Gene expression of insulin receptor, insulin-like growth factor increases and insulin-like growth factor-binding protein-3 reduces with increase in prostate size in benign prostatic hyperplasia

Abstract

Introduction: Although the role of insulin in the development of benign prostatic hyperplasia (BPH) is well established, there are no studies regarding alteration in the gene expression of components of insulin-signaling pathway and their association with prostate size in BPH. Hence, the study was designed to analyze the gene and protein expression of insulin receptor and its related components in patients with BPH.

Materials and methods: Twenty-seven BPH patients aged between 55 and 75 years were recruited in the study and prostatic tissues were obtained after transurethral resection of the prostate. Gene expression levels of Insulin receptor (IR), insulin receptor substrate (IRS), insulin-like growth factor (IGF) and insulin-like growth factor-binding protein-3 (IGFBP-3) were assessed by q-PCR.

Results: Insulin receptor (IR-A and B) and insulin-like growth factors (IGF-1 and IGF-2) gene expression were significantly increased and IGFBP-3 gene expression was reduced in BPH patients with larger prostate size. Also, serum insulin was significantly increased and IGFBP-3 was significantly reduced in patients with larger prostate size.

Conclusion: Increased expression of IR-A, B and IGF-1, 2 genes and reduced IGFBP-3 gene expression was associated with larger prostate size in BPH.

Keywords:

• Benign prostatic hyperplasia
• insulin receptor
• insulin-like growth factor
• insulin-like growth factor-binding protein
• gene expression

Introduction

Benign prostatic hyperplasia (BPH) is the most common urological problem in aging men [1]. Although BPH is highly prevalent, the pathogenesis involved in the development of prostate growth remains uncertain. Among hormones, androgens play a prominent and essential role in normal and hyperplastic prostate growth [2]. Pradidarcheep has found an association between late onset hypogonadism and lower urinary tract symptoms (LUTS) indicating a link between low testosterone and symptoms suggestive of BPH [3]. Previous studies have found an improvement in PSA, prostate volume and LUTS after testosterone replacement therapy in patients with hypogonadism [4–7], where as Efesoy et al. and Meuleman et al. did not found any increase in prostate volume or PSA after treatment with testosterone [8,9]. Dutasteride, a 5-α reductase inhibitor used in the treatment of BPH was found to reduce PSA and prostate volume and it has been attributed to increase in testosterone levels [10].

Previous studies have reported the role of other factors like insulin and insulin-like growth factors (IGF’s) in the development of BPH which might act through androgen independent mechanisms [11–13]. A recent study has reported that androgen deprivation therapy increases fasting plasma insulin and decreases insulin sensitivity [14]. Animal experiment studies and clinical studies have indicated the complications associated with insulin resistance in the pathogenesis of BPH [13,15,16]. Yeh et al. has revealed an association of LUTS with metabolic syndrome in elderly male [17]. Also earlier investigators have confirmed increased incidence of BPH in insulin resistant and diabetic population [18].

Insulin is known to influence cell growth, differentiation and regulation of gene expression and alteration in insulin-signaling cascade has been demonstrated in many cancers [19]. Insulin transduces its signaling through its cognate receptors, which consists of two isoforms, insulin receptor – A and B (IR-A and IR-B) [20], which belong to family of receptor tyrosine kinases that includes the receptor for insulin-like growth factor 1 (IGF-1 R). Upregulated expression of IGF-1 R, IR and potentially hybrid IR/IGF-1Rs was observed in many tumor types that enable high activation of mitogenic, prosurvival and protein synthesis pathways with the increased levels of ligands like insulin, IGF-1, or IGF-2 [21,22].

Recent studies have demonstrated the significance of insulin receptor and its differential expression in prostate cancer [23]. Over expression of insulin receptor and its higher activity of downstream signaling in malignant prostate tissues has been reported [24,25]. Differential expression of insulin receptor isoforms IR-A and IR-B and alteration in ratios of IR A/B were observed in prostate cancer and its adjacent tissues [26]. The insulin-like growth factor-binding protein-3 (IGFBP-3) is known to exhibitproapoptotic and antiangiogenic properties. Previous studies have demonstrated the expression of IGFBP-3 in benign epithelial, stromal and tumor prostate cells [27] and hypothesized that IGBP-3 gene suppresses metastasis in prostate cancer [28]. But till date, there are no reports about the expression of IR, IGF and IGFBP-3 in BPH patients with different prostate size. Hence, the present study was designed to investigate gene expression of insulin receptor and associated factors in prostate tissues of BPH patients and their association with prostate size.

