NOV/CCN3 Induces Adhesion of Muscle Skeletal Cells and Cooperates with FGF2 and IGF-1 to Promote Proliferation and Survival

Abstract

During mammalian development, expression of the Nephroblastoma overexpressed gene (NOV/CCN3) is tightly regulated in skeletal muscles. Ex vivo, ectopic expression of NOV blocks myogenic differentiation. NOV also supports endothelial cell adhesion and angiogenesis through interactions with integrins. Integrins play fundamental roles during myogenesis. In this study, we show that NOV mediates adhesion and spreading of myoblasts. Myoblasts adhesion to NOV does not require proteoglycans and is dependent on integrin β1, whereas spreading involves another RGD-sensitive integrin. The C-Terminal part of NOV as well as full-length is able to support adhesion of myoblasts; in addition, both increase focal-adhesion kinase (FAK) phosphorylation. Furthermore, NOV is an adhesive substrate that, combined with FGF2 or IGF-1, promotes cell specific proliferation and survival, respectively, in a better way than fibronectin. Taken together, these results identify NOV as an adhesion substrate for myoblasts which, in concert with growth factors, could play a role in the physiology of muscle cells.

Keywords:

• NOV
• CCN family
• adhesion
• integrins
• FAK
• FGF2
• IGF-1
• muscle skeletal cells

INTRODUCTION

The NOV/CCN3 gene is a member of the CCN family [CYR61/CCN1 [1], CTGF/CCN2 [2] and NOV [3, 4]] which also includes WISP1/CCN4 [5, 6], WISP 2/CCN5 [6, 7, 8] and WISP3/CCN6 [6]. It encodes a secreted cysteine-rich multimodular glycoprotein [9] which shares strong structural similarities with other CCN proteins [10, 11]. These proteins are involved in the regulation of cell proliferation, chemotaxis, angiogenesis, adhesion, and the assembly of the extracellular matrix [for a review see [11]]. The recent targeted disruption of CTGF and CYR61, the most extensively studied members of this family, revealed defects in skeletal development [12] and in vasculogenesis [13], respectively. These findings indicate that despite their strong homologies, they serve essential and nonredundant functions. The CCN proteins have also been involved in normal and in pathological processes such as wound healing, fibrotic disorders and tumors [11].

NOV, like the other CCN proteins, is composed of four distinct structural domains [10] with homology to insulin-like growth factor binding protein (IGFBP-domain I), von Willebrand factor type C repeat, chordin (VWC/CH-domain II), and thrombospondin type 1 repeat (TSP1-domain III) and a C-Terminal domain (CT-domain IV) with a putative cystine-knot structure. The functions of these domains have only recently started to be explored. The presence of the IGFBP motif is not sufficient to confer to CTGF and to NOV the ability to bind IGFs with physiological relevance [14, 15]. The VWC/CH domain of CTGF binds to TGFβ 1 and BMP2 leading to modulation of their signaling pathways [16]. The TSP1 domain of CTGF binds to VEGF and inhibits its angiogenic activity [17], while a sequence of CYR61 within this domain is sufficient to support α 6β 1-dependent fibroblasts adhesion [18]. The CT domain which contains heparin-binding sequences confers to CCN proteins the ability to bind to the extracellular matrix. CCN proteins are thus termed “matricellular proteins” [19].

The biological roles of NOV and its domains are poorly understood. Studies on its expression pattern during mammalian development suggest that NOV may play an autocrine/paracrine role in the development and/or differentiation of several tissues, including the adrenal cortex [20], cartilage [21], the central nervous system [22], visceral muscles and particularly skeletal muscles [23]. In skeletal muscle, NOV gene expression is tightly regulated during mouse embryo development. NOV RNAs were first detected after day 10, in the lateral dermomyotome along the entire rostrocaudal axis. Later, at day 16.5, NOV was detected both in hypaxial muscles derived from nonmigratory precursors cells and in shoulder and hip muscles, which arise from migratory precursors. In addition, NOV RNAs were enriched at cell-matrix junction sites such as, the myotendinous junctions in the limbs and the myofascial junctions in epaxial muscles [23]. In Wilms' tumors expressing muscular heterotypic differentiation NOV expression has been correlated with tumor differentiation [4, 9, 24]. Ex vivo, ectopic expression of NOV blocks muscular differentiation in both a mouse and a human myoblast model [[25]; our unpublished results].

There are also several lines of evidence indicating that NOV is involved in cell adhesion. Via its CT-domain, NOV binds to fibulin 1C, an extracellular matrix protein [26, 27]. Recombinant NOV can promote the adhesion of vascular smooth muscle cells (VSMC) ex vivo and changes in NOV expression occur following injury to the arterial walls [28]. More recently, NOV was reported to support endothelial cell adhesion through interactions with integrin cell surface receptors and to promote angiogenesis [28, 29].

