, transmission electron microscopy imaging was utilised at 100 kV to obtain the desired results.

An equivalent volume of RIPA buffer was added to the exosomes and incubated on ice for a duration of 10 min. Subsequently, centrifugation was conducted at 12000 g for 5 min at a temperature of 4 °C, and the resulting supernatant was collected. The concentration of exosome proteins was determined using the BCA method.

Western blot

Exosomal protein samples of 50 μg or HUVEC protein samples of 60 μg were subjected to electrophoresis using a 10% SDS-PAGE gel. The proteins were subsequently transferred onto PVDF membranes at a constant voltage of 100 V. Following this, the membranes were blocked with 5% skim milk powder at room temperature for 1 h. Primary antibodies, including mouse anti-CD63 (1:500, Santa Cruz, SC-5275), mouse anti-CD9 (1:500, Santa Cruz, SC-13118), mouse anti-TSG101 (1:500, Santa Cruz, SC-7964), rabbit anti-KLF6 (1:1000, Thermo Fisher, PA5-104348), rabbit anti-VEGFA (1: 1000, Abcam, ab214424), and mouse anti-β-actin (1:10000, Abcam, ab68477), were added separately and incubated overnight at 4 °C. Subsequently, goat anti-mouse IgG H&L (HRP) (1: 5000, Thermo Fisher, 31160) or goat anti-rabbit IgG H&L (HRP) (1: 5000, Thermo Fisher, 31210) secondary antibodies were employed. Bands were visualised with SuperSignal West Dura Extended Duration Substrate (Thermo Fisher, 34075), subsequently by exposure to X-film in a darkroom for development.

Transwell invasion assay

The Matrix Invasion Chamber 24 Well (Corning, 354480) was equilibrated to room temperature and subsequently filled with 500 μl of serum-free culture medium. The chamber was then incubated at 37 °C for 2 h to facilitate the hydration of the basement membrane. Any excess liquid was absorbed, and the chamber was set aside. HUVEC cells were resuspended in serum-free culture medium and their concentration was adjusted to 2 × 10⁵/ml. A volume of 200 μl of the cell suspension was introduced into the upper chamber, while 600 μl of cell culture medium containing 15% exosome-depleted FBS was added to the lower chamber. The cells were then incubated in a 37 °C and 5% CO₂ incubator for 12 h. Following this, they were fixed with 4% paraformaldehyde for 30 min. Subsequently, the cells were stained with 0.1% Crystal violet for 30 min, cleaned with PBS, and photographed using an inverted microscope for the purpose of counting. Each group was allocated three multiple wells, and for each well, five fields of view were randomly selected at a magnification of 200. This was done to ascertain the average number of invading cells.

Scratch assay

The density of HUVECs was adjusted to 5 × 10⁵ cells/ml, and then 70 μl of cell suspension was added to each chamber. The cells were cultured until they reached full growth in the small chamber, and any non-adherent cells were washed with PBS. Following this, 1 ml of complete culture medium containing 1% exosome-depleted FBS was added to each well, and exosomes were introduced at a final concentration of 200 μg/ml. The cells were cultured in a chamber, and their migration was observed using an inverted microscope at 0 and 7 h. The Image J software was employed to quantify the dimensions of the scratches, including area, height, and width, as well as to calculate the migration ratio of the scratches based on their width. The scratch migration rate was determined using the formula (0 h scratch width − 7 h scratch width)/0h scratch width × 100%, and each sample was replicated three times.

Angiogenesis assay

The experiment on angiogenesis was conducted using a 15-well µ-Slide Angiogenesis (Ibidi GmbH, 81506). Matrigel® Growth Factor Reduced (Corning Biocoat, 356231) was added to each well at a volume of 10 µl and subsequently incubated at 37 °C for 1 h to facilitate solidification. The HUVEC cells were treated with exosomes and adjusted to a density of 2 × 10⁵ cells/ml. Subsequently, 50 µl of the cell suspension was added to each well, with 3 parallel samples established for each group. The samples were incubated at 37 °C in a 5% CO₂ incubator for 12 h, and images were captured using an inverted optical microscope. The ACAS Image Analysis System (Ibidi GmbH) was utilised to analyse the images, and the formation ability was assessed by quantifying Total Tube Length, Total Branching Points, and Total Loops.

