Liuwei Dihuang pills attenuate ovariectomy-induced bone loss by alleviating bone marrow mesenchymal stem cell (BMSC) senescence via the Yes-associated protein (YAP)-autophagy axis

Abstract

Context

Liuwei Dihuang pill (LWDH) has been used to treat postmenopausal osteoporosis (PMOP).

Objective

To explore the effects and mechanisms of action of LWDH in PMOP.

Materials and methods

Forty-eight female Sprague-Dawley rats were divided into four groups: sham-operated (SHAM), ovariectomized (OVX), LWDH high dose (LWDH-H, 1.6 g/kg/d) and LWDH low dose (LWDH-L, 0.8 g/kg/d); the doses were administered after ovariectomy via gavage for eight weeks. After eight weeks, the bone microarchitecture was evaluated. The effect of LWDH on the differentiation of bone marrow mesenchymal stem cells (BMSCs) was assessed via osteogenesis- and lipogenesis-induced BMSC differentiation. The senescence-related biological indices were also detected using senescence staining, cell cycle analysis, quantitative real-time polymerase chain reaction and western blotting. Finally, the expression levels of autophagy-related proteins and Yes-associated protein (YAP) were evaluated.

Results

LWDH-L and LWDH-H significantly modified OVX-induced bone loss. LWDH promoted osteogenesis and inhibited adipogenesis in OVX-BMSCs. Additionally, LWDH decreased the positive ratio of senescence OVX-BMSCs and improved cell viability, cell cycle, and the mRNA and protein levels of p53 and p21. LWDH upregulated the expression of autophagy-related proteins, LC3, Beclin1 and YAP, in OVX-BMSCs and downregulated the expression of p62.

Discussion and conclusions

LWDH improves osteoporosis by delaying the BMSC senescence through the YAP-autophagy axis.

Keywords:

• Traditional Chinese medicine
• postmenopausal osteoporosis (P MOP)
• senescence

Introduction

Postmenopausal osteoporosis (PMOP) is a whole-body skeletal disease caused by ovarian degeneration and decreased oestrogen secretion in menopausal women. POMP is characterized by the deterioration of bone microarchitecture, an increase in bone fragility, and clinical manifestations, such as bone pain and fractures (Barron et al. 2020). PMOP has become a global public health problem. With an aging population, the expected increase in the prevalence and burden of PMOP will undoubtedly pose significant clinical, social and economic challenges (Adami et al. 2022). Currently, bisphosphonates and hormone replacement therapy are commonly used to treat PMOP; however, these therapies can induce diseases, such as heart disease, cancer and stroke during treatment (Lange et al. 2017; Lewis and Wellons 2017; The NAMS 2017 Hormone Therapy Position Statement Advisory Panel 2017), ultimately severely limiting the effectiveness of treatment and affecting the quality of life of patients. Therefore, the necessary preventive measures to reduce the high fracture risk and cost must be identified.

Mesenchymal stem cells (MSCs), which have proliferative capacity and differentiation properties, are derived from various tissues, including the placenta, adipose tissue, dental pulp and bone marrow. Bone marrow mesenchymal stem cells (BMSCs) are one of the most used cell sources in clinical research (Naji et al. 2019). Numerous studies have shown that BMSCs have great potential in the treatment of age-related diseases (Zhou et al. 2015; Bi et al. 2021; Jiang et al. 2021), including osteoporosis, skin diseases and diabetes. BMSCs are the common progenitors of osteoblasts and adipocytes. A mutual balance between the osteoblast and adipocyte differentiation of BMSCs is necessary for maintaining bone homeostasis and health (Devlin and Rosen 2015; Chen Q et al. 2016). PMOP is not only associated with accelerated bone resorption due to enhanced osteoclast activation caused by oestrogen deficiency (Sui et al. 2016), but also dysfunction caused by the senescence of BMSCs due to oestrogen deficiency. Senescent BMSCs exhibit decreased self-renewal capacity, reduced osteogenic capacity and preferential differentiation into lipogenic cells (Kim et al. 2012; Wu G et al. 2018; Wu W et al. 2020), which disrupt the dynamic osteoblast-lipogenic balance, leading to increased bone marrow obesity and progressive bone loss, further increasing bone fragility and fracture susceptibility. Our previous study revealed that with BMSC senescence, the capacity for osteogenic differentiation markedly increased, and adipogenic differentiation significantly decreased (Chen X et al. 2019). Thus, further investigations on the mechanism of BMSCs senescence are essential for the treatment of PMOP.

Autophagy is one of the features of aging that plays an important role in regulating cellular metabolism, function and homeostasis, and is defined as the lysosomal degradation pathway (Han et al. 2018). According to recent evidence, autophagy deficiency is associated with the impaired osteogenic capacity of senescent BMSCs in osteoporosis (Li et al. 2017; Chen XD et al. 2020). In addition, Yes-associated protein (YAP)-mediated mechanotransduction plays a key role in the differentiation of osteoblasts and adipocytes into BMSCs (Pan et al. 2017). YAP upregulates the levels of LC3II/LC3I, a key protein of autophagy in BMSCs, to promote osteogenic differentiation (Chen M et al. 2020). Overall, YAP is an important regulator of BMSC differentiation and is essential for maintaining a dynamic osteoblast-lipogenic balance to ensure a normal level of bone metabolism.