Integrins are expressed and developmentally regulated in vertebral skeletal muscle fibers [30]. In ex vivo experiments integrins have been implicated in both muscle cell proliferation and differentiation [31, 32, 33]. Genetic studies have shown that in integrin α 7 deficient mice, muscles degenerate due to the detachment of myofibrils from the myotendinous junctions at the muscle ends [34]. Furthermore, β 1 integrin is involved in myoblasts fusion, the assembly of the muscle fiber cytoskeleton and the maintenance of myotendinous junction [35].

We have investigated whether NOV recombinant protein was an adhesive molecule for muscular cells via integrin receptors. We show, that adhesion to NOV of myoblasts involves integrins and is mediated by the C-Terminal part of the molecule which leads to the activation of FAK. We also report that NOV as an adhesive protein is able to cooperate in a cell-specific manner with FGF2 and IGF-1 to promote myoblasts proliferation and survival respectively. Taken together, these data suggest that NOV could play a role during myogenic development.

MATERIALS AND METHODS

Materials

Mouse C2C12 myoblast cell line [36] was obtained from Dr. D. Montarras (Pasteur Institute, Paris). Human RD rhabdomyosarcoma cell line was purchased from Flow laboratories (Rockville, MD). Mouse ATDC5 prechondrocytes were a generous gift of Dr. T. Nakamura (NIH, Bethesda). CG4 were kindly provided by Dr. B. Zalc (Salpetriêre Hospital, Paris). G59 were previously described [37].

DMEM and fœtal calf serum (FCS) were purchased from Invitrogen (France). Bovine serum albumin (Euromedex, Mundolsheim, France), type 1 collagen, laminin, human plasma fibronectin, echistatin, and peptides GRGDS, SDGRG, Poly-L-lysine, Heparin, Heparan sulfates, Chondroïtin sulfates, and Phalloidin-FITC conjugate were obtained from Sigma-Aldrich (St.Louis, MO). The anti-NOV K19M rabbit polyclonal antibody, directed against the K19M peptide (339–357 amino-acids) has been previously described [9]. Rabbit polyclonal anti-PARP and mAbs against phosphotyrosine (clone pY-99) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), mAbs against p125 FAK from BD Biosciences Europe (Erembodegem, Belgium), and affinity purified rabbit polyclonal anti-MAPK 1/2 from Upstate (Charlottesville, VA). Rat anti-mouse monoclonal anti-integrin β1 antibody and blocking goat anti-integrin α 5β1 (clone AB 1950) were purchased from Chemicon, Inc (Temecula, CA). Recombinant PDGF BB and IGF-1 were purchased from Prepotech and FGF2 from R&D systems Europe (Lille, France).

Cell Culture

C2C12 cells were routinely propagated in Dulbecco's modified Eagle's medium (DMEM), supplemented with 20% FCS. RD cells were maintained in DMEM supplemented with 10% FCS.

Proteins, and NOV Antibody

Cloning into the baculovirus expression vector pDB-s-H6 [38] and production and purification of full-length human NOV (NOVH) protein (AA 33-357) and of the C-Terminal region of NOV (AA188-357) were previously described [27]. The N-Terminal region of NOV (AA 33-187) was produced following amplification of a PCR fragment using 5′ ATTAATCGAAggccgtgggggccAGCGCT GCCCTCCCCAG 3′ and GCCGctcgagTCAT TATGCAAGGGTAAGGCCTCCCAG 3′ oligonucleotides as sense and antisense, respectively, and subcloning into pDB-s-H6 expression vector. Plasmids, selected by restriction mapping and nucleotide sequencing, were subsequently cotransfected in Sf9 cells together with baculoviral DNA yielding the corresponding NOV recombinant baculoviruses which were clonally purified as described [39]. N-Ter Protein production and purification were performed as previously described [27]. Purity of recombinant NOV proteins was assessed by SDS-PAGE and silver staining. A mass spectrometry was further performed (Innova Proteomics, Rennes, France) on NOV recombinant purified protein using an Ultraflex MALDI Mass Spectrometer (Bruker Daltonics, Billerica, MA). Spectra were analyzed using MASCOT software [40]. Results revealed that no adhesive proteins were contaminating NOV preparations.

To detect the N-Ter region of NOV we used a polyclonal antibody raised in rabbit against the whole NOV protein expressed as glutatione S-transferase (GST) fusion protein. A DNA fragment was generated by PCR using primer sets 5′ GACTG GATCC GTCGCTGCGACTCAGCGCTGC 3′ and 5′CTGCGTCGACTTACATTTTCCCTCTGGT 3′ (encoding aa 29-357). To facilitate cloning the forward primers start with a Bam H1 site and the reverse primer with a Sal1 site. The resulting cDNA fragment was cloned directionally into PGEX-4T vector (Amersham Pharmacia Biotech, Inc, Piscataway, NJ) and confirmed by sequence analysis. The GST-fusion protein was purified on a glutathione-S Sepharose column and used as antigen. Antisera were produced according to standard protocols. Antisera were purified by passage through a GST column to remove antibodies against GST.

