Myocardial angiogenesis induced by exercise training involves a regulatory mechanism mediated by kinin receptors

ABSTRACT

Objective:

To demonstrate that the kallikrein-kinin system (KKS) is upstream of angiogenic signaling pathway, and to determine the role of the kinin B1 and B2 receptors in myocardial angiogenesis induced by exercise training.

Methods:

Forty Wistar rats were randomly assigned to an exercise control (EC) group, a B1 receptor antagonist (B1Ant) group, a B2 receptor antagonist (B2Ant) group, and a double receptor antagonist ((B1+ B2)Ant) group. A myocardial infarction model was employed. Animals in all groups received 30 min of exercise training for 4 weeks. The expression of VEGF and eNOS, capillary supply, and apoptosis rate were evaluated.

Results:

The mRNA and protein expression of VEGF and eNOS showed similar trends in all groups, and were lowest in the (B1+ B2) Ant group, and highest in the EC group. Levels of VEGF and eNOS mRNA were significantly lower in the B1Ant group than in the B2Ant group (p< .001 and p< .05, respectively). VEGF and eNOS protein in the B1Ant group was also significantly lower (p< .01 and p< .05, respectively) than in the B2Ant group. The capillary numbers in the (B1+ B2) Ant group were significantly lower than in the EC group (395.8 ± 105 vs. 1127.9 ± 192.98, respectively). The apoptosis rate of cardiomyocytes was highest in the (B1+ B2) Ant group.

Conclusion:

KKS may act as an upstream signal transduction pathway for angiogenic factors in myocardial angiogenesis. The B1 and B2 receptors exert additive effects, and the B1 receptor has the most prominent role in mediating KKS-induced myocardial angiogenesis.

KEYWORDS:

• Angiogenesis
• kallikrein-kinin system
• kinin B1 receptor
• kinin B2 receptor
• exercise training
• myocardial infarction
• VEGF
• eNOS

Introduction

Exercise training exerts many positive effects on the cardiovascular system, including improved heart function and improved collateral circulation of the coronary artery. Exercise and muscle contractions create a powerful stimulus for structural remodeling of the vasculature. An increase in flow velocity through a vessel increases shear stress, and an increase in shear stress is a major stimulus for the enlargement of conduit vessels and capillarity by angiogenesis. Angiogenesis induced by exercise training involves many angiogenic factors, including vascular endothelial growth factor (VEGF), fibroblast growth factor-2 (FGF-2), and endothelial nitric oxide synthase (eNOS), et al. VEGF is a potent pro-angiogenic factor and plays an important role in vasculogenesis and neoangiogenesis by inducing cell proliferation, inhibiting apoptosis, and increasing vascular permeability, vasodilatation, and recruitment of inflammatory cells to sites of injury (1–3). Nitric oxide/endothelial nitric oxide synthase is up-regulated by shear stress and exercise training (4), and eNOS is required for proper endothelial cell migration, proliferation, and differentiation (5). FGF-2 also contributes to exercise training-induced angiogenesis in heart tissue (5). While the roles of these and other factors have been well documented in vascular remodeling and angiogenesis, the signal transduction pathways and mechanisms underlying angiogenesis remains to be fully elucidated, and likely involve the coordination of many different angiogenic factors.

The kallikrein-kinin system (KKS) is an important modulatory system that exists in tissues and organs and has been implicated in many physiological and pathological processes. The biological action of the KKS is mediated by two known G-protein-coupled receptors, the B1 receptor and B2 receptor. The KKS exerts most of its effects via the B2 receptor, which is constitutively expressed in the vasculature (6). The B1 receptor has a higher affinity for kinin metabolites and is primarily expressed during tissue injury or inflammation (7).

The KKS is recognized as an important modulator of the cardiovascular system (8,9). Systemic delivery of the kallikrein gene inhibited myocardial injury (10), and experiments using mice deficient in tissue kallikrein revealed that tissue kallikrein plays an important role in cardioprotection against ischemia (11). The relationship between exercise and kinins had been reported that Kinin levels increased in the groups evaluated at the end of the training period and 60 min post-exercise (12). Acute increases in plasma kinin levels have also been reported to occur during exercise (13).

Many angiogenic factors interact with elements of the KKS. For example, in human airway smooth muscle cells, bradykinin can induce secretion of VEGF (14). Additionally, the bradykinin B1 receptor is a known stimulant of FGF-2 expression (15). Moreover, eNOS derived NO is a major effect of bradykinin-induced vasodilation and angiogenesis (16). In the present study, we hypothesized that the KKS is an upstream pathway involved in the activity of many angiogenic factors, and that activation of the KKS may activate angiogenesis. In this study, we evaluated the effects of activation of the KKS on the angiogenic factors VEGF and eNOS.