Liuwei Dihuang pill (LWDH) is a classic traditional Chinese medicinal formula consisting of six herbs: the roots of Rehmannia glutinosa (Gaertn.) DC. (Plantaginaceae) (Shu Dihuang), ripe fruits of Cornus officinalis Siebold & Zucc. (Cornaceae) (Shan Zhu Yu), the rhizome of Dioscorea opposita Thunb. (Dioscoreaceae) (Shan Yao), tubers of Alisma orientale (Sam.) Juz. (Alismataceae) (Ze Xie), the root bark of Paeonia × suffruticosa Andrews. (Paeoniaceae) (Mu Dan Pi), and the sclerotium of Poria cocos (Schw.) Wolf. (Polyporaceae) (Fu Ling) in an 8:4:4:3:3:3 ratio. LWDH was first recorded during the Song dynasty in ‘Xiaoer Yaozheng Zhijue’ (Hong-Rong 2012). LWDH has long been used to treat PMOP in China. The main active chemical components of LWDH are paeonol, alisol B23-acetate, moroniside, loganin and paeoniflorin. In recent years, paeonol has been demonstrated to induce autophagy and inhibit the apoptosis of vascular smooth muscle cells (VSMCs) by activating the class III PI3K/Beclin-1 signalling pathway (Liu Y et al. 2021). Alisol B 23-acetate prevents postmenopausal atherosclerosis and reduces lipid accumulation by activating oestrogen receptor alpha (ERα) (Chen Q et al. 2020). Moroniside promotes the osteogenic differentiation of MC3T3-E1 cells and inhibits the differentiation of osteoclasts, resulting in the inhibition of OVX-induced osteoporosis in mice (Lee et al. 2021). Loganin improves ovariectomized (OVX)-induced bone loss in mice by regulating the mRNA expression of differentiation markers, promoting osteoblast differentiation, and inhibiting osteoclast differentiation of primary monocytes (Lee et al. 2022). Paeoniflorin significantly reduces the number of osteoclasts and inhibits osteoclast bone erosion by altering the RANKL/RANK/OPG ratio and inflammatory cytokine profile (Xu et al. 2018).

To date, the mechanisms underlying the effects of LWDH on osteoporosis have not been systematically evaluated. In this study, we investigated whether LWDH counteracts OVX-induced bone loss by delaying the senescence of BMSCs. According to literature (Jia et al. 2018; Ma et al. 2018; Totaro et al. 2019) and our preliminary study, YAP may play an essential role in mediating autophagy to delay the senescence of BMSCs. These findings are vital to the prevention of OVX-induced bone loss by LWDH.

Materials and methods

Experimental drug and high-performance liquid chromatography analysis

LWDH (concentrated pill, product lot number: 21072045, State Drug Authentication Character: Z19993068) was purchased from Beijing Tongrentang Co., Ltd. (Chengdu, China). LWDH was analysed using high-performance liquid chromatography (HPLC) to determine the content of the drug components. The contents were as follows: paeoniflorin, 1.7 mg/g; alisol B 23-acetate, 0.31 mg/g; paeonol, 2.2 mg/g; morroniside, 1.9 mg/g; and loganin, 2.0 mg/g. This experimental report was provided by Shanghai (China) Huajian Testing Technology Co. (Shanghai, China).

Animals and treatment

A total of 48 Sprague-Dawley (SD) female rats (specific pathogen-free (SPF) grade; 235 ± 15 g; 8-weeks-old) were randomly divided into two groups: a SHAM group (SHAM, n = 12) and an OVX group (OVX, n = 36). OVX was performed after the administration of pentobarbital sodium anaesthesia. To prevent infection, each rat was administered penicillin three days after surgery, and OVX rats were randomly divided into three groups: OVX (OVX, n = 12), OVX + high dose LWDH (LWDH-H, n = 12, 1.6 g/kg/d) and OVX + low dose LWDH (LWDH-L, n = 12, 0.8 g/kg/d). The LWDH groups were administered 0.5 mL/100 g via gavage twice daily, according to the weight of the rats. The SHAM and OVX groups were administered the same amount of ultrapure water via gavage. The experimental dose of LWDH-H was equal to the corresponding clinically prescribed dose for a 70 kg human patient. The animals were housed under SPF conditions (temperature, 20 ± 1 °C; 12 h light/dark cycle, and 50 ± 5% humidity) with enough food and water. All animal procedures were performed in accordance with protocols approved by the Experimental Animal Ethics Committee of Chengdu University of Traditional Chinese Medicine (ethics approval number: 2019-04).