Cell Adhesion Assay

Microtiter plates (96-wells, Maxisorp, Nunc) were coated with test proteins diluted in PBS at 200 μ l per well and incubated at 4°C overnight. Wells were rinsed with PBS and blocked with 1% BSA at room temperature for 1 hr. Cells were harvested by trypsinization. The cells were washed in DMEM containing 10% FCS, centrifuged and resuspended at 3 × 10⁵ cells/ml in serum-free DMEM. Two hundred microliters of each suspension were added to test wells. After incubation at 37°C for 90 min, nonadherent cells were rinsed off with PBS and adhered cells were fixed and stained at room temperature for 10 min with a solution containing 0,25 % crystal Violet and 20% methanol. Adhesion was quantified by measuring the absorbance of the dye, after release with 1% SDS, at 570 nm using a Tecan Elisa plate reader. Either EDTA, Mg^{+ +}, RGD peptides, or blocking anti-integrin antibody were added for 30 min at room temperature to the suspended cells prior to plating.

DNA Synthesis and Cell Survival

C2C12 were seeded into 96-well plates at a density of 6 × 10⁴ cells per well for 2 hrs in serum-free DMEM medium. Following washing with DMEM, adherent cells were further incubated for 24 hrs with serum-free DMEM or supplemented with PDGF BB (25 ng/ml), FGF2 (5 ng/ml) or IGF-1 (100 ng/ml). Twenty hours after stimulation, [3H]-thymidine (25 Ci/mmol, Amersham Pharmacia) was added to 2.5 μCi/ml and after 4 hrs, cells were washed with PBS. TCA5% was added to each well for 15 min at 4°C. Total incorporated [3H]-thymidine was counted after complete cell dissolution in 0.1 M NaOH. Cell survival was also assessed under these experimental conditions by adding 500 μ l/ml of methylthiazotetrazolium (MTT) and the wells were further incubated at 37°C for 3 hrs. Formazan precipitates were then dissolved by addition of 1 volume of isopropanol in 0.05 N HCl. The absorbance was measured at 570 and 690 nm.

Caspase 3 and 7 activities assays were performed using Caspase–Glo^TM 3/7 luminescent kit (Promega, Madison). In this test, C2C12 plated as mentioned above for 2 hrs were further incubated for 6 hrs in the presence or absence of IGF-1 (100 ng/ml). Luminescence was quantified using a Tecan Elisa plate reader.

Fluorescence Microscopy

C2C12 cells were seeded at a density of 2 × 10⁵cells/ml in 30 mm Petri dishes coated with different test proteins at 10 μ g/ml and incubated for 2 hrs at 37°C. The actin cytoskeleton of adherent cells was visualized with fluorescein-conjugated phalloidin (Sigma) following the manufacturer's instructions. Detection of phosphotyrosine proteins was performed following fixation with 3% paraformaldheyde for 10 min, permeabilization with 0.5% Triton X100 in PBS for 5 min, saturation with 1% BSA, addition of 3% normal donkey serum in PBS for 30 min, incubation with Mab anti-phosphotyrosine (anti-pTYR) (PY99) diluted to 1/500 for 1 hr at room temperature, washings four times with PBS, and incubation with donkey anti-mouse IgG conjugated with Texas Red. The cells were observed using a fluorescence microscope (Olympus BX612) and images were taken using a CDD camera.

Immunoprecipitation and Western Blotting

Cells were seeded at a density of 6 × 10⁵ cells/ml in 30 mm Petri dishes coated with different test proteins at 10 μg/ml and incubated for 2 hrs at 37°C. They were then lysed in NP 40-lysis buffer (20 mM Tris-HCl, pH7.4 containing 137 mM NaCl, 10 mM EDTA, 2 mM Na₃VO₄, 10 mM sodium pyrophosphate, 100 mM sodium fluoride, and 1% Protease inhibitor cocktail (Sigma-Aldrich), 1% NP 40) for 25 min at 4°C. Lysates were clarified by centrifugation at 12,000g for 10 min at 4°C. The protein concentration was determined by using an improved Lowry assay (Biorad, Marnes la Coquette, France). Equal amounts of proteins were incubated with anti-FAK antibody (1 μg per 100 μg of proteins) for 2 hrs at 4°C. Immune complexes were precipitated by incubating the samples with 25 μl of Protein G-agarose (Sigma) for 2 hrs at 4°C. Protein G beads were washed four times with ice-cold NP 40-lysis buffer and bound proteins were solubilized in SDS-PAGE sample buffer. Protein samples were separated on 8% SDS-PAGE gels.