Quantitative real-time polymerase chain reaction (qRT-PCR)

The PureLink miRNA Isolation Kit (Thermo Fisher, K1570-01) was utilised to extract micro RNAs from exosomes and HUVEC. The SuperScriptTM III Reverse Transcriptase (Thermo Fisher, 18080085) was employed for reverse transcription of the miRNAs, utilising the miR-200a-3p stem-loop primer (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACATCG). Additionally, the TRIzol® Plus RNA Purification Kit (Thermo Fisher, 12183-555) was used to extract mRNAs from HUVEC, followed by reverse transcription with the SuperScriptTM III First-Strand Synthesis SuperMix (Thermo Fisher, 11752-050). The detection of miR-200a-3p, KLF6 mRNA, and VEGFA mRNA was accomplished using Power SYBR® Green PCR Master Mix (Applied Biosystems, 4367659) and the following primers: miR-200a-3p (miR-200a-3p, forward: 5′-GCGCGTAACACTGTCTGGTAA-3′), KLF6 (KLF6, forward: 5′-CAGGCACTTCCGAAAGCAC-3′, reverse: 5′-CAGAGGTGCCTCTTCATGTG-3′), and VEGFA (VEGFA, forward: 5′-GGAGGGCAGAATCATCACGAA-3′, reverse: 5′-GTCCACCAGGGTCTCGATT-3′), in accordance with the manufacturer’s instructions.

Dual luciferase viability experiment

The upstream and downstream 200 bp fragments of the KLF6 region bound to miR-200a-3p was selected, then constructed them onto the pmirGLO plasmid using whole gene synthesis method, and then sequencing and identification. The sequences of KLF6 was amplified and transferred to the luciferase gene downstream of pmirGLO plasmid (Promega, Fitchburg, WI, USA) to obtain pmiR-KLF6-WT. Meanwhile, the KLF6 fragment (pmiR-KLF6-MUT) containing the mutant target was designed according to the predicted binding sites of KLF6 and miR-200a-3p based on RNA22 (https://cm.jefferson.edu/rna22/interactive). PmiR-KLF6-WT, pmiR-KLF6-MUT and miR-200a-3p mimics and miR-NC were co-transfected into HUVECs using lipofectamine® 3000. Forty-eight hours after the transfection, the relative luciferase activity was evaluated via the Dual-Luciferase® Reporter Assay System (Promega, E1910).

Statistical analysis

The data analysis was conducted using SPSS 19.0, and the results were presented as the mean ± standard deviation. The LSD-t test was employed to compare two groups, while the analysis of variance (ANOVA) test was utilised for comparing multiple groups. Significant results were determined based on as two-tail p values less than 0.05.

Results

TNF-α induced the secretion of IL-6

FLS were stimulated with TNF-α for 48 h, resulting in a noticeable increase in the concentration of IL-6 in the culture supernatants (Figure 1A, p < 0.01). This finding serves as confirmation that TNF-α directly triggers an inflammatory response in FLS.

Figure 1. Content of IL-6 in culture supernatant of FLS and characteristics of exosomes derived from FLS induced by TNF-α or PBS were quantified and characterised by nanoparticle characterization instrument, transmission electron microscope and Western blot. (A) The changes of content of IL-6 in culture supernatant of FLS stimulated by PBS or TNF-α for 48h. (B) Transmission electron microscope pictures of exosome. (C) Particle size distribution of exosomes. (D) The protein of CD9, CD63 and TSG101 in exosome were examined by Western blot. **p < 0.01.

Identification of exosomes derived from FLS

The successful separation of exosomes was confirmed through the examination of their typical morphology using a transmission electron microscope (Figure 1B). Additionally, nanoparticle characterisation instrument assays revealed that the isolated exosomes exhibited a mean diameter ranging between 50 and 150 nm (Figure 1C), which was consistent with the unique distribution of exosomes. Furthermore, the expression levels of exosome markers, including CD9, CD63 and TSG101 were successfully detected by western blot (Figure 1D).

Exosomes derived from FLS induced by TNF-α promoted invasion, migration and angiogenesis

In order to further explore the impact of exosmes derived from FLS induced by TNF-α on the biological functions of HUVEC, various properties including invasion, migration, and angiogenesis. HUVEC treated with PBS were utilised as the control group for comparison purposes. Compared to the control group, exosomes induced by PBS or TNF-α promoted HUVEC invasion and migration. In comparison to exosomes induced by PBS, exosomes induced by TNF-α exhibited a significantly heightened invasion, and migration as evidenced by Figure 2 (p < 0.01). Additionally, the angiogenesis of HUVEC, including total loops, tube length, and branch points were notebaly increased in TNF-α induced exosomes (Figure 3, p < 0.05).