Bone mineral density and bone microarchitecture measurements

To obtain bones for the experiments, rats were euthanized for cervical dislocation at the end of the study according to the protocol approved by the Experimental Animal Ethics Committee. The soft tissues surrounding the femur were removed. Thereafter, the femur was fixed in 4% paraformaldehyde (PFA) for two days, stored in 70% ethanol at 4 °C, and air-dried at 21–25 °C room temperature for two days. The left femurs of all groups were scanned using micro-CT (PerkinElmer, Waltham, MA). The morphological parameters, including bone mineral density (BMD), trabecular number (Tb. N), trabecular thickness (Tb. Th), trabecular separation (Tb. Sp), bone volume fraction (BV/TV) and cortical thickness (Ct. Th) were analysed using the Bone Microarchitecture Analysis Add-on system software. The scanning parameters were as follows: current: 80 μA, voltage: 90 kV.

Isolation and culture of rat BMSCs

The complete medium comprised Dulbecco’s modified Eagle media: Nutrient Mixture F-12 (DMEM/F12), 10% foetal bovine serum (QuaCell, Zhongshan City, China) and 1% antibiotic solution (penicillin and streptomycin) (BOSTER, Wuhan, China). Primary BMSCs were flushed and collected from the bilateral femurs and tibias under aseptic conditions. The cells were then incubated in 5% CO₂ at 37 °C. The medium was changed after 24 h, and then every three days. After the adherent cells reached 80% confluence, the cells were digested and passaged.

CCK8 cell proliferation assay

Experimental BMSCs (2.5 × 10³ cells/well) were inoculated into 96-well plates and incubated overnight at 37 °C. Cell viability was measured using a Cell Counting Kit-8 (CCK8) (Absin, Shanghai, China) according to the manufacturer’s instructions. The optical density (OD) of each well was measured at 450 nm using a microplate reader (Thermo Fisher Scientific, Waltham, MA).

SA-β-gal staining

Senescence-associated β-galactosidase (SA-β-gal) cytochemical staining was performed to assess cellular senescence. BMSCs were inoculated at a density of 5 × 10⁴ cells/well into six-well plates containing BMSC medium and incubated in a cell culture incubator at 37 °C with 5% CO₂ for two days. This procedure was performed according to the manufacturer’s instructions (Bioss, Beijing, China, s0105).

Flow cytometry cell cycle analysis

BMSCs after 48 h of intervention were digested with trypsin and collected, resuspended once in phosphate-buffered saline (PBS), fixed overnight in 70% ethanol at 4 °C, washed once with pre-cooled PBS, and resuspended in 500 μL of diluted binding buffer. Before loading, 100 μL PI (Beyotime, C1062L, Shanghai, China) was added to the wells, which were then mixed. Finally, the samples were incubated for 5 min and detected using flow cytometry (BD FACSVerse™ flow cytometer, San Jose, CA) within 1 h.

Osteogenic differentiation

Osteogenic differentiation was induced by seeding 5 × 10⁴ BMSCs into six-well plates containing osteogenic induction medium (OIM, OriCell, Cyagen Biosciences, Santa Clara, CA). The plate was incubated at 37 °C with 5% CO₂ for seven days and the induction medium was changed according to the manufacturer’s instructions.

Adipogenic differentiation

Cyagen Biosciences’ OriCell™ SD Rat Mesenchymal Stem Cell Adipogenic Differentiation Medium (Guangzhou, China) was employed for this experiment. BMSCs were seeded in six-well plates at a density of 5 × 10⁴ cells/well. After addition to the lipogenic induction medium, the cells were incubated at 37 °C with 5% CO₂ for 14 days. The induction medium was changed according to the manufacturer’s instructions.

Alkaline phosphatase (ALP) staining and measurement of ALP activity

BMSCs cultured in OIM for four days were used for the ALP staining and activity assays. ALP staining was performed using a BCIP/NBT ALP Color Development Kit (Beyotime, Shanghai, China). Before staining, the BMSCs were washed with PBS and fixed with 4% PFA for 30 min. The cells were then washed thrice with PBS and stained according to the manufacturer’s instructions. The ALP activity in the cell fractions was measured using a microplate assay kit (Nanjing Jiancheng Biotechnology Co., Ltd., Nanjing, China) according to the manufacturer’s instructions, and the absorbance at 520 nm was measured using an enzyme marker.

Alizarin red staining (ARS)

The formation of calcium deposits was observed after 14 days of BMSC osteogenesis induction. The cells were evaluated using ARS staining. Briefly, the cells were fixed in 4% PFA for 20 min, washed three times with PBS, stained with Alizarin Red staining solution (Beyotime, Shanghai, China) for 5 min, and washed three times with PBS. Calcium deposition was desorbed with 10% cetylpyridine chloride (Aladdin, Shanghai, China) to quantify the degree of mineralization. Finally, the solution was collected, and the OD at 570 nm was measured.