For western blot analysis, the proteins were electrophoretically transferred onto polyvinylidene difluoride (PVDF) membranes (Hybond P Pharmacia-Amersham, Orsay, France). The membranes were washed in methanol for 10 seconds and dried, before being incubated for 1 hr at room temperature in 5% nonfat dried milk in 0.05% Tween 20 in PBS with the antibodies. After washing in 0.05% Tween 20 in PBS, the bound antibodies were detected with the anti-rabbit IgG horseradish peroxidase conjugate. Peroxidase activity was detected by ECL (Amersham, Pharmacia, Biotech, Orsay, France) according to the manufacturer's instructions. To determine total FAK in each sample, blots were stripped (62.5 mM Tris-HCl, pH 6.8 containing; 2% SDS; 100 mM β-mercaptoethanol) at 55°C and reprobed with mAb against FAK.

Statistical Analysis

Data were analyzed using Instat software (Graphpad Software Inc., San Diego, CA) with the Mann-Whitney's U test for unpaired data. All P values are from two-sided tests, and only P value less than 0.05 was considered statistically significant.

RESULTS

NOV Mediates Adhesion of Muscle Cells

We established that compared to BSA, NOV mediates C2C12 muscle cells adhesion in a dose-dependent manner (Figure 1A, B). Other cell types also adhere to NOV substrates. The rhabdomyosarcoma cell line RD (Figure 1C), primary chondrocytes, and the ATDC5 chondrogenic cell line derived from an embryonic carcinoma also adhere to NOV (data not shown). In contrast, NOV could not mediate adhesion of the oligodendroglial precursor cell line CG4 or of the G59 glioblastoma cells (data not shown). The adhesive properties of NOV and of collagen I (COL I) and laminin (LN), two well-characterized adhesive proteins were then compared. We observed that adhesion of C2C12 myoblasts cells onto NOV, and collagen I was comparable (Figure 1B) and that NOV was a better adhesion protein than collagen I and laminin for RD cells (Figure 1C). Fibronectin (FN) was the best substrate for all the cell lines tested and similar to the unspecific Poly-L-Lysine used as a maximal control for adhesion. (Figure 1B, C). Similar results were obtained with at least five different preparations of NOV. In addition, mass spectrometry analysis of NOV purified preparations indicate the absence of cell adhesion protein contaminants. These data confirmed that NOV is an adhesive protein and further showed that this adhesive property is cell-specific.

Figure 1 NOV mediates myoblasts. (A) C2C12 myoblasts were plated in microtiter wells coated with increasing concentrations of NOV or with BSA as a control. Adhesion was quantified as described in Materials and Methods. (B, C) The indicated cells were plated in microtiter wells coated with NOV (6 μg/ml), BSA (6 μg/ml), Poly-L lysine (PL) (100 μg/ml), or with 6 μg/ml Collagen I (COL I), Fibronectin (FN), Laminin (LN). Data are presented as mean ±SEM from triplicate determinations and are representative of at least three separate experiments performed with different preparations of NOV and giving similar results. Substrates giving adhesion levels significantly different from BSA are indicated by stars (*,P < 0.05) and from NOV by triangles (Δ: P < 0.05).

Integrins, but not Proteoglycans, are Involved in C2C12 Cell Adhesion and Spreading on NOV

Cell surface proteoglycans contain heparan sulfate and chondroitin sulfates [4]. Since we have previously reported that NOV is a heparin-binding protein [9] and as it has been suggested that heparan sulfate proteoglycans could be involved in adhesion of endothelial cells to NOV [29], we investigated whether heparin or chondroitin sulfate A, B, and C could interfere with NOV-mediated C2C12 cell adhesion. As shown in Figure 2A, incubation of the myoblast cells in the presence of 10 or 100 μ g/ml of heparin, chondroitin sulfate A, B, or C did not significantly impair C2C12 cell adhesion to NOV, indicating that different mechanisms could be responsible for muscular and endothelial cells adhesion to NOV. Integrins mediate the adhesion of endothelial cells to NOV [29, 42], whereas adhesion of VSCM to NOV is integrin-independent [28]. We next investigated whether C2C12 cell-surface integrins were involved in cell adhesion to NOV. Cells were preincubated with 2.5 mM EDTA in the presence or absence of divalent cations (Mg⁺⁺) before plating. The inhibitory effect of EDTA on C2C12 cell adhesion to NOV (57%), fibronectin (86%), and collagen I (99%) was restored by addition of 5 mM Mg⁺⁺ (Figure 2B). These results are thus consistent with a possible involvement of integrins in the adhesion of C2C12 cells to NOV. To further investigate the likely role of integrins, we took advantage of the fact that many integrin-ligand interactions are RGD-dependent and can be inhibited by either RGD-containing peptides or by echistatin, a RGD containing disintegrin, which is 550X more potent than short RGD peptides [43]. Incubation of C2C12 cells with the GRGDS peptide (50 μ M) resulted in a 60% of inhibition in collagen I-mediated adhesion in agreement with previous results [44], whereas no significant inhibition of C2C12 cell-adhesion could be detected when plated on NOV, fibronectin, or Poly-L-lysine. However, both GRGDS (50 μ M) and echistatin (10^{− 7}M) did affect specifically the spreading of C2C12 cells on NOV, whereas the inverted SDGRG (50 μ M) peptide used as a control for specificity had no effect (Figure 2D). At these concentrations none of these compounds induce a morphological change of C2C12 cells seeded on fibronectin or Poly-L-lysine coated plates (data not shown). At higher concentrations of echistatin (10^{− 6}M) a 40% inhibition of adhesion was observed on NOV and on fibronectin and, ∼90% inhibition on collagen I (data not shown). At this concentration a weak inhibition (∼15%) was also observed on Poly-L-lysine.