Figure 2. Exosome derived from FLS stimulated by TNF-α promoted invasion and migration of HUVECs. Transwell invasion assay was utilised to assess the invasion ability of HUVECs after different treatment (a); the column presented the relative invasion HUVECs (B); wound healing assay was utilised to assess the migration ability of HUVECs after different treatment (C); the column presented the migration ratio of HUVECs (D). **p < 0.01.

Figure 3. Exosome derived from FLS stimulated by TNF-α promoted angiogenesis of HUVECs. The angiogenesis assays were detected by tube formation assay after different treatment (a); the columns presented the number of total loops (B), tube length (C), and total branching points (D). *p < 0.05.

Differentially expressed miRNA and mRNA

There were 7 differences (p < 0.05) miRNAs in exosomes and HUVEC cells, and 4 consistent differences in expression, namely miR-1246, miR-200a-3p, miR-30a-3p, and miR-99b-3p (Table 1). We selected these four miRNAs mentioned above in this study and validated them using qPCR. The qRT-PCR results showed that miR-200a-3p maintained high consistency with the sequencing results. MiR-200a-3p maintained high consistency with the sequencing results. Subsequently, we obtained 271 genes with ∣logFC∣ ≥ 1.5 and p < 0.05 from the differential mRNA obtained. Then 271 genes were compared with the intersection of 4678 protein coding genes related to angiogenes from the genecard (https://www.genecards.org/), and 1088 predicted target genes from miR-200a-3p in the miRDB database. Finally, we obtained 5 gene symbols: IL-6R, EPHA2, KLF6, NAMPT, PRKAB1 (Table 2).

Table 1. Differentially expressed miRNA in HUVECs and exosome.

	HUVECs			exosome
microRNA_ID	logFC (TNF/PBS)	Pvalue (TNF/PBS)	Qvalue (TNF/PBS)	logFC (TNF/PBS)	Pvalue (TNF/PBS)	Qvalue (TNF/PBS)
hsa-miR-1246	1.857309863	0.001521267	0.068239696	4.968773442	0.008672444	0.089958228
hsa-miR-200a-3p	1.104474994	0.011500491	0.319526725	4.008798516	2.25E-20	1.38E-17
hsa-miR-30a-3p	−0.579654845	0.017988094	0.444300775	−0.78515269	0.030665481	0.21822412
hsa-miR-99b-3p	−1.012746146	0.003937364	0.154541536	−1.153136397	0.018328433	0.151581098

Table 2. Differentially expressed mRNA in HUVECs.

Gene Symbol	PBS Average TPM	TNF Average TPM	PBS Average FPKM	TNF Average FPKM	PBS Average Read Count	TNF Average Read Count	logFC (TNF/PBS)	Pvalue (TNF/PBS)	Qvalue (TNF/PBS)
IL6R	3.98	16.54666667	7.936666667	32.72666667	763	2610.783333	2.194081394	1.43E-283	6.52E-281
EPHA2	100.4766667	417.5533333	200.5566667	825.2433333	20134.16	64885.22333	2.107294855	0	0
KLF6	64.32666667	18.04333333	127.25	36.00333333	10853	3918.666667	−1.888964308	0	0
NAMPT	7.753333333	25.86666667	15.45	51.13666667	1716.666667	4476	1.803161981	3.78E-216	1.02E-213
PRKAB1	5.223333333	15.36	10.42666667	30.35333333	576.04	1294.333333	1.587373242	1.34E-93	1.13E-91

Abnormal expression of miR-200a-3p

To further elucidate the mechanism by which exosomes derived from FLS regulate the biological function of HUVEC. The expression of miR-200a-3p was assessed using qRT-PCR. The results revealed a significantly increase in the expression of miR-200a-3p in exosomes derived from FLS induced by TNF-α, in comparison to those induced by PBS (Figure 4A, p < 0.01). In a similar vein, the expression of miR-200a-3p in HUVEC, which were subjected to exosomes derived from FLS induced by TNF-α, exhibited a substantially increase when compared to both the control group and the PBS induced exosome group (Figure 4B, p < 0.01).

Figure 4. The expression level of miR-200a-3p. The expression level of miR-200a-3p derived from FLS stimulated by PBS or TNF-α were detected by qRT-PCR (a); the expression level of miR-200a-3p in HUVECs after different treatment (B). *p < 0.05, **p < 0.01.