Oil Red O staining

The lipogenic differentiation ability of BMSCs was assessed. Briefly, the lipogenic differentiation of BMSCs was induced for 14 days and lipid formation was observed. The cells were stained with Oil Red O according to the manufacturer’s protocol (Cyagen, Biosciences, Santa Clara, CA). After staining, photographs were taken and analysed using ImageJ software (Bethesda, MD).

RNA isolation and reverse transcription polymerase chain reaction

Total RNA was isolated from BMSCs using TRIzol^® reagent (252612, Thermo Fisher Scientific, Inc., Waltham, MA). RNA was reverse-transcribed to cDNA using HiScript III RT SuperMix (R323-01, Vazyme, Nanjing, China). PCR amplification of the cDNA products was performed using the ChamQ Universal SYBR qPCR Master Mix (Q711-02/03, Vazyme, Nanjing, China), according to the manufacturer’s instructions. The fold change in mRNA levels was calculated using the 2^–ΔΔC_t method. β-Actin mRNA was used as an internal control. The primer sequences are listed in Table 1.

Table 1. The primer sequences used in quantitative qRT-PCR.

Name	Forward primer	Reverse primer
p53	GACTTCTTGTAGATGGCCATGG	ATGGAGGATTCACAGTCGGATA
p21	GTCAGTTCCTTGTGGAGCCG	GAAGGTAGAGCTTGGGCAGG
Ocn	GCCATAGATGCGCTTGTAG	TAAGGTGGTGAATAGACTCCG
Osterix	AAGAAGCCATACACTGAC	CATTGGTGCTTGAGAAGG
Runx2	CTACGAAATGCCTCTGCTGTT	GCTTCTGTCTGTGCCTTCTTG
Adipoq	AATCCTGCCCAGTCATGAAG	CATCTCCTGGGTCACCCTTA
PPARγ	TCTCACAATGCCATCAGGTTTG	AGCTGGTCGATATCACTGGAG
Cebpα	GGGTTGTTGCTGTTGATGTTT	CGAAACGGAAAAGGTTCTCA
LC3II	ACTGCCGCCCTAAAGGTTAC	CGAGGTCCAACCCACAAAGA
p62	GGAACTGATGGAGTCGGATAAC	GTGGATGGGTCCACTTCTTT
Beclin1	CGGCTCCTATTCCATCAAAA	AACTGTGAGGACACCCAAGC
YAP	CCCAAGGCTTGACCCTCGT	CGTATTGCCTGCCGAAATAACT
β-actin	CACCCGCGAGTACAACCTTC	CCCATACCCACCATCACACC

Protein preparation and western blot (WB) analysis

Total cellular and nuclear proteins were extracted using the Nuclear and Cytoplasmic Extraction Reagent Kit (Beyotime, Beijing, China), according to the manufacturer’s instructions. Protein concentrations were determined using the bicinchoninic acid (BCA) protein assay reagent (Absin, Shanghai, China, abs9232). Protein samples were separated using sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE), transferred onto polyvinylidene fluoride (PVDF) membranes, blocked with 5% fat-free milk, and incubated with primary antibodies (specific for p53, p21, LC3A/B, p62, Beclin1, YAP) overnight at 4 °C, followed by horseradish peroxidase (HRP)-conjugated polyclonal IgG for 2 h at room temperature. The images were acquired using a Tanon 6100 multi-imaging system and the density of each band was quantified using ImageJ software (Bethesda, MD). Details of the primary antibodies are presented in Table 2.

Table 2. Antibodies for western blot, immunofluorescence staining and immunohistochemistry staining.

Antibody name	Diluted multiples	Antibody source	Company	Product number
p53	1:1000	Rabbit	CST	2524T
p21	1:1000	Rabbit	Abcam	Abl09199
LC3A/B	1:1000	Rabbit	CST	12741S
p62	1:1000	Rabbit	Abcam	Abl109012
Beclin 1	1:1000	Rabbit	CST	3495T
YAP	1:1000	Rabbit	CST	14074S
β-actin	1:2000	Rabbit	Beyotime	AF5003

Histological staining and immunohistochemistry (IHC)

The femurs were decalcified with 10% EDTA for four weeks and embedded in paraffin. Thereafter, 5 μm sagittal sections of the lower femur were prepared and stained with haematoxylin–eosin (HE) (C0105M, Beyotime, Beijing, China), a tartrate-resistant acid phosphatase (TRAP) Stain Kit (G1492, Solarbio, Beijing, China) and a Goldner trichrome stain kit (G3550, Solarbio, Beijing, China). All experiments were performed according to the manufacturer’s instructions. Images were captured using a pathology section sweeper (Zeiss, Oberkochen, Germany). Antigen repair was performed using citric acid at 98 °C for 5 min and incubated with primary antibody (specific for modified uridine triphosphate (UTP), Runx2 and YAP) at 4 °C overnight. For IHC, the cells were incubated with biotinylated secondary antibodies (Vector Laboratories, Burlingame, CA, 1:200, ZF0917) for 1 h at room temperature and ABC solution (Vector Laboratories, Burlingame, CA) for 30 min at room temperature. The expression of the target protein was visualized after the addition of 3,3′-diaminobenzidine (DAB) solution (Vector Laboratories, Burlingame, CA, ZF1024). Details of the primary antibodies are presented in Table 2.