Figure 2 Integrins, but not glycosaminoglycans, are involved in C2C12 cell adhesion and spreading on NOV. (A) C2C12 myoblasts were incubated or not (Ct) in suspension with heparin (Hp), chondroitin sulfate (A) CA, (B) CB or (C) CC (10 or 100 μg/ml) for 30 min prior to plating on microtiter wells coated with NOV (6 μg/ml). (B) C2C12 myoblasts were preincubated or not (Ct) either with EDTA (2.5 mM) alone or in combination with Mg⁺⁺ (5 mM) as indicated. (C) Cells were incubated or not (Ct) with GRGDS peptide (50 μM) prior to plating on microtiter wells coated with NOV, COL I, FN, PL or BSA. (D) Cells were incubated or not with GRGDS or GDGRS peptides (50 μM) or echistatin (10 ⁻⁷M) prior to plating on microtiter wells coated with NOV. Following fixation and staining, cells were photographed. Notice the spread morphology of C2C12 cells plated on NOV or pretreated with GRGDS peptide opposed to the round morphology after treatment with GRGDS or echistatin. (E) Western blot analysis of β1 integrin expressed in C2C12 cells plated on NOV, COL I or PL for 90 min (left panel). C2C12 myoblasts were preincubated or not (Ct) for 30 min with 50 μg/ml mAb against integrin β1 (AB1950) prior to plating on microtiter wells coated with NOV, COL I or PL (right panel). Adhesion in A/B/C, and D was evaluated and presented as in Figure 1. (*: P < 0.05).

Since the β1 integrin subunit participates in adhesion of endothelial cells to NOV [29, 42] and since this subunit has been reported to play an important role in the physiology of muscle cells [35], we assessed its role in C2C12 cell adhesion to NOV. We first checked by western immunoblotting (Figure 2F) that β1 integrin was expressed by C2C12 cells plated on collagen I, Poly-L-lysine, and NOV. On each of these substrates, the premature (110 kDa) and the mature (130 kDa) forms of β1 integrin [45] could be detected. We then used a Mab specific for blocking integrin β1 (AB1950). This antibody partially blocked C2C12 cell adhesion to NOV (47%) and to collagen I (74%), whereas it induced a slight increase on C2C12 adhesion to Poly-L-lysine (20%). Thus, adhesion to NOV and Poly-L-lysine of C2C12 cells involve different mechanisms. Taken together, these data indicate that RGD-sensitive integrins are involved in the spreading of C2C12 cells on NOV and that the β1 subunit of integrins is important for their adhesion on this substrate.

Adhesion of C2C12 Cells to NOV is Mediated by Its Carboxyl-Terminal Domain and Results in Cytoskeleton Reorganization, FAK Activation, and Increased DNA Synthesis

In order to define the NOV structural domains that mediate C2C12 adhesion, we expressed in insect cells via a baculovirus vector, in addition to the full-length NOV protein, the N-Terminal (domains I and II), and the C-Terminal (domains III and IV) regions of NOV. The amino-terminal ends of each recombinant polypeptide are endowed with a secretory signal and polyhistidine tag. The expressed polypeptides were purified on a Nickel-nitrilotriacetic acid (Ni-NTA)-agarose column as previously described [27]. Western blotting showed (Figure 3A) that the full length as the C-Terminal fragment (C-Ter) reacted with the anti-GST-NOV and anti-NOV K19M antibodies, whereas the N-Terminal fragment (N-Ter) was only detected, as expected, by the GST-NOV antiserum. The two N-Ter forms of 27 and 24 kDa could result from different degrees of N-glycosylation as the N-Ter region of NOV contains a potential site for N-glycosylation [20].