Exosomes derived from FLS induced by TNF-α regulated the expression of KLF6 and VEGFA in HUVEC

It is widely acknowledged that micro RNA exterts a sponge effect that facilitates mRNA degradation. Consequently, we proceed to investigate the expression of KLF6 and VEGFA in HUVEC via western blot analysis. Our findings revealed a significant reduction in the expression level of KLF6 in HUVEC treated with exosomes derived fromFLS induced by TNF-α, in contrast to the PBS induced exosome and the control groups (p < 0.01). Conversely, the expression level of VEGFA were markedly increased in the TNF-α induced exosome group (Figure 5, p < 0.01).

Figure 5. Exosome derived from FLS stimulated by TNF-α decreased the expression of KLF6 and promoted the level of VEGFA in HUVEC. KLF6 (A) and VEGFA (B) were detected by qRT-PCR; Western blot assay was used to detect the proteins expression of KLF6 and VEGFA (C); the columns presented the relative expression of KLF6 (D) and VEGFA (E). *p < 0.05, **p < 0.01.

KLF6 is target of miR-200a-3p

Through an examination of the RNA22 database, we conducted an analysis of the downstream regulatory genes associated with miR-200a-3p. Our findings revealed that KLF6 mRNA possesses a binding site that interacts with miR-200-3p (Figure 6A). Subsequently, we employed dual luciferase activity assay, to confirm that miR-200a-3p specifically targets KLF6 (Figure 6B).

Figure 6. KLF6 is the target of miR-200a-3p. The 3′UTR of KLF6 mRNA has a base site that binds to miR-200a-3p (a); the dual luciferase activity experiment was used to confirm the targeting relationship between miR-200a-3p and KLF6 in HUVECs. ** p < 0.01.

Discussion

The pathogenesis of rheumatoid arthritis is profoundly influenced by the inflammation process and activation of FLS. Exosomes play a critical role in facilitating intercellular communication [17]. In the current study, we isolated primary FLS from synovial tissue and articular cartilage of RA patients. TNF-α was utilised to stimulate the FLS. Subsequently, we derived exosomes from FLS stimulated by TNF-α or PBS. Exosomes were successfully identified by transmission electron microscope. Multiple unique markers can be used to identify exosomes, including CD9, CD63, and TSG101 etc [18,19]. Exosomes were further identified by CD9, CD63, and TSG101 in FLS derived from FLS. Furthermore, we found that TNF-α stimulation enhanced the expression of CD9, CD63, and TSG101. Nakao et al. indicated that TNF-α-treated exosomes isolated from human gingiva-derived mesenchymal stem cell significantly polarised macrophage phenotype from M1 to M2, thereby suppressed periodontal bone loss [20]. In our study, we found that the IL-6 content in TNF-α-treated FLS was higher than that in FLS. Li et al. indicated that TNF-α-induced pro-inflammatory cytokines (IL-1β, IL-6 and IL-8) production of human MH7A cells [21]. Similar to this study, our study also indicated that TNF-α stimulated the secretion of IL-6 triggered inflammatory response.

Neovascularization is promoted by proangiogenic factors produced by immune cells during inflammatory reaction [22]. As a result of an inflammatory process and angiogenesis, fragile vessels form, which exposes the synovial membrane to further bleeding [23]. The angiogenensis process of cells includes adhesion, migration, and invasion etc [24]. We first investigated the HUVECs invasion and migration capacity after different treatment. We found that the invasion and migration capacity of HUVECs with TNF-α stimulated exosomes significantly increased. Interestingly, the invasion and migration capacity of HUVECs treated with PBS stimulated exosomes also increased, indicated that exosomes may contribute to the invasion and migration of HUVECs. Synovial blood vessel growth is a significant event in the progression of RA [25]. Further experiments presented that TNF-α stimulated exosomes promoted the tube formation of HUVECs. Notably, PBS stimulated exosomes decreased the tube formation of HUVECs compared to the control group. The reason for this difference may related to exosomes stimulated by TNF-α secreted various factors.

