Differences in adrenocortical secretory and gene expression responses to stimulation in vitro by ACTH or prolactin between high- and low-avoidance Hatano rats

Abstract

Rats of the Hatano high-avoidance (HAA) and low-avoidance (LAA) strains have been genetically selected on the basis of their two-way active avoidance behavior, and have different endocrine responses to stress. The present study focused on the adrenal steroid hormone responses of the Hatano strains and identifies differences in regulation of the adrenal cortex in vitro of HAA and LAA rats. Although incubation with prolactin (PRL) and/or adrenocorticotrophic hormone (ACTH) resulted in a dose-dependent increase of corticosterone and progesterone release by adrenal cells from both HAA and LAA male rats, the responses were markedly increased for adrenal cells from LAA rats as compared with HAA rats. This finding suggested that adrenal glands of HAA rats are less sensitive to PRL and/or ACTH than adrenals from LAA rats. Several possible intra-adrenal regulators were investigated. The basal level of expression of steroidogenic acute regulatory protein (StAR) and the long form of the PRL receptor (PRLR-L) mRNAs was higher in adrenals of LAA rats. ACTH treatment of adrenal cells from HAA rats resulted in statistically significant increases in melanocortin receptor 2 (MC2R) mRNA expression, while neither ACTH nor PRL altered MC2R mRNA expression in adrenal cells of LAA rats. Conversely, the increase in PRLR-L mRNA expression induced by PRL was observed only in adrenal cells from LAA rats. Treatment of adrenal cells with PRL and/or ACTH increased the expression of StAR and CYP11A1 mRNAs for both Hatano strains. However, the induction of StAR mRNA expression was higher in LAA rats, but the CYP11A1 response was lower. These findings indicate that adrenal cells of the LAA strain have higher sensitivity to secretagogues than those of the HAA strain. These results suggest that PRL may also be important in stimulating secretion of adrenal steroid hormones.

• ACTH
• adrenal steroids
• Hatano rat
• MC2R
• prolactin
• steroidogenic acute regulatory protein

Introduction

Hatano high-avoidance (HAA) and low-avoidance (LAA) rat lines have been selected, respectively, for rapid versus poor acquisition of two-way active avoidance behavior in a shuttle box (Ohta et al. 1995). This selective breeding has resulted also in different endocrine responses to stress between the two strains. One of the most important features resulting from the genetic selection of Hatano rats has been that the LAA strain has a significantly blunted adrenocorticotrophic hormone (ACTH) response, but higher corticosterone and prolactin (PRL) responses, to restraint stress compared with the HAA strain (Ohta et al. 1999; Asai et al. 2004, 2006). Although HAA rats have heavier adrenals and a thicker adrenal cortex than LAA rats, lower basal or stressed plasma corticosterone levels with normal ACTH levels were detected in HAA rats (Ohta et al. 1999; Asai et al. 2004, 2006). It seems likely from these results that there may be critical differences in adrenocortical responsiveness between the two strains, bred for high and low avoidance, which may be reflected in changes in plasma corticosterone levels.

Stress embodies a range of integrative physiological and behavioral processes that occur when there is a real or perceived threat to homeostasis. It is well established that differences in hypothalamic–pituitary–adrenal (HPA) axis responsiveness may occur at all levels of the axis. Previous studies have compared the responsiveness of the HPA axis to stress in different rat strains, and it has been concluded that the differences seen are mostly at the level of the adrenal glands (Gomez et al. 1996; Kosti et al. 2006). Thus, the present study was focused on the intra-adrenal changes in response to PRL and/or ACTH of the two inbred HAA and LAA rat strains.