Figure 3 Adhesion of C2C12 cells to NOV is mediated by C-Ter and results in cytoskeleton reorganization, in increases of tyrosine phosphorylation of FAK, and of DNA synthesis. (A) Purification of NOV; The full-length NOV (44-kDa) (lane 1), N-Ter (27-24 kDa) (lane 2) and C-Ter (27 kDa) (lane 3) proteins were Coomassie blue (CBB) -stained and characterized by Western blotting. The anti-GST-NOV antibody detects NOV full-length (lane 1), N-Ter (lane 2) and C-Ter (lane 3) and the anti-NOV K19M antibody detects NOV full length (lane 1) and C-Ter (lane 3) and but not N-Ter (lane 2). (B) C2C12 myoblasts were adhered to microtiter wells coated with 6 μg/ml of NOV, C-Ter, N-Ter or BSA as a control. Adhesion was evaluated and presented as in Figure 1. (*, P < 0.05). Cells morphology was examined under a phase-contrast microscope after incubation at 37°C for 90 min (right panel). (C, D) C2C12 cells (2 × 10⁵ cells/ml) were plated on dishes coated with NOV (10 μ g/ml), C-Ter (10 μg/ml), N-Ter (10 μg/ml), FN (10 μg/ml) as indicated. After 2 hrs, actin cytoskeleton was stained in adherent cells with fluorescein-conjugate phalloidin in (C). Membranes rufflings are indicated by arrowheads and pseudopods by round stars. In (D) focal adhesions indicated by arrows or focal complexes indicated by short arrowheads are stained with anti-phosphotyrosine antibody (see color plate III at the end of this issue). (E) Adherent C2C12 cells were lysed two hrs after plating on indicated substrates and proteins were immunoprecipitated with anti-FAK antibody, the phosphotyrosine content of recovered FAK protein in each sample was assessed by Western blotting (upper panel). The even recovery of FAK protein sample was assessed following stripping of the antibodies and reblotting with Mab against FAK. (F) C2C12 myoblasts were adhered on precoated plates with NOV (6 μg/ml), C-Ter (6 μg/ml) or N-Ter (6 μg/ml) for 2 hrs. DNA synthesis was measured as described in Material and Methods. All values were standardized with respect to the amount of adherent cells on each substrate. The results are presented as fold increase on the N-Ter value which is set to 1. Data are mean ± SEM from six determinations and are representative of at least three separate experiments. (*, P < 0.05).

Full-length NOV and C-Ter mediate adhesion and spreading of C2C12. In contrast, adhesion and spreading of these cells on the N-Ter part of NOV was reduced (Figure 3B). We next examined the morphological changes and signaling responses in C2C12 cells adhered to these NOV fragments. Using phalloidin staining at, 2 hrs after plating, myoblasts adherent on NOV or C-Ter exhibited numerous protrusive structures supporting their adhesion and spreading, among which the thin pseudopods corresponded to the previously described filopodia [46] and the ruffling edges to typical lamellipodia (Figure 3C). Many fewer of these structures were detected in myoblasts plated on N-Ter. As control, C2C12 myoblasts plated on fibronectin were more spread with more abundant actin stress fibers, and cells plated on Poly-L-lysine had a round morphology.

The formation of filopodia and lamellipodia is associated with the formation of focal complexes that are smaller and distinct from focal adhesions. These complexes contained proteins rich in protein kinases and tyrosine phosphorylated proteins [47]. Immunofluorescence studies performed with a Mab against phosphotyrosine revealed (Figure 3D) punctuated structures enriched in phosphotyrosine when C2C12 cells were adhered to NOV or to C-Ter, and only a weak and diffuse background staining without any discrete structure when C2C12 cells were adhered to N-Ter. In cells adhered to fibronectin, tyrosine phosphorylated proteins were organized in the characteristic elongated and arrowhead structures.

It has also been reported that these focal complexes contained pp125 FAK [48]. Since FAK is a downstream target of integrins, we investigated whether FAK was phosphorylated on tyrosine when C2C12 cells were allowed to adhere to NOV. FAK was immunoprecipitated from these cells and western blot studies showed that there was an increase of tyrosine phosphorylation of FAK when cells were plated on NOV, C-Ter and fibronectin when compared to C2C12 cells plated on N-Ter or Poly-L-lysine (Figure 3E). Thus, the C-Ter region of NOV is sufficient to mediate C2C12 cell adhesion via the formation of focal complexes in a comparable manner to the full-length protein.