Materials and methods

Animal care and use

Adult male Wistar rats (180–220 g; 9 weeks of age) were purchased from the Laboratory Animal Center of Dalian Medical University. The animals were maintained under conventional conditions in our animal facility for 3 d with access to food and water ad libitum. This study was approved by the Ethics Committee of Affiliated Zhongshan Hospital of Dalian University. The study protocol complied with the Guide for the Care and Use of Laboratory Animals published by the U.S. National Institutes of Health (NIH Publication No. 85–23, revised 1996).

Experiment surgery

To create the myocardial infarction (MI) model, pentobarbitalum natricum (30 mg/kg body weight) was given intraperitoneally, and oral tracheal intubation with 40–60 ml/kg tidal volume was delivered at a breathing rate of 50–60 times/min. An incision was made at the point between the third and forth ribs where apex beats were the strongest, and the ligation point was between the apex and junction of the left atrial appendage and the pulmonary conus, ~2-3 mm under the left atrial appendage. The suture direction was perpendicular to the atrioventricular junction line. 5–0 sutures were used with moderate force, and the depth of insertion was 1.5–2.0 mm. Extensive paling of the cardiac muscle was observed under the ligated vessel, and movement of the ventricular wall was disordered. In case of arrhythmia, lidocaine was injected intraperitoneally.

Experimental protocol

All animals underwent heart surgery and exercise training. Exercise training began three days after the surgery. Rats were randomly assigned to one of four groups: (i) Exercise Control (EC) group (n = 10), in which animals were given saline (2 ml/kg) via intraperitoneal injection; (ii) B1Receptor Antagonist (B1Ant) group (n = 10), in which animals were given B1 receptor antagonist des-Arg9-[Leu8]-BK (50 nmol/kg body wt per day, Sigma) (17); (iii) B2 Receptor Antagonist (B2Ant) group (n = 10), in which animals were given B2 receptor antagonist bradyzide (0.75 nmol/kg body wt per day, Sigma) (18); (iv) Two Receptor Antagonist ((B1+ B2)Ant) group (n = 10), in which animals were given both B1 and B2 receptor antagonist simultaneously at the above doses. Antagonists were diluted with saline and delivered intraperitoneally. The intensity of exercise began with 8 m/min of running for 5 min, then increased to 11 m/min for 5 mins, and finally increased to 22 m/min for 20 min, 1 time/day. Exercise was initiated immediately after antagonist deliver for 4 weeks. The gradual increase in exercise intensity was modified from a previous report (19), and was justified based on a pilot experiment regarding the safety of exercise in rats with myocardial infarction. After 4 weeks, animals were euthanized, the heart was dissected out and the cardiac muscle on the fringes of the ligation point was isolated.

Measurement of VEGF and eNOS mRNA expression

Total RNA was extracted from homogenates of cardiac muscles with TRIzol. RT was performed using M-MLV reverse transcriptase (Invitrogen, Carlsbad, CA) with an oligo(dT) primer. Real-time PCR was performed using the LightCycler-FastStart DNA Master SYBR Green kit (Roche, Indianapolis, IN). The primer sets of VEGF, eNOS and β-actin were as follows: VEGF, 5ʹ- GGCTCACTTCCAGAAACACG −3ʹand 5ʹ-GTGCTCTTGCAGAATCTAGTGG-3ʹ; eNOS, 5ʹ- CATTGAGATCAAAGGACTGCAG −3ʹand 5ʹ- AGGACGCTGGTTGCCATAG−3ʹ; β-actin, 5ʹ–GAAGTGTGACGTTGACATCCG −3ʹand 5ʹ- GCCTAGAAGCATTTGCGGTG −3ʹ. The standard LightCycler program was performed as follows: pre-incubation at 95 C for 5 min, followed by amplification at 95 C for 30 s. Annealing followed at 65 C for 35 s. A total of 45 cycles were carried out for all reactions. The melting program was 65–95 C at the rate of 0.1 C/s with continuous fluorescence measurement. Data were analyzed using RelQuant LightCycler software (Roche, Indianapolis, IN).