PRL is an essential hormone for mammary gland development and milk production, but it also acts on the adrenal gland (Ogle and Kitay 1979; Glasow et al. 1998; Opalka et al. 2001; Kaminska et al. 2002; Silva et al. 2004). Additionally, recent studies showed that PRL increases in vitro the secretion of corticosterone and aldosterone by rat adrenocortical cells (Lo et al. 1998, 2006; Chang et al. 1999; Kau et al. 1999; Lo and Wang 2002; Kan et al. 2003; Jaroenporn et al. 2007). As mentioned above, circulating stress levels of PRL were higher in LAA rats, while stress levels of ACTH were lower than in HAA rats. It seems that an increased corticosterone response to ACTH in the LAA strain may be due to the higher levels of PRL present in this strain.

The ACTH receptor gene has been cloned; it belongs to the melanocortin receptor family, and is classified as melanocortin receptor 2 (MC2R; Mountjoy et al. 1992). This receptor is expressed in all three zones of the adrenal cortex (Reincke et al. 1998). The presence of high and low affinity receptors for ACTH indicates that the adrenal cortex is highly sensitive to the concentration of ACTH in the systemic circulation. ACTH binds to its receptors located on adrenal cell membranes, activating a Gs-protein and resulting in an increase of intracellular cyclic adenosine monophosphate (cAMP) concentration (Sewer and Waterman 2003). ACTH thereby stimulates corticosterone secretion by affecting several steps in the steroidogenesis pathway: (1) ACTH increases the transcription of the steroidogenic acute regulatory protein (StAR) gene, resulting in increased cholesterol uptake, the precursor for the biosynthesis of all steroid hormones, (2) ACTH stimulates the cleavage of the side-chain of cholesterol (via CYP11A1), converting cholesterol to pregnenolone, the first and rate-limiting step in corticosterone production and (3) ACTH hydroxylates pregnenolone to give 17-OH-pregnenolone, which then transfers to the endoplasmic reticulum for conversion to 11-deoxycortisol.

The present study aimed to evaluate in vitro the adrenal steroid hormone response of the Hatano strains and identify differences in the adrenal regulation of HAA and LAA rats that may underlie differences in their responses to stress in vivo. This study was designed to determine adrenocortical responsiveness to ACTH and PRL, and the expression of adrenal signaling molecules was investigated in order to determine whether the differences observed may be explained by the changes in the expression of MC2R, the long form of the PRL receptor (PRLR-L), StAR or CYP11A1 mRNAs.

Materials and methods

Animals

Adult male Hatano rats (ages 8–12 weeks) from each strain, HAA and LAA, were obtained from the Hatano Research Institute. The rats were kept under standard housing conditions, with controlled lighting (lights on 05.00–19.00 h), temperature (23 ± 2°C) and humidity (50 ± 10%). They were fed with rat diet (MR-Breeder, Nosan Corporation, Yokohama, Japan) and water ad libitum. The experimental protocol was approved by the Animal Ethical Committee in accordance with the guide for the care and use of laboratory animals prepared by Tokyo University of Agriculture and Technology.

Materials

Dulbecco's modified Eagle's medium (DMEM), MEM non-essential amino acid solution, penicillin and streptomycin were purchased from Invitrogen (Burlington, ON, Canada); HEPES was purchased from Dojindo (Gaitherburg, Maryland, USA); collagenase type V, deoxyribonuclease and fetal bovine serum were purchased from Sigma-Aldrich (St. Loui, MO, USA); AG490 was purchased from Calbiochem (San Diego, CA, USA); rat ACTH (AFPRFR7890) and ovine PRL (oPRL; AFP10692C) were purchased from NIDDK (NIH, Torrance, CA, USA).