Materials and methods

Study subjects

The study was carried out July 2015 to August 2016 in the department of Biochemistry and Urology, JIPMER, Puducherry, India. Twenty-seven BPH patients, aged 50–75 years, who underwent transurethral resection of prostate were recruited in the study. BPH was diagnosed based on clinical findings, per rectal examination, ultrasound findings and confirmed by histopathological findings. Subjects with prostate cancer, other causes of lower urinary tract symptoms, diabetes, renal disease, cardiovascular disease and pancreatic disorders were excluded from the study. The study protocol was approved by scientific advisory committee and institute ethics committee. Written informed consent was obtained from all the subjects prior to the study.

Blood sample collection and estimation of biochemical parameters

Five milliliters of venous blood samples was collected after overnight fasting from the subjects. Serum was separated and the aliquoted samples stored at −80°C and used for further analysis of the test parameters namely insulin (CalbiotechInc, Spring Valley, California), PSA (CalbiotechInc, Spring Valley, California), IGF-1 (Raybiotech, Georgia, United States), IGFBP-3 (Raybiotech, Georgia, United States) by using ELISA kits.

Prostate tissue collection and processing

Prostate tissues was obtained from transition zone of the prostate after transurethral resection of prostate (TURP) and were transferred immediately to the laboratory in liquid nitrogen container, tissues were aliquoted and stored at −80 °C. BPH patients were divided into two groups based on their prostate size: Group A (n = 13) prostate size ≤30 ml, Group B (n = 14) prostate size by >30 ml.

RNA extraction, cDNA synthesis and real-time PCR

RNA was extracted from tissues using RNeasy Fibrous Tissue kit in combination with RNase-free DNase set (Qiagen) according to the manufacturer’s protocol. RNA concentration, purity were determined by measuring the absorbance at 260 and 280 nm in Nanodrop2000 (Thermo Scientific, MA, USA). One microgram of total RNA was used for single-strand complementary DNA synthesis by using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, CA, USA) according to manufacturer’s protocol. Gene-specific oligonucleotide primers (IDT) were used as listed in Table 1. Expression levels of the genes were measured by real-time PCR using SYBR master mix (TaKaRa Bio Inc Japan). Real-time PCR was carried out in CFX96 real-time PCR detection system. Signals were normalized to the housekeeping genes β-actin or GAPDH as the endogenous internal control. The following real-time PCR protocol was used: Initial denaturation program (95 °C for 30 s), an amplification and quantification program repeated 40 cycles (95 °C for 5 s, 60 °C for 30 s). After the reaction complete, melting curve analysis performed in order to confirm the presence of a single PCR product. To determine the difference, mRNA levels derived from the group A (<30 ml) tissues were arbitrarily taken as control group. Fold change was calculated by using 2^–ΔΔCt method. All real-time PCR expression data were presented as arbitrary units.

Table 1. Primers used for real-time PCR.

Gene		Primer sequence
IR-A	Forward	GTTTTCGTCCCCAGGCCATC
	Reverse	CCAACATCGCCAAGGGACCT
IR-B	Forward	CACTGGTGCCGAGGACCCTA
	Reverse	GACCTGCGTTTCCGAGATGG
IRS-1	Forward	TATGCCAGCATCAGTTTCCA
	Reverse	TTTGCTGAGGTCATTTAGGTCTT
IRS-2	Forward	CAGGTGTCGGGAGTCGAG
	Reverse	GGAGGAGAAGGTCTCGGAAC
IGF-1	Forward	TGTGGAGACACGGGCTTTTA
	Reverse	ATCCACGATGCCTGTCTGA
IGF-2	Forward	CCCCCGAAAAGTACAACATC
	Reverse	GGGGGAGAATTCGTCTGATT
IGFBP-3	Forward	AAGTTGACTACGAGTCTCAG
	Reverse	AATCAGTTCACCACAAACAGA
IGF-1R	Forward	GAGCAGCTAGAAGGGAATTAC
	Reverse	AAGTTCTGGTTGTCGAGGA
GAPDH	Forward	AGCCACATCGCTCAGACAC
	Reverse	GCCCAATACGACCAAATCC
ACTIN	Forward	ATCTGGCACCACACTTCTACA
	Reverse	GTTTCGTGGATGCCACAGGACT

Western blot analysis

Prostate tissues were homogenized, and proteins were extracted using homogenizing buffer contains freshly added protease inhibitor cocktail (Mini complete protease inhibitor cocktail tablets, Roche, Germany) and incubated on ice for 20 min, followed by centrifugation at 12,000 rpm for 30 min at 4 °C. Thirty micrograms of proteins were resolved by SDS-PAGE (8–12%). After transferring to nitrocellulose membranes (Advantec, Japan), the membranes were then blocked with the skimmed milk solution, incubated overnight at 4 °C with appropriate primary antibodies (Rabbit monoclonal anti-IR, Cell Signaling Technology, MA, USA). And then membranes were washed with TBST thrice, incubated with horseradish peroxidase-conjugated secondary antibody at 25 °C for one hour, blots were visualized with an chemiluminescence blotting substrate (Roche, Germany) kit.