Research has demonstrated that exosomal miR-103a, derived from macrophages, impedes the expression of hepatocyte nuclear factor 4 alpha (HNF4A) and activates the JKA/STAT3 signalling pathway, thereby promoting joint inflammation and angiogenesis in a mouse model of rheumatoid arthritis [26]. Similar to their search, we also found that exosomes contribute to the formation of synovial microvessels. A previously study has been demonstrated that exosomes stimulated by TNF-α secreted long non-coding RNA suppressed chondrocyte proliferation and migration through modulating cartilage extracellular matrix [9]. Another study indicated that circRNA suppressed the TNF-α induced MH7A cells migration and proliferation [21]. Exosomes derived from synovium may be valuable biomarkers for RA [5]. However, there is no clear study indicating the role of miR-200a-3p in TNF-α stimulated exosomes derived from FLS of RA patients. We utilised DNBSEQ sequencing platform to sequence the exosomes miRNAs, miRNAs and mRNA from the intervention HUVECs. There were 7 differences in the expression of miRNAs in exosomes and HUVECs, and 4 consistent differences in expression. We chose miR-200a-3p to further study. PCR result revealed a significant increase of the expression of miR-200a-3p in TNF-α stimulated exosomes. Furthermore, the expression of miR-200a-3p HUVECs treated with TNF-α stimulated exosomes also enhanced than HUVECs or PBS induced exosomes. Our results indicated that TNF-α induced the expression of miR-200a-3p. Previous study indicated the release of miR-200a-3p-enriched microvesicles from activated platelets modulated VEGFA expression in HUVEC remotely [12]. Wu et al. confirmed that miR-200a-3p inhibitor aggravated inflammation cytokines in human nasal epithelial cells [27]. These studies indicated that miR-200a-3p was related to inflammation and angiogenesis. We analysed the 271 differential mRNA obtained from sequencing, and found that the expression changes of KLF6 were consistent with our hypothesis.

KLF6 is a transcriptional activator, and functions as a tumour suppressor [28]. Previous studies have confirmed the role of KLF6 in inhibiting angiogenesis [29,30]. It has been reported that VEGF is angiogenic growth factors whose activation results in dysregulated blood vessel formation could be observed in RA [31]. Cheng et al. demonstrated that angiogenesis was promoted by LOXL1-AS1 through miR-590-5p-medicated modulation of KLF6/VEGF signalling [32]. VEGFA as one member of VEGF family is also participate in angiogenesis [33]. We investigated the expression levels of KLF6 and VEGFA mRNA and protein. QRT-PCR and western blot results presented that the expression levels of KLF6 mRNA and protein suppressed in HUVECs treated with TNF-α stimulated exosomes. Whereas, the expression levels of VEGFA enhanced in HUVECs treated with TNF-α stimulated exosomes. This results was similarly to previous study [34]. Subsequently, the fluorescent enzyme reporter assay provided confirmation that KLF6 was directly targeted by miR-200a-3p. Numerous studies indicate that the expression level of KLF6 is related to the injury time [29,35]. However, we only detected the expression level of KLF6 at one time point. Therefore, the changes of KLF6 expression level should investigate in the future study. However, there are still limitations in the study. First, we found that the PBS induced the exosomes also promoted HUVECs migration and invasion, the reason may be due to other substances that we have not identified, such as lncRNA. Furthermore, due to we are currently conducting research based on this sequencing data, we could not yet to publicly disclose our Clean Data. Finally, it is crucial to acknowledge the limitations of our investigation, which solely relied on in vitro experiments.

In summary, our study has provided evidence that exosomes derived from FLS, induced by TNF-α, possess the capacity to augment the migratory, invasive, and angiogenic properties of HUVECs through the involvement of the miR-200a-3p/KLF6/VEGFA axis. This significant finding contributes to an enhanced comprehension of the underlying mechanisms behind synovial pannus formation in rheumatoid arthritis.

Authors’ contributions

Bin Zhang, Mingfeng Yang: Conceptualisation, Methodology, Software, Validation, Formal analysis, Investigation, Data Curation, Writing - Original Draft, Funding acquisition. Juanfang Gu: Methodology, Software, Validation, Formal analysis, Investigation, Visualisation, Funding acquisition. Linfeng Guo: Methodology, Software, Validation, Investigation, Data Curation. Jiangzhen Xie: Software, Investigation, Resources, Funding acquisition.

Ethics approval and consent to participate

The studies involving human participants were reviewed and approved by the Institutional Research Ethics Committee of the Ethics Committee of The First Hospital of Jiaxing (Approve number: LS2020-073). The study was conducted in accordance with the Helsinki declaration of the world medical association.

Disclosure statement

The authors declare no competing interests.

Additional information

Funding

This work was supported by Natural Science Foundation of Zhejiang [grant numbers LQ19H010001], Science and Technology Foundation of Jiaxing [grant numbers 2021AD10022], Jiaxing Key Discipiline of Medcine, Rheumatology and Autoimmunology (Supporting Subject2023-ZC-016).