Primary adrenal cell culture

Adrenal glands were obtained from HAA or LAA rats. For each experiment, five rats from each strain were killed by decapitation, without anaesthesia; each experiment was repeated three times (15 rats of each strain in total), and in quadruplicate. The adrenal glands were immediately removed. Whole glands were used, and procedures were performed according to the previously described methods (Jaroenporn et al. 2007). Cells at a concentration of 5 × 10⁴ cells/200 μl were pre-incubated for 24 h at 37°C in a humidified atmosphere (95% air/5% CO₂) with DMEM medium supplemented with 2% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin. After 24 h in culture, the incubation medium was replaced with fresh medium, and cells were then incubated in the absence or presence of rat ACTH (10^{− 15} to 10^{− 10} M) and/or oPRL 10^{− 9} to 10^{− 6} M) for 4 h. At the end of the 4 h incubation period, the supernatant was decanted and stored at − 20°C for later corticosterone determination by radioimmunoassay (RIA). Additionally, supernatant concentrations of progesterone, the precursor of corticosterone were also measured.

RNA isolation and cDNA synthesis

Total RNA was isolated from the pellet of the incubated cells with Isogen reagent (Nippon gene, Toyama-prefecture, Toyama, Japan) according to the instructions of the manufacturer. The isolated RNA was reverse transcribed into cDNA with a PrimeScript™ 1st strand cDNA Synthesis Kit (Takara Bio Inc., Otsu, Shiga, Japan) according to the manufacturer's instructions. Briefly, 2 μg of total RNA was mixed with 50 μM oligo dT primer and 10 μM dNTPs diethylpyrocarbomate (DEPC)-treated water to a final volume of 10 μl. RNA and primers were denatured at 65°C and then cooled immediately on ice. Reverse transcription was performed using 10 μl of a master mix containing the following: 5 × PrimerScript™ buffer, RNase inhibitor 40 U/μl, PrimerScript™ RTase 200 U/μl and DEPC-treated water. Reactions were incubated at 42°C for 30 min and were terminated by incubation at 95°C for 5 min. Samples were either used directly for PCR or were stored at − 20°C until analysis.

Quantitative real-time PCR

Quantitative real-time PCR was performed with a Chromo 4™ System (Bio-Rad, CA, USA) according to the manufacturer's instructions. The reaction mixture contained cDNA, 10 μM primer pairs and 2 × SYBR^® Premix Ex Taq™ (Takara Bio Inc., Otsu, Shiga, Japan) in a final volume of 25 μl. The Thermal Cycling program was 95°C for 10 sec, and 40 cycles at 95°C for 3 sec, 60°C for 20 sec, followed by the melting curve determination between 60°C and 95°C to differentiate between the desired amplicons and any primerdimers or DNA contaminants. The specific primer pairs for each gene are shown in Table I.

Table I.  Sequences of forward and reverse primers used for RT-PCR.

Gene	Sense primer (5′-3′)	Antisense primer (5′-3′)
StAR	CAGGTGTGGGCAAGGTGTTC	TGCGGTCCACCAGTTCTTC
CYP11A1	ATCCAGCTTCTTTCCCAATCC	AAAGCCCAAGTACCGGAAGTG
MC2R	CATCATTGGAGTTTTGGAGAA	TGGTGGGAGAAGATCACCATG
PRLR-L	ATACTGGAGTAGATGGAGCCAGGAG	CTTCCGTGACCAGAGTCACTGTCGG
GAPDH	CCTGCCCAAGATTGTTGAGT	TGTACCGATCGATGTCTGGA

Radioimmunoassay

Concentrations of corticosterone (Kanesaka et al. 1992) and progesterone (Taya et al. 1985) were measured by double antibody RIAs using ¹²⁵I-labeled radioligands as described previously. The intra- and inter-assay coefficients of variation were respectively: 5.1% and 12.7% for corticosterone and 6.2% and 10.7% for progesterone. The lower limits of the assay sensitivity were 5 pg/tube for corticosterone and 0.6 pg/tube for progesterone.

Statistical analysis

Results are expressed as mean ± standard error of the mean (SEM). Statistical analyses were performed using the statistical package for the Social Sciences program. Differences among times of sampling were evaluated by one-way analyses of variance for factorial or repeated measure design with post-hoc testing by least significant difference tests. P-values of less than 0.05 were considered to be statistically significant.