Statistical analysis

Data are expressed as the mean ± SD of three or more independent experiments. The experimental data were calculated using GraphPad Prism 8.0.1 software. Differences between groups were evaluated using one-way analysis of variance (ANOVA). Statistical significance was set at p < 0.05.

Results

Component analysis of LWDH

We analysed the chemical composition of the LWDH. LWDH was analysed using HPLC to determine the content of the drug components (Figure 1(A–D)). The content of the components was: peony glucoside, 1.7 mg/g; alisol B 23-acetate, 0.31 mg/g; paeonol, 2.2 mg/g; morroniside, 1.9 mg/g; and loganin, 2.0 mg/g.

Figure 1. HPLC chromatogram of LWDH. A. Paeonol; B. Alisol B 23-acetate; C. Moroniside and Loganin. D. Paeoniflorin.

LWDH can counteract OVX-induced bone loss

Micro-CT scans provided the distal femur microstructure 3D images of each group. Compared to the SHAM group (Figure 2(A)), rats in the OVX group had reduced bone Tb. N, Tb. Th and Ct. Th; however, Tb. Sp was found to significantly increase (Figure 2(A,B)). Compared to the OVX group, BMD, BV/TV, Tb. N, Tb. Th and Ct. Th were significantly increased in the LWDH-H and LWDH-L groups, while Tb. Sp was found to decrease (Figure 2(A–G)). These results suggest that LWDH reduced OVX-induced bone loss.

Figure 2. LWDH attenuates the bone loss caused by OVX. (A) 3D reconstruction of representative images of the coronal and cross-sectional surfaces of the distal femur at 8 weeks after surgery in each group. The highlighted area of the Coronal row is region of interest (ROI). (B-G) Micro-CT analyses of bone mineral density (BMD), bone volume/total volume (BV/TV), trabecular number (Tb. N), trabecular thickness (Tb. Th), trabecular separation (Tb. Sp) and midshaft cortical thickness (Ct. Th). (n = 6, *p < 0.05 vs. Sham; ^#p < 0.05 vs. OVX by one-way ANOVA test.)

LWDH enhances osteogenesis and inhibits bone marrow lipogenesis in the femur of OVX rats

HE staining revealed that Tb. N was reduced, sparse, and discontinuous in the OVX group compared to the LWDH groups. Tb. N in the femoral marrow cavity was increased in the LWDH-H and LWDH-L groups (Figure 3(A)). Immunohistochemical staining revealed a significant increase in the number of Runx2 positive cells around the bone trabeculae, indicating an increase in the number of osteoblasts around the bone trabeculae (Figure 3(B,F)). Goldner trichomes showed reduced bone mineralization in the OVX group compared to the SHAM group, and elevated bone mineralization in the LWDH-H and LWDH-L groups. Mineralized bone was green and non-mineralized bone was red (Figure 3(C)). The number of osteoclasts (Oc/B. Pm) was found to increase in the OVX group and decrease in the LWDH-H and LWDH-L groups, which may be related to the antioxidant capacity and inhibitory ability of LWDH (Figure 3(D,G)) (Perry et al. 2014; Tseng et al. 2014; Mohamad et al. 2020).

Figure 3. LWDH enhances osteogenic capacity and inhibits lipogenic capacity in OVX rats. LWDH enhances osteogenic capacity and inhibits lipogenic capacity in OVX rats. (A) HE staining images of the sections from the distal femur. (B) Immunohistochemical staining images of the osteogenic factor Runx2. (C) Histological evaluation of the Goldner trichome staining in each group, green-stained mineralized bone (MB) and red-stained unmineralized bone (UB). (D) TRAP staining of femur sections. (E) Representative HE staining of femur sections exhibiting the marrow adipose tissue. (F) The quantification of Runx2 in rats from different groups. (G) Quantification of osteoblasts in different groups of rats. (H) Number of fat cells in the femur (n = 6, *p < 0.05 vs. Sham; ^#p < 0.05 vs. OVX by one-way ANOVA test).

Interestingly, the number and density of bone marrow adipose tissues (MATs) increased in the OVX group. The number and density of bone marrow adipocytes decreased in both the LWDH-H and LWDH-L groups compared to the OVX group (Figure 3(E,H)). This result may be related to BMSC dysfunction caused by ovarian removal, which affects BMSC lineage differentiation. In this study, LWDH ameliorated the impaired lineage assignment of BMSCs to osteoblast differentiation induced by OVX, and inhibited adipocyte differentiation.