As a first step to investigate whether adhesion of cells on NOV could mediate proliferation, we determined the ability of C2C12 cells to incorporate [3H] thymidine. When cells were plated on NOV or C-Ter, and following normalization to number of adherent cells, there were a significant 2.6 ± 0.5 and a 2.7 ± 0.6 fold increases, respectively, of [3H] thymidine incorporation, compared to the response of cells plated on N-Ter (Figure 3F). These data indicate that NOV acts as an adhesive protein via its C-Ter region which also enhances DNA synthesis.

NOV-mediated Adhesion Enhances the Effect of FGF2 on C2C12 Cell Proliferation and Cooperates with IGF to Protect Cells from Apoptosis

We further compared the ability of growth factors, known to play a role in C2C12 cell proliferation or survival such as FGF2, PDGF or IGF-1, to regulate [3H] thymidine incorporation when cells adhered to NOV. As shown in Figure 4A, FGF2 was the most potent growth factor for C2C12 cells plated on either NOV or fibronectin. In the presence of FGF2 and PDGF, C2C12 cells plated on NOV proliferated 5.2 ± 2.3 and 2.6 ± 0.7 times more, respectively, as compared to cells plated on fibronectin. In contrast, IGF-1 had no significant effect on DNA synthesis. Thus, C2C12 cells plated on NOV were more responsive to FGF2 and to PDGF than C2C12 cells plated on fibronectin. This different sensitivity of cells plated on NOV to the proliferative activity of growth factors is cell-specific, since it has not been observed with ATDC5 cells (data not shown).

Figure 4 NOV-mediated adhesion of C2C12 cells enhances the effect of growth factors on proliferation and survival. C2C12 myoblasts were allowed to adhere on precoated plates with NOV (6 μ g/ml) or FN (6 μg/ml) for 2 hrs. Adherent cells were incubated for 22 hrs in the presence or absence of FGF2 (5 ng/ml), PDGF (25 ng/ml) or IGF-1 (100 ng/ml). DNA synthesis was measured following [3H] thymidine incorporation. The results are presented as fold increase compared to the control of untreated cells. Data are presented as in Figure 3F. (*, P < 0.05).

As a first attempt to investigate the signaling pathway mediated by C2C12 cells plated on NOV, the kinetics of mitogen-activated protein kinase (MAPK) phosphorylation was followed in these cells plated on NOV-coated dishes for various times in serum-free medium. Cell lysates were electrophoresed and immunoblotted, and MAPK activation was examined by a mobility shift assay. As shown in Figure 5A, the degree of shifting for both 42 and 44 kDa forms remains high for 30 min after the cells were plated on NOV, then declines from 1 hr (corresponding to the maximal spreading of the cells) to 5 hrs. There was a second highly reproducible increase of MAPK phosphorylation that lasted for up to 9 hrs. This increase was less when cells were plated on fibronectin (Figure 5B). Such a MAPK activation has been previously reported to induce apoptosis in embryonic fibroblasts [49]. Therefore, we examined whether the second peak of MAPK phosphorylation could be correlated with apoptosis-induced by growth factor starvation. Since cleavage of the Poly (ADP-ribose) polymerase (PARP) from a 116 kDa to a 85 kDa form is an early event in apoptosis in intact cells [50], we analyzed on the same immunoblots whether PARP fragments could be detected. As shown in Figure 5B, an 85 kDa fragment was detected in C2C12 cells plated on NOV after 7 and 9 hrs, but this fragment was not detected on fibronectin. In agreement with the second peak of MAPK phosphorylation and the appearance of PARP proteolysis, at 8 hrs, a higher level of caspase 3 and 7 activities was measured in C2C12 plated on NOV than in cells plated on fibronectin (Figure 5C). Since NOV in a soluble form was able to protect endothelial cells from apoptosis [29], we examined whether addition of NOV (0.5 or 5μ g/ml) to C2C12 cells plated on NOV could prevent PARP cleavage and induction of MAP kinase phosphorylation. As shown in Figure 5D, incubation of C2C12 cells with both concentrations of NOV resulted in detection of the 85 kDa form of PARP and to the shifted MAP kinase form.