Results

Basal and ACTH-stimulated corticosterone and progesterone release in vitro

The basal release of corticosterone and progesterone by adrenal cells was greater for LAA than for HAA rats (Table II). Administration of ACTH (10^{− 15} to 10^{− 10} M) resulted in a dose-dependent increase of corticosterone and progesterone release for HAA and LAA rats (Figure 1A,B). However, the release of corticosterone and progesterone in response to ACTH (10^{− 15} to 10^{− 10} M) was significantly greater by adrenal cells from LAA rats as compared with HAA rats.

Table II.  The basal release of corticosterone and progesterone in primary cultures of adrenal cells from adult male HAA and LAA rats.

	Corticosterone (ng/ml)	Progesterone (ng/ml)
HAA	22.2 ± 1.1	1.3 ± 0.1
LAA	51.2 ± 2.9^*	2.5 ± 0.2^*

Results represent the means ± SEM of three different experiments performed in quadruplicate

^*P < 0.01 as compared with HAA rats.

Figure 1 Effects of ACTH (10^-15 to 10^-10 M) on release of corticosterone (A) and progesterone (B) in primary adrenal cultured cells from adult male HAA (open bar) and LAA rats (close bar). Results represent the means ± SEM of three different experiments performed in quadruplicate. ^{#, ##}P < 0.05, P < 0.01 as compared with basal level (0M) of each strains, respectively. ^{*, **}P < 0.05, P < 0.01 as compared with HAA rats, respectively.

oPRL-stimulated corticosterone and progesterone release in vitro

Administration of oPRL (10^{− 9} to 10^{− 6} M) resulted in a dose-dependent increase of corticosterone and progesterone release for both HAA and LAA rats (Figure 2A,B). However, the release of corticosterone and progesterone in response to oPRL (10^{− 7} to 10^{− 6} M) was significantly greater by adrenal cells from LAA rats as compared with HAA rats.

Figure 2 Effects of oPRL (10^{− 9} to 10^{− 6} M) on release of corticosterone (A) and progesterone (B) in primary adrenal cultured cells from adult male HAA (open bar) and LAA rats (close bar). Results represent the means ± SEM of three different experiments performed in quadruplicate. ^##P < 0.01 compared with basal level (0M) of each strain, respectively. ^**P < 0.01 as compared with HAA rats, respectively.

Co-treatment of oPRL and ACTH on corticosterone and progesterone release in vitro

When compared with the effects of ACTH alone at low ACTH concentrations (10^{− 15} to 10^{− 12} M), the release of corticosterone and progesterone was greater when oPRL (10^{− 7} M) was added (Figure 3). However, the release of corticosterone and progesterone with these concentrations of ACTH and PRL was no greater than with PRL alone at 10^{− 7} M (Figure 2), hence indicating that PRL does not enhance the responses to low concentrations of ACTH. However, the release of corticosterone and progesterone in response to co-treatment with oPRL and ACTH was higher in LAA rats as compared with HAA rats (Figure 3A,B).

Figure 3 Effects of co-treatment with 10^-7 M oPRL and ACTH (10^{− 15} to 10^{− 10} M) on release of corticosterone (A) and progesterone (B) by primary cultures of adrenal cells from adult male HAA (open bar) and LAA rats (close bar). Results are represents the means ± SEM of three different experiments performed in quadruplicate. ^##P < 0.01 compared with basal level (0M) of each strain, respectively. ^{*, **}P < 0.05, P < 0.01 as compared with HAA rats, respectively.