LWDH delays the senescence of BMSCs in OVX rats

We evaluated the effect of LWDH on the BMSCs of OVX rats. We isolated BMSCs from SHAM, OVX, LWDH-H and LWDH-L rats and cultured them in a third-generation CCK8 assay. Based on our results, proliferation was significantly higher in the LWDH-H and LWDH-L groups than the OVX group (Figure 4(C)). The effect of LWDH on BMSCs in OVX rats was analysed using SA-β-gal staining. The OVX group had more senescence-positive cells than the SHAM group, which is consistent with previous findings (Figure 4(A)). However, fewer senescence-positive cells were found in the BMSCs of the LWDH-H and LWDH-L groups than of the OVX group (Figure 4(A,B)). The changes in the cell cycle in each group were determined using flow cytometry. The mean percentages of cells in the G0/G1 phase were 67.98% and 88.99% for the SHAM and OVX groups, respectively. The G0/G1 phase was blocked in the OVX group compared to the SHAM group. In addition, the mean percentages of cells in the G0/G1 phase were 72.30% and 77.03% after treatment with LWDH-H and LWDH-L, respectively; cells progressed from the G0/G1 phase and cell viability was restored (Figure 4(D)). The mRNA and protein levels of p53 and p21, which regulate the cell cycle via the senescence signalling pathway, were assessed. Based on our findings, the expression levels of p53 and p21 in the OVX group were significantly higher than those in the SHAM group; however, these levels decreased after treatment with LWDH-H and LWDH-L (Figure 4(E–I)). These results suggest that LWDH can delay the senescence of BMSCs in OVX rats.

Figure 4. LWDH delays the senescence of BMSCs in OVX rats. (A, B) Representative images of aging-related β-galactosidase staining in different groups of rat BMSCs and quantitative analysis of positive cells (n = 6). (C) CCK8 assay was used to evaluate cell viability (n = 6). (D) Cell cycle distribution (G0/G1, S, G2/M) was detected by flow cytometry (n = 3). (E, F) BMSCs of each group were subjected to qRT-PCR to detect the expression of p53 and p21 mRNA (n = 6). (G-I) BMSCs were lysed and prepared to measure the expression levels of p53 and p21 by WB (n = 3). *p < 0.05 vs. Sham; ^#p < 0.05 vs. OVX by one-way ANOVA test.

LWDH enhances the osteogenic capacity and reduces the lipogenic capacity of BMSCs

To observe the effect of LWDH on the differentiation ability of BMSCs, we conducted ALP staining and ALP activity to determine osteogenic differentiation and elucidate the effect of LWDH on the osteogenesis of BMSCs. ALP staining was enhanced and more intense in the LWDH-H and LWDH-L groups than in the OVX group (Figure 5(A,D)). ARS staining was used to assess the amount of calcium deposited. The number of calcium deposits was higher in the LWDH-H and LWDH-L groups than in the OVX group (Figure 5(B,E)). When BMSC lipogenic differentiation after the induction of lipogenic differentiation was assessed, the OVX group was found to have dense and full lipid droplets compared to the SHAM group based on Oil Red O staining. All lipid droplets decreased in size after treatment with LWDH. Therefore, LWDH could effectively inhibit the lipogenic differentiation of senescent BMSCs (Figure 5(C,F)).

Figure 5. LWDH enhances BMSCs osteogenic capacity and inhibits lipogenic capacity. (A) Osteogenic differentiation was assessed by ALP staining. (B) Representative images of Alizarin Red staining. (C) Representative images of oil red O staining. (D) ALP activity assays. (E) Calcium deposition was determined by measuring optical density. (F) quantitative analysis of oil red O staining. (G-I) qRT-PCR analyses of the expression of Runx2, Osterix and Ocn under osteogenic condition. (J-L) qRT-PCR analyses of the expression of Adipoq, PPARγ and Cebpα under adipogenic condition (n = 6). *p < 0.05 vs. Sham; ^#p < 0.05 vs. OVX by one-way ANOVA test.

The expression levels of the osteogenic markers were determined using qRT-PCR. After four days of osteogenic differentiation induction, the mRNA expression levels of runt-related transcription factor 2 (Runx2), a zinc finger transcription factor (Osterix) and osteocalcin (Ocn) in the LWDH-H and LWDH-L groups were higher than those in the OVX group (Figure 5(G–I)). The expression levels of adipogenic factors were detected using qRT-PCR. After seven days of adipogenic differentiation induction, the expression levels of adiponectin (Adipoq), peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer-binding protein alpha (Cebpα) mRNA in the LWDH-H and LWDH-L groups were downregulated compared with those in the OVX group (Figure 5(J–L)). These results suggest that LWDH enhances the osteogenic capacity and reduces the lipogenic capacity of BMSCs. In addition, the ability of LWDH to reduce the accumulation of bone MAT and delay bone loss was demonstrated.