Measurement of VEGF and eNOS protein expression

The levels of VEGF and eNOS in homogenates of cardiac muscle tissue were quantified by western blot. Briefly, 100ug protein per sample was separated using 12% SDS-PAGE, and then transferred on to a PVDF membrane (Millipore, Billerica, MA, USA). The membrane was blocked for 1 h in 5% (v/v) nonfat milk in tris-buffered saline-Tween (TBST), prior to incubation overnight at 4°C with an antibody against VEGF (GeneTex International Corporation, North America) and an antibody against eNOS (MyBiosource, Inc. Southern California, San Diego) diluted 1:2000 in 1% (v/v) nonfat milk in TBST. After incubation, membranes were washed three times with TBST, and then incubated for 1 h with an HRP (horseradish peroxidase)-conjugated sheep anti-rabbit IgG antibody (1:5000 dilution; KPL). The protein bands were visualized by chemiluminescence. β-actin was used as a loading control.

Measurement of capillary supply by immunohistochemistry

Paraffin-embedded tissue sections (4 μm) were deparaffinised by immersing in xylene. Sections were pre-incubated with 3% H₂O₂ for 15 min to inhibit endogenous peroxidase activity and were washed with PBS (pH 7.4). A 1:50 dilution of rabbit polyclonal anti-CD31 antibody (Abcam, Cambridge, United Kingdom) was applied to the sections overnight at 4°C. Sections were rinsed in PBS, then incubated with MaxVision singlestep immunohistochemical method reagent at room temperature for 15 min. The enzymatic reaction was visualized with diaminobenzidine.

Evaluation of apoptosis in TUNEL-positive cardiomyocytes

Briefly, tissue slides (4 μm) were deparaffinized, treated with proteinase K (20 μg/ml) for 15 min at room temperature, and then quenched in 2.0% hydrogen peroxide solution. After rinsing PBS(pH 7.4), specimens were incubated in 1× equilibration buffer for 10 to 15 s. The tissue slides were then incubated with terminal deoxynucleotidyl transferase (TdT) for 1 h at 37°C, blocked with stop/wash buffer, and incubated with peroxidase-conjugated anti-digoxigenin antibody for 30 min at room temperature. Finally, the slides were developed using diaminobenzidine (DAB; Sigma, St. Louis, MO, USA). Nuclear staining by hematoxylin was performed as counterstaining. The ratio of TUNEL-positive cardiomyocytes to the total number of cardiomyocytes was calculated.

Statistical analysis

All values are expressed as mean ± SD. One-way ANOVA was used to determine significant differences between groups (SPSS Version 20.0, SPSS Inc., Chicago, IL). When statistical significance was observed, post-hoc analysis was used to identify pairwise differences. A p-value of p < .05 was considered statistically significant.

Results

VEGF mRNA levels were lowest in the (B1+ B2)Ant group (p= .000 compared with the other three groups). There was almost a 3-fold difference in VEGF mRNA between the (B1+ B2)Ant group and the EC group. VEGF mRNA level in EC group were the highest (p= .000 compared with the B1ant group, p= .021 compared with the B2ant group). The difference of VEGF mRNA level between the B1ant group and the B2ant group was also significant (p= .000) (Figure 1a). Levels of eNOS mRNA were significantly lower in the (B1+ B2)Ant group compared with the B2Ant group (p= .000), and the B1ant group (p= .001). Levels of eNOS mRNA in the B1Ant group were significantly lower than in the B2Ant group (p= .028), and the EC group had the highest levels of eNOS (Figure 1b).

Figure 1. VEGF and eNOS mRNA and protein levels in cardiac muscle. (a) VEGF mRNA level, (b) eNOS mRNA level, (c) VEGF protein level, (d) eNOS protein level. VEGF was detected as an immunoreactive band at approx. 23 kDa, eNOS was detected as an immunoreactive band at approx. 140 kDa

VEGF protein and eNOS protein levels were significantly lower in the (B1+ B2)Ant group compared with the B1Ant group (p= .047and p= .020, respectively). Protein levels of VEGF and eNOS were significantly lower in the B1Ant group than in the B2Ant group (p= .001 and p= .015, respectively). VEGF and eNOS protein levels were highest in the EC group (Figure 1c,d).

Capillary numbers (Figure 2) in cardiac muscle tissue were significantly lower in the (B1+ B2)Ant group (395.8 ± 105) than in the other three groups (p= .000 compared with the EC group, p= .011 compared with the B1Ant group, p= .000 compared with the B2Ant group). Capillary numbers in the B1Ant group (635.7 ± 165.16) were significantly lower than in the B2Ant group (847.5 ± 290.92) (p= .024). Capillary numbers were highest in the EC group (1127.9 ± 192.98) (p= .004 compared with the B2 Ant group).