Influence Of Prl (10⁻⁷ M) And/or Acth (10⁻¹⁰ M) On Prlr, Mc2r, Star And Cyp11a1 Mrna Expression

As determined by quantitative real-time PCR, mRNAs for MC2R, PRLR-L, StAR and CYP11A1 were expressed in adrenal gland cells from HAA and LAA rats (Figure 4). Fold differences in mRNA expression were determined by calculations derived from the algorithms outlined by Vandesompele et al. (2002), using GAPDH as an endogenous control. The basal expression of MC2R and CYP11A1 mRNAs tended to be lower in LAA rats, whereas PRLR-L and StAR mRNA expression was significantly higher as compared with HAA rats. We next examined whether PRL (10^{− 7} M) and/or ACTH (10^{− 10} M) alter the expression of MC2R, PRLR-L, StAR and CYP11A1 in adrenal gland cells from LAA and HAA rats (Figure 4). ACTH treatment of adrenal cells from HAA rats resulted in significant increases in MC2R mRNA expression, while PRL did not alter the expression of MC2R mRNA (Figure 4A). Also, treatment with ACTH and PRL resulted in a greater increase in MC2R mRNA expression in adrenal cells from HAA rats. Additionally, the expression of MC2R mRNA in response to combined treatment with PRL and ACTH was significantly greater than with PRL or ACTH alone (P ≤ 0.01) in adrenal cells from HAA rats. This result suggests that there is the possibility of an interaction between PRL and ACTH in the adrenal cells of the HAA strain for stimulation of MC2R mRNA expression. In contrast to HAA rats, neither ACTH nor PRL altered MC2R mRNA expression in adrenal cells from LAA rats. For PRLR-L, no statistically significant difference was found in mRNA expression in adrenal cells from HAA rats treated with PRL and/or ACTH (Figure 4B). However, PRL increased PRLR-L mRNA expression in adrenal cells from LAA rats. Treatment with PRL and/or ACTH resulted in an increase in the expression of StAR and CYP11A1 mRNAs in both HAA and LAA strains (Figure 4C,D). However, the induction of StAR mRNA expression in response to PRL and/or ACTH treatment was higher in LAA rats as compared with HAA rats, but the CYP11A1 response was lower.

Figure 4 Effects of PRL (10^{− 7} M) and/or ACTH (10^{− 10} M) on MC2R (A), PRLR-L (B), StAR (C) and CYP11A1 (D) mRNA expression in primary adrenal cultured cells from adult male HAA (open bar) and LAA rats (close bar). Expression of the mRNAs was normalized to the expression of GAPDH mRNA. Fold induction represents the increase in expression compared with the basal levels of HAA rats. Values presented are the means of three samples in duplicates. ^{#, ##}P < 0.05, P < 0.01 compared with the basal levels in each strain, respectively. ^{*, **}P < 0.05, P < 0.01 compared with HAA rats, respectively.

Discussion

The present study was focused on the intra-adrenal changes in response to PRL and/or ACTH of two inbred rat strains known to have clear differences in their active avoidance behavior in a shuttle box. This study clearly demonstrated different endocrine responses at the level of the adrenal gland between HAA and LAA rats. Previous study showed that the LAA rats have a significantly blunted ACTH response to restraint stress compared with HAA rats, but a greater corticosterone response (Asai et al. 2004). This finding suggested that the HAA rat adrenal cortex is less sensitive to ACTH than the LAA rat adrenal. Moreover, in vitro results in the present study showed clear strain differences in basal steroid secretion and in adrenal responsiveness to PRL and/or ACTH stimulation, in agreement with a previous in vivo study (Asai et al. 2004). Although the minimum effect on corticosterone secretion from dispersed cells of both strains was achieved at the same concentration of ACTH (10^{− 14} M), the increment in steroid release in response to increasing doses of ACTH was significantly greater in the dispersed cells of the LAA strains. This finding supports the hypothesis that the adrenal cells of the LAA strain have greater ACTH sensitivity compared to those of the HAA strain. However, the mechanism to explain the strains difference in adrenal responsiveness to ACTH remains to be fully elucidated.