LWDH enhances YAP and autophagy of BMSCs in OVX rats

To demonstrate whether LWDH can enhance the autophagy of BMSCs in OVX rats to retard their senescence, we examined the expression levels of the autophagy-related mRNA and protein, LC3II/LC3I, p62 and Beclin1, using qRT-PCR and WB. The expression levels of LC3II/LC3I and Beclin1 were found to decrease in the OVX group, while that of p62 significantly increased compared with the levels in the SHAM group (Figure 6(A–F,H)). After treatment with LWDH, the mRNA and protein expression levels of LC3II/LC3I and Beclin1 were increased in the LWDH-H and LWDH-L groups, while that of p62 decreased compared to those in the OVX group (Figure 6(A–F,H)), indicating that LWDH can enhance the autophagy level of BMSCs in OVX rats. We examined the mRNA and protein expression levels of YAP, which decreased in the OVX group compared to the SHAM group and increased in the LWDH groups (Figure 6(G,I,J)). The number of distal femoral sections was observed using IHC. The number of YAP-positive cells increased in the LWDH groups compared with the OVX group (Figure 6(K,L)). These results indicate that LWDH could increase YAP and enhance the autophagy level of BMSCs in OVX rats, delaying their senescence.

Figure 6. LWDH can maintain BMSCs autophagy levels in OVX rats. (A-C) BMSCs of each group were subjected to qRT-PCR to detect the expression of LC3II, p62 and Beclin1 mRNA (n = 6). (D-F, H) The expression and quantitative analysis of LC3II, p62 and Beclin1 at the protein level in each group were detected by WB (n = 3). (G, I) The expression and quantitative analysis of YAP at the protein level in each group were detected by WB (n = 3). (J) BMSCs of each group were subjected to qRT-PCR to detect the expression of YAP mRNA (n = 6). (K, L) Quantitative and statistical analysis of immunohistochemical (IHC) staining of YAP-positive cells in distal femoral tissues (n = 6). *p < 0.05 vs. Sham; ^#p < 0.05 vs. OVX by one-way ANOVA test.

Discussion

LWDH is an herbal formula widely used in clinical practice to treat PMOP. Previous studies have shown that LWDH enhances osteoblast proliferation, increases ALP activity, and stimulates bone formation (Xia et al. 2014). LWDH can also prolong the lifespan of Caenorhabditis elegans and aged mice, and prevent premature neuronal apoptosis through antioxidants (Tseng et al. 2014). Thus, LWDH could be used as a new anti-aging herbal remedy to treat osteoporosis. Persistent cell-cycle arrest is a major feature of cellular senescence. CDKN1A encodes the cell cycle protein-dependent kinase inhibitor, p21/WAF1/CIP1/CDKN1A. p21 was identified as the first downstream target of p53. The induction of p21 by p53 leads to cell cycle arrest in the G0/G1 phase, eventually leading to senescence-associated growth arrest (el-Deiry et al. 1993, 1994). Several studies have shown that BMSCs from OVX rats or mice exhibit enhanced senescence (Wu G et al. 2018; Wu W et al. 2020), with upregulated levels of the associated proteins, p53 and p21 CIP1/WAF1, and increased β-galactosidase-stained positive cells (Wu G et al. 2018; Wu W et al. 2020). The differentiation characteristics of senescent BMSCs show reduced osteogenic and enhanced lipogenic capacity. In general, p53/p21CIP1/WAF1 combined with SA-β-gal can be used as a standard for detecting senescent MSCs. In our study, the proliferative capacity of BMSCs in the OVX group was significantly lower than that in the SHAM group, and the cell cycle was blocked in the G0/G1 phase. Compared to the LWDH groups, the proliferative capacity of BMSCs was restored in the OVX group after removal of the cell cycle block; the number of β-galactosidase-positive cells also decreased. The p53 and p21 mRNA and protein levels in the OVX group were higher than those in the SHAM group, indicating that OVX-BMSCs were in a senescent state; this trend was consistent with that of previous studies. However, both senescence-related mRNA and protein levels decreased in the LWDH group compared to the OVX group. This result suggests that LWDH can alleviate the senescence of BMSCs, thereby inhibiting p53 and p21 mRNA levels and protein production. Overall, LWDH plays a role in delaying BMSC senescence and bone loss.

According to the literature, the main role of autophagy is to remove damaged molecular material from autophagosomes to the cell, which is then degraded by lysosomes to maintain cellular function. This biological process is essential for the prevention of aging (García-Prat et al. 2016). Recent evidence has revealed the fundamental role of autophagy in the fate and maintenance of bone homeostasis in MSCs (Chen XD et al. 2020). Autophagy is an immediate cytoprotective mechanism in MSCs against stress (Salemi et al. 2012). Autophagy dysfunction impairs the function and stemness of MSCs (García-Prat et al. 2016; Chen XD et al. 2020). According to several studies, p62 protein levels are upregulated and LC3 II/LC3I and Beclin1 protein levels are reduced during BMSCs senescence, resulting in the accumulation of intracellular reactive oxygen species (ROS) and damage to deoxyribonucleic acid (DNA) and the mitochondria, ultimately leading to cellular dysfunction. These factors induce extensive cellular senescence and degenerative bone disease (Ma et al. 2018; Liu F et al. 2021). In this experiment, the upregulation of p62 protein levels and the decrease in LC3 II/LC3I and Beclin1 protein levels indicated a decrease in autophagy levels in OVX-BMSCs, which is consistent with a previous trend. Treatment with LWDH resulted in a significant decrease in p62 protein levels and restored LC3 II/LC3I and Beclin1 protein levels to near-normal levels. Therefore, LWDH restores autophagy levels in OVX-BMSCs, which is necessary to slow the senescence of BMSCs and maintain differentiation homeostasis. LWDH is also an important factor in attenuating bone loss due to ovariectomy.