Statistical analysis

The normality of the data was tested by Kolmogorov–Smirnoff test. The data for the continuous variables were expressed as mean with standard deviation and median with range. Independent t-test was used to compare the differences between two groups. Statistical analysis was performed using SPSS, Graph Padsoftware and p values <.05 considered as statistically significant.

Results

Table 2 shows the mean and standard deviation of age, insulin, PSA, IGF-1 and IGFBP-3 in BPH patients with prostate size less than 30 ml and more than 30 ml. Insulin and PSA levels are significantly increased in serum of larger prostate size group. IGFBP-3 was significantly reduced in larger prostate size group and there was no significant difference in IGF-1 levels.

Table 2. Mean and S.D or Median (range) of age, prostate size and biochemical parameters among BPH groups.

Parameters	BPH patients with prostate size more than 30 ml (Group A) (n = 13)	BPH patients with prostate size less than 30 ml (Group B) (n = 14)	p value
Age (years)	60 ± 9.6	62 ± 10.2	.6
BMI	22.3 ± 2.2	20.1 ± 3.8	.44
Glucose (mg/dL)	101 ± 10.9	99.7 ± 11.9	.81
Insulin (µIU/mL)	18.9 ± 7.3	26.8 ± 8.2	.04
Insulin-like growth factor 1 (µg/L)	123.3 ± 7.3	123.6 ± 7.8	.91
Insulin-like growth factor binding protein 3 (µg/L)	1093.2 ± 215.7	862.8 ± 169.4	.02
Prostate-specific Antigen (µg/L)	0.8 (0.3–3.7)	4.2 (0.6–12.7)	.01

p value <.05 is considered as significant.

Gene expression of IR-a, IR-B, IRS-1 and IRS-2

We determined the gene expression levels of insulin receptor and its substrates in BPH patients with different prostate size. IR isoform A and B were significantly higher in BPH patients larger size prostate tissues when compared with lesser prostate size (Figure 1(A)). There was no significant difference of IRS-1 and IRS-2 expression between both the groups (Figure 1(B)).

Figure 1. (A) Relative fold change of IR A and IR B in prostate tissues of BPH patients (Group A: Prostate size <30 Ml, Group B: Prostate size >30 ml). Data were expressed in Mean ± SEM. *p = .007 for IR A, p = .01 for IR B. (B) Relative fold change of IRS-1 and IRS-2 in prostate tissues of BPH patients (Group A: Prostate size <30 Ml, Group B: Prostate size >30 ml). Data were expressed in Mean ± SEM. p value – .12 for IRS-1, p value – .25 for IRS-2.

Gene expression of IGF-1, IGF-2, IGF-1 R and IGFBP-3

Figure 2 shows the gene expression of IGF-1, IGF-2, IGF-1 R and IGFBP-3 in BPH patients with different prostate size. IGF-1 and IGF-2 expression were significantly increased and IGFBP-3 expression was significantly reduced in patients with larger prostate size group when compared to small prostate size group. There was no significant difference in IGF-1 R expression among two groups.

Figure 2. Relative fold change of IGF-1, IGF-2, IGF-1 R and IGFBP-3 in prostate tissues of BPH patients (Group A: Prostate size <30 Ml, Group B: Prostate size >30 ml). Data were expressed in Mean ± SEM. *p = .001 for IGF-1, p = .003 for IGF-2, p = .003 for IGFBP-3.

Protein expression of IR

Figure 3 shows the protein expression of insulin receptor beta subunit (IR-B) in prostate tissues. It was found that increase in IR-B expression was associated with increase in prostate size. Relative ratio of IR-B/Beta actin was higher in large prostate size group when compared with small prostate size group (p < .05).

Figure 3. (a) Relative ratio of IR-B/Beta actin protein expression in prostate tissues of BPH patients. Data were expressed in Mean ± SEM, *indicates statistically significant, p values – .05 for IR-B. (b) First line (C1) represent Group A (<30 ml prostate size), next four lines (S1, S2, S3, S4) represents Group B (>30 ml prostate size).