It is well known that the binding to the membrane receptor is a required step for ACTH to trigger cAMP formation and subsequent steroidogenic induction. The expression level of ACTH receptor on the adrenocortical cell surface is therefore an important factor determining ACTH responsiveness (Slawik et al. 2004). Although basal expression of MC2R mRNA was comparable between the HAA and LAA strains, the up-regulation of MC2R mRNA by ACTH and enhanced up-regulation by exposure to both ACTH and PRL was observed only in HAA rat adrenal cells. The present study measured the mRNA levels and the changes in order to seek difference in responses of ACTH and/or PRL between the two strains that might impact on the differences in secretory responses. The observations suggest that the greater corticosterone response to ACTH in the LAA strain may not be due to an increase in MC2R expression following ACTH treatment.

Another possibility is a PRL-induced promotion of adrenal steroidogenesis. Although this study showed that PRL could act directly on the adrenal cells to drive corticosterone and progesterone secretion in both Hatano strains, in agreement with previous studies (Chang et al. 1999; Lo et al. 2000; Lo and Wang 2003; Jaroenporn et al. 2007), release of the steroids in response to PRL was greater by adrenal cells from LAA rats as compared with HAA rats. Additionally, an increase in PRLR-L mRNA expression by PRL treatment was observed only in LAA rats. PRL action may involve interaction with the second messengers and the pathways used by ACTH, i.e. cAMP and Ca^{2 +} (Yamazaki et al. 1998; Gallo-Payet et al. 1999; Gallo-Payet and Payet 2003; Yamazaki et al. 2006). In addition, PRL has been demonstrated to exert membrane effects resulting in a rapid increase in intracellular Ca^{2 +} in a range of cells (Prevarskaya et al. 1995; Sorin et al. 1998, 2000; Ducret et al. 2002), probably through modulation of influx of extracellular Ca^{2 +} through voltage-gated calcium channels. Recent data document that Ca^{2 +} plays a crucial role in potentiating the levels of StAR expression and steroidogenesis in gonadal and adrenal cells (Cherradi et al. 1997; Manna et al. 1999). In addition, the present study found StAR mRNA expression to be greater in the adrenals of LAA than HAA rats. One interpretation of the findings is that Ca^{2 +} enhances similarly both the StAR response to ACTH and the additional increase in this response brought about by PRL. It is well known that adrenal steroidogenic enzymes, including a number of cytochrome P450 family and hydroxysteroid dehydrogenase (HSD) family members are controlled by ACTH (Waterman and Bischof 1996; Lo et al. 1998; Lo and Wang 2003; Chang et al. 2004). In this study, PRL and/or ACTH treatment resulted in an increase in the expression of StAR and CYP11A1 mRNAs in adrenal cells of both strains. This evidence lends support to the idea that PRL may contribute to a sustained corticosterone response by affecting several steps in the steroidogenesis pathway. The present study found that the PRL does not enhance ACTH stimulation of corticosterone and progesterone secretion, but it acts like ACTH to stimulate steroid secretion.

The finding of differential sensitivity to ACTH between the two Hatano rat strains may have considerable implications for the animals' adaptive stress response. According to this model, LAA rats that have a higher adrenal sensitivity may cope better with stressful stimulation, as shown by a low incidence of gastric erosions in restraint stress water (Asai et al. 2006). Conversely, HAA rats with lower adrenal sensitivity show a less adaptive response to stress.

In conclusion, the greater in vitro adrenocortical response to ACTH in the LAA strain relative to the HAA strain may underlie the greater corticosterone secretory response to stress in the LAA strain in vivo.

Acknowledgements

We are grateful to Dr. A.F. Parlow and the Rat Pituitary Hormone Distribution Program (NIDDK, NIH, Torrance, CA, USA) for providing rat ACTH and ovine PRL, and to Dr. G.D. Niswender, Animal Reproduction and Biotechnology Laboratory, Colorado State University, Fort Collins, CO, USA for providing antisera to progesterone (GDN337). This study was supported in part by a Grant-in-Aid for Scientific Research (B-18310044, The Japan Thailand Joint Research) from the Ministry of Education, Culture, Sport, Science and Technology of Japan and the Japan Society for the Promotion of Sciences.