YAP acts as an upstream regulator of autophagy (Wang et al. 2020). YAP controls the autophagic flux by regulating the degradation of autophagosomes and is essential for the maturation of autophagosomes into autolysosomes (Pavel et al. 2018; Totaro et al. 2019). YAP depletion in human periodontal stem cells has been demonstrated to promote senescence by stimulating p53/p21 and lysosomal activity (Jia et al. 2018). In the present study, both YAP mRNA and protein levels, and cellular immunofluorescence staining were decreased in the BMSCs of OVX rats, with an opposite trend observed after treatment with LWDH. Thus, the above data suggest that LWDH delays ovariectomy-induced bone loss by activating YAP in OVX-BMSCs, maintaining autophagy levels, delaying BMSC senescence, restoring osteogenic capacity and reducing adipocyte production.

In this study, the mRNA and protein levels of YAP were downregulated in the OVX group compared to the SHAM group. Compared to the OVX group, the autophagy-related mRNA and protein levels increased as the mRNA and protein levels of YAP increased after LWDH treatment. Therefore, LWDH could regulate the autophagy level of BMSCs by activating YAP. In addition, the mRNA and protein expression levels of senescence-related p53 and p21 were decreased. Overall, LWDH was found to maintain autophagy by activating YAP to delay the senescence of BMSCs and improve bone remodelling. These data highlight the important role of YAP in the treatment of LWDH-induced ovariectomy-induced bone loss, mainly through YAP-mediated cellular autophagy. Although our results confirm that LWDH may be a promising drug for the treatment of osteoporosis, to further investigate the potential role of LWDH in regulating YAP in PMOP, we will knock out or knockdown the YAP gene in animals to evaluate the direct or indirect effect of LWDH on YAP. Such investigations will enable us to gain more effective and scientific clarity on the relationship between the drug and molecule.

Conclusions

LWDH was found to improve OVX-induced osteoporosis, delay the senescence of BMSCs, promote osteogenic capacity, and inhibit lipogenic capacity. To our knowledge, this study is the first to demonstrate that YAP-induced alterations in autophagy are key factors for LWDH to slow the senescence of BMSCs in OVX. Herein, the molecular mechanism of LWDH in the treatment of osteoporosis was revealed and YAP was demonstrated to be a potential target for the treatment of osteoporosis. Thus, LWDH activation of YAP-mediated autophagy to slow BMSC senescence may be a new therapeutic approach for the treatment of osteoporosis.

Author contributions

Bing Liang, Xiongbin Chen and Min Li conceived the study, finished doing all the experiments, compiled and analysed the data, and wrote the manuscript. Xia Yang provides language support for the manuscript. Lingling Zhang, Liangqin Shi, Yanju Gong, Yuanyuan Gong and Huan Xu participated in the design of this study, performed data collection and analysis, manuscript preparation and revision. Xiao Wu, Zhong Jin, Yanru Wang and Luwei Liu contributed to animal experiments, data collection, analysis and manuscript preparation. Xiaohong Yi, Lushuang Xie, Hua Zhong, Chongyang Shen and Yong Wang assisted in the cell experiments and provided guidance on experimental methods and techniques. Lan Yang designed and conceived the study, critically revised the manuscript and finally reviewed it. All authors reviewed the manuscript.

Acknowledgements

We are grateful for the technical support provided by the State Key Laboratory of Southwestern Chinese Medicine Resources (Pharmacy School, Chengdu University of Traditional Chinese Medicine, Chengdu 611130, China).

Disclosure statement

No potential conflict of interest was reported by the author(s).

Data availability statement

The data that support the findings of this study are available from the corresponding author Lan Yang upon reasonable request.

Additional information

Funding

This study was supported by grants from the Scientific Research Foundation of Chengdu University of Traditional Chinese Medicine (Grant no. JSZX2018004, XCZX2022001), Xinglin Scholar Research Promotion Project of Chengdu University of TCM (Grant no. QNXZ2020002), Scientific Research Start-up Fund (2021) for Introduced Talents (Grant no. 030041251/030) and The National Natural Science Foundation of China (Grant no. 82174226), Open Project of Sichuan Provincial Key Laboratory for Human Disease Gene Study (Grant no. 2023kflx003).