Figure 2. Immunostaining of CD-31 in cardiac muscles. Capillary vessels were defined as having brown/yellow-stained lumens. Magnification, Scale bar,50μm (×400)

The incidence of TUNEL-positive cardiomyocytes was quantified in each group (Figure 3). The ratio of TUNEL-positive cardiomyocytes to the total cardiomyocytes was highest in the (B1+ B2)Ant group (34.24 ± 6.73%) (p= .000 compared with the EC group and the B2Ant group, p = .017 compared with B1Ant group). There was no statistically significant difference in the ratio of TUNEL-positive cardiomyocytes between the B1Ant group (29.53 ± 3.43) and the B2Ant group (14.91 ± 3.35) (p= .53). The ratio of TUNEL-positive cardiomyocytes in the EC group was the lowest (11.16 ± 1.51).

Figure 3. Detection of TUNEL-positive cardiomyocytes. The apoptotic nuclei are stained brownish. Magnification, Scale bar, 50μm (×400)

Discussion

Our study is the first demonstration that cardiac angiogenesis depends on both kinin B1 and B2 receptors. We show that these two receptors exert additive effects, and that the B1 receptor has a more prominent role in facilitating angiogenesis. Our results suggest that KKS may be an upstream signal transduction pathway influencing the activity of angiogenic factors.

Exercise training exerts positive effects on the cardiovascular system, improving angiogenesis and heart function. Exercise also affects the KKS. Plasma kallikrein activity and bradykinin content increase immediately after exercise (20). In previous research, we found that angiogenesis in cardiac muscle induced by exercise training was accompanied by up-regulation of both the kinin B1 and B2 receptors (21).

There have is also evidence demonstrating relationships and interactions between the KKS and angiogenic factors. Yu et al. (22) found that exogenous bradykinin increased VEGF expression in prostate cancer cells and promoted tube formation in endothelial progenitor cells and human umbilical vein endothelial cells. Pretreatment of prostate cancer cells with B2 receptor antagonist reduced bradykinin-mediated VEGF production. Munk et al. (23) identified an obligatory role for hypoxia in the angiogenic effects of angiotensin II in the mouse heart via the AT2 receptor, which was mediated through a mechanism involving bradykinin, and revealed that angiotensin II–mediated angiogenesis is abolished by inhibiting the B2 kinin receptor. Furthermore, angiotensin II failed to induce endothelial sprout formation in the hearts of B2-knockout mice. The kinin B2 receptor was shown to play a crucial role in angiogenesis related to different vasoactive molecules, including bradykinin, ACE inhibitors, and VEGF, in an in vitro model of angiogenesis of mouse heart tissue under hypoxia (6). Diabetes mellitus reduces neovascularization, and diminishes growth factor expression and activity in a diabetic rat ischemic leg model. Treatment with the ACE inhibitor perindopril improves post-ischemic revascularization. This effect is mediated, at least in part, by the BK-B1R-related pathway and the activation of VEGF/eNOS/bFGF signaling (24).

In our study, we used kinin receptor antagonists to evaluate the influence of the KKS on angiogenic factors related to exercise. Post-MI animals undergoing exercise training have significant blood flow in the myocardium and increased myocardial vascular density compared to post-MI animals without exercise (19,25), therefore we did not employ a control group with myocardial infarction only without exercise. The main findings from the present study are that exercise-induced angiogenesis in cardiac muscle is inhibited by treatment with both a B1R antagonist and a B2R antagonist, and that up-regulation of VEGF and eNOS due to exercise training is also inhibited by antagonist treatment. Treatment with both B1R and B2R antagonists had nearly the same results, this may indicate that angiogenic factors triggering angiogenesis depend on the activity of the kinin receptors, and suggests that the KKS may a prominent upstream signal transduction pathway leading to the activity of angiogenic factors.