Discussion

Although several studies have reported IR expression in tissues that are classically insulin responsive, such as skeletal muscle and adipose tissue [29], the data regarding IR expression and its physiological role in prostate tissues are limited. Cox et al. have confirmed the presence of insulin receptor in prostate tissue and demonstrated two isoforms of IR such as IR isoform A and IR isoform B [23]. Overexpression of IR-A has been reported in several malignancies compared to IR-B [26]. It has been reported that IR isoform A regulates cell proliferation and exhibits antiapoptotic effects, whereas IR isoform B is involved in the metabolic regulation [30]. In the present study, we observed significantly increased gene expression of IR isoform A in BPH patients with prostate size more than 30 ml compared to those with less than 30 ml prostate size suggesting increased prostate growth is associated with over expression of IR-A. Also we found increased IR-B protein expression in BPH patients with larger prostate size.

Insulin-like growth factors (IGF-1 and IGF-2) are closely related and structurally similar to insulin. IGF-1 and IGF-2, through activation ofIGF-1 receptor (IGF-1 R) are involved in cell proliferation, migration, growth and apoptosis [31,32]. Previous studies have evaluated IGF-1, IGF-2 and IGF-1 R expression in prostate cancer and found significantly increased expression in prostate cancer when compared with normal prostate tissue [33,34]. These studies have concluded that the differential expression of components of IGF system are associated with aggressive tumor behavior and predicts the outcome of prostate cancer [33]. In the present study IGF-1 and IGF-2 expression were greater in BPH patients with larger prostate size compared to those with smaller prostate size. Also IGF-1 R expression was higher in patients with prostate size more than 30 ml, but it was not statistically significant.

Insulin-like growth factor-binding protein-3 (IGFBP-3), the most abundant IGF binding proteins in circulation function as regulators of IGF-I and IGF-II bioavailability and inhibitors of IGF action by preventing IGFs from binding to their receptors [35,36]. Previous investigators have demonstrated significant local production of IGFBP-3 in the prostate and an association between higher nuclear IGFBP-3 expressions with recurrence of prostate cancer [27,37]. In the current study, we found that IGFBP-3 expression was significantly reduced in BPH patients with larger prostate size.

Binding of insulin and IGF to IR or IGF-IR, respectively, results in the activation of intracellular downstream signaling (e.g. insulin receptor substrate [IRS]) pathways with different biological responses. IRS-1 was reported to be associated with tumor growth and proliferation and IRS-2 was found to be associated with tumor motility and invasion [38]. Increased expression of both IRS-1 and IRS-2 are demonstrated in hepatocellular, pancreatic and prostate cancers [38]. In our study, there was no significant difference in IRS-1and IRS-2 gene expression in both the groups.

In the present study, alteration in the gene expression in BPH patients with different prostate size was supported by alteration in serum levels of insulin and IGFBP-3. When serum levels of insulin, IGF-1 and IGFBP-3 levels were compared between two groups, we found that insulin was significantly increased and IGFBP-3 was significantly reduced in BPH patients with larger prostate size. These findings were in accordance with earlier studies from several groups including our group, which linked hyperinsulinemia with prostate enlargement in BPH patients [13,39,40].

Insulin resistance followed by secondary hyperinsulinemia is well established in BPH [15]. Based on our findings, we speculate that binding of insulin with insulin receptor may activate downstream signaling pathways like IRS resulting in prostate enlargement. Also, hyperinsulinemia may reduce the serum levels of IGFBP-3, thereby increasing the expression of IGF-1 and IGF-2 which can lead to increase in prostate size in BPH patients.

The strength of our study is, this is the first study to report alteration in gene expression of IR isoforms, IGF-1 R and its ligands IGF-1, IGF-2, in prostate tissue in BPH patients. The main limitation of our study is that only few cases had larger prostate size (>50 ml) and noninclusion of malignant prostate tissue to assess the alteration between benign and malignant prostate enlargement.

The data from the study has got clinical implication, since it demonstrates an association between increased expressions of insulin receptor, insulin receptor substrate, insulin-like growth factor in the enlargement of prostate in BPH. Increase in prostate size can lead to acute urinary retention, one of the common complications of BPH. The findings of this study will form the basis of further prospective studies to see if the altered expression of insulin receptor and its related components have a causal effect on BPH and whether they can predict the rate of progression of BPH. These findings may also provide new prospects for developing novel drugs for the treatment of BPH.

Conclusions

The findings from the present study showed increased expression of Insulin receptor, insulin receptor substrate and insulin-like growth factor in BPH patients with larger prostate size indicating overexpression of components of insulin-signaling pathway might be associated with development of BPH.

Acknowledgements

This work was supported by a grant from JIPMER intramural fund sanctioned to the corresponding author.

Disclosure statement

No potential conflict of interest was reported by the authors.

Additional information

Funding

This work was supported by a grant from JIPMER intramural fund sanctioned to the corresponding author.