There are divergent reports regarding the roles of the B1 and B2 receptors in angiogenesis, as most studies are limited by their focus on only one receptor. In a murine model of limb ischemia, Emanueli et al. investigated the role of the kinin B1 receptor in reparative angiogenesis and demonstrated that abrogation of B1 signaling inhibited the native angiogenic response to ischemia, severely compromising blood perfusion recovery. This led to poorer outcomes, especially in B1 knockouts that had limb necrosis, eventually leading to spontaneous auto-amputation (26). Morbidelli et al. (27) studied the ability of bradykinin to stimulate cell growth and migration in cultured endothelium from coronary postcapillary venules (CVEC), and reported that treatment with a B1 receptor agonist mimicked the proliferative effects of bradykinin, whereas treatment with a B2 receptor agonist had no such effect. The proliferation induced by bradykinin was abolished by the addition of the B1 selective antagonist, while the selective B2 receptor antagonist did not modify bradykinin-induced growth. Thus, only the B1 receptor appeared to be responsible for the proliferation induced by bradykinin, and likely promoted coronary angiogenesis. Kränkel et al (28). demonstrated that the kinin B2 receptor was involved in the recruitment of circulating angiogenic progenitor cells (CPCs) to sites of ischemia, found that and B2R was abundantly present on CD133+ and CD34+ CPCs, as well as cultured endothelial progenitor cells (EPCs) derived from blood mononuclear cells (MNCs). They reported that blockade of the B2R by systemic administration of icatibant, a bradykinin B2 receptor antagonist, prevented the beneficial effects of bone marrow mononuclear cells transplantation. It was also shown that blocking B2R in early pregnancy impairs fetal growth and transformation of the spiral arteries, supporting the role of the B2R in local physiological adaptation (29). We used a rat myocardial infarction model to determine the relationship between angiogenic factors and the two kinin receptors during angiogenesis induced by exercise. Individually, both the B1R antagonist and the B2R antagonist inhibited angiogenesis and diminished the exercise-induced up-regulation of VEGF and eNOS, but when the two antagonists were used simultaneously the inhibition was more significant. The most important physiological findings from the present study are that cardiac muscle angiogenesis induced by exercise training is mediated by both kinin receptors. VEGF and eNOS mRNA expression was the lowest in the (B1+ B2)Ant group, and was highest in the EC group. Protein expression of VEGF and eNOS was lower in the B1antagonist group than in the B2 antagonist group, and was lowest in the (B1+ B2)Ant group. The density of blood vessels was also lowest in the (B1+ B2)Ant group, and was lower in the B1 receptor antagonist group than in the B2 receptor antagonist group. These data indicate that both the B1 receptor and the B2 receptor play a role in angiogenesis, and suggest that, while the effects of the two receptors are additive, the B1 receptor plays a stronger role than B2 receptor in mediating angiogenesis.

Exercise can reduce myocardial apoptosis. Exercise training is effective in diminishing apoptosis in the aging heart, demonstrating the beneficial effects of long-term exercise training (30). Hideaki et al. showed that kallikrein gene delivery significantly reduced myocardiocyte apoptosis after ischemia/reperfusion injury, as demonstrated by TUNEL assay, and that icatibant administration reversed the kallikrein-mediated beneficial effects (31). Infusion of cardiac tissue with kallikrein protein protects against myocardial ischemia injury by inhibiting apoptosis and inflammation (32), which is consistent with the results of our experiment. We found that apoptosis of cardiomyocytes was the lowest in the EC group. Treatment with the B1 receptor antagonist resulted in a significant increase in the apoptosis rate of cardiomyocytes. When both B1 and B2 receptors were blocked simultaneously, the rate of cardiomyocyte apoptosis was the highest, indicating that B1 and B2 receptors have an additive role in myocardial protection. There were no significant differences between the B1 group and B2 group (p= .053), but a larger sample size might show differential effects between treatment with the B1 and B2 receptor antagonists.

Study limitations

Our study clearly demonstrates that the B1 and B2 receptors play an additive role in exercise-induced angiogenesis, but we do not know whether the B1 and B2 receptors interact with each other in a synergistic manner. In future studies, we will evaluate the relationship and interactions between the B1 and B2 receptors and signal transduction during angiogenesis.

Conclusion

Prior to this study, little was known about the relationships between kinin receptors and angiogenic factors during exercise-induced angiogenesis. We report the novel discovery that expression of angiogenic factors depends on the activity of both the kinin B1 and B2 receptors, that these two receptors may exert additive effects on angiogenesis, and that the B1 receptor may have a more prominent role in angiogenesis than the B2 receptor. In conclusion, the KKS may be the upstream signal transduction pathway that mediates activity of angiogenic factors.

Statement of animal rights

The study protocol complied with the Guide for the Care and Use of Laboratory Animals published by the

U.S. National Institutes of Health (NIH Publication no. 85–23, revised 1996).

Acknowledgments

This study was approved by the Ethics Committee of Affiliated Zhongshan Hospital of Dalian University.

Disclosure statement

The authors have declared that no competing interests exist.

Additional information

Funding

This work was supported by the National Natural Science Foundation of China [grant No. 81071598]. Construction founds of key medicial disciplines in Longhua district, Shenzhen [MKD202007090206]; National Natural Science Foundation of China [81071598]; Construction founds of key medicial disciplines in Longhua district, Shenzhen [MKD202007090206].