Figure 5 Kinetics of MAPK activation of C2C12 cells adhered to NOV; correlation with PARP cleavage. C2C12 myoblasts (6 × 10⁵ cells/ml) were plated on NOV (10 μg/ml) or FN (10 μg/ml) and incubated at 37 °C for various times as indicated. (A, B) Western blotting analysis was done using anti-p42/44 MAPK antibody. The arrowheads indicate slower migrating forms of p42/P44 MAPK corresponding to the activated forms. In (B), the upper part of the same Western blot was probed with a polyclonal anti-PARP antibody. PARP* indicates the cleaved form. (C) Two hours following adhesion on NOV or FN, C2C12 cell cultures were incubated, either in the absence (Ct) or in presence of IGF-1 (100 ng/ml), for further 6 hrs. Caspase 3 and 7 activies were evaluated as described in Material and Methods. All values were standardized with respect to the amount of adherent cells on each substrate. (AU): arbitrary units. (D) C2C12 cell cultures were incubated, 2 hrs following plating on NOV, either in the absence (Ct) or in presence of soluble NOV (0.5 or 5 μ g/ml) or IGF-1 (100 ng/ml), for further 3 and 6 hrs. MAPK phosphorylation and PARP cleavage were examined by Western blotting at indicated times. (E) C2C12 myoblasts were allowed to adhere on NOV or FN for 2 hrs. Adherent cells were incubated for 22 hrs in the presence or absence of IGF-1 (100 ng/ml). Cell viability was evaluated with the MTT absorbance as described in Materials and methods. The results are presented as fold increase compared to the control of untreated cells. Data are mean ± SEM from six determinations and are representative of at least three separate experiments. (*, P < 0.05).

However, these two events did not occur when IGF-1, a survival factor for myoblasts [51] was added to the cultures plated on NOV. When C2C12 cells plated on NOV and on fibronectin were treated with IGF-1, caspase activity was reduced to the same level suggesting that cells plated on NOV were more responsive to IGF-1 than on fibronectin (Figure 5C). We also compared the ratios of viable C2C12 cells plated on NOV and fibronectin when grown in the presence of IGF-1 for 24 hrs. Relative to the untreated cells, the number of viable C2C12 cells assessed by mitochondrial activity (MTT test) was about 3-fold higher when cells were plated on NOV than on fibronectin (Figure 4B). As IGF-1 did not increase significantly [H3] thymidine incorporation whether cells were plated on NOV or on fibronectin, these data indicate that C2C12 cells plated on NOV were also more responsive to IGF-1 for cell survival than C2C12 cells plated on fibronectin.

Taken together, these observations indicate that in C2C12 cells plated on NOV the second induction of MAPK phosphorylation is correlated with apoptosis and that C2C12 cells plated on NOV were more responsive to IGF-1 for cell survival and to FGF2 for cell proliferation than C2C12 cells plated on fibronectin.

DISCUSSION

NOV is expressed during mouse development in skeletal and visceral muscles, in cartilage, and in the nervous system [23] and is involved ex vivo in the differentiation of myoblasts [25]. In the present study, we show that NOV mediates adhesion of C2C12 myoblasts through a mechanism involving integrin β1. Our results also suggest that other RGD sensitive integrin(s) are probably involved in the spreading of myoblasts and that proteoglycans are not engaged when NOV interacts with integrins. We further show that the C-Ter part of NOV is sufficient to support adhesion of C2C12 cells, activation of FAK and stimulation of DNA synthesis. This region of NOV exerts full activity comparable to full length NOV. Our data also demonstrate that NOV cooperates with FGF2 and IGF-1 to enhance C2C12 myoblasts proliferation and survival, respectively, to a greater extent than the fibronectin substrate. In addition, we report that these activities are cell-specific, since comparison of the biological properties of NOV and fibronectin on adhesion of chondrocytes did not reveal major differences.

The involvement of integrin β 1 in adhesion of C2C12 myoblasts to NOV is in agreement with previous reports [29, 42], which showed that this integrin is also crucial or the adhesion of endothelial cells to NOV. NOV is the only member of the CCN family to bind integrin α 5 β1 either directly [29] or mediated by fibronectin [42]. At present nine integrin α subunits (α 1, α 2, α 4, α 5, α 6, α 7, α 9, α 11, αv) are expressed by skeletal muscle fibers either during differentiation or by mature muscle cells [30]. Because of the lack of availability of blocking antibodies against mouse α integrins, we could not discriminate which α integrin was involved in the β 1 heterodimer engaged in NOV interaction. Since the α subunits are also involved in ligand binding, this might explain why the blocking antibody against β 1 was not able to block completely adhesion of cells on NOV.

It has also been reported that NOV is able to interact directly with integrin αvβ 3 despite the absence of an RGD sequence motif in NOV, and that this integrin is important for adhesion of endothelial cells on NOV [29] but not for vascular smooth muscle cells [28]. In our experimental model, we observed that incubation of C2C12 cells with the RGD peptide, did not impair their attachment to NOV but strongly inhibited cell spreading indicating that another integrin, possibly αvβ3 is involved in the spreading of myoblasts C2C12 on NOV. Adhesion and spreading of C2C12 myoblasts on NOV therefore involves different integrins from those used by endothelial cells.

Interestingly, regulation of attachment and spreading of C2C12 myoblasts on fibronectin has been shown to include different signaling pathways [52]. Whereas adhesion of C2C12 cells depends on integrin signaling pathway, spreading can be enhanced by cooperation between extracellular stimuli, such as insulin, and integrins resulting in a better survival of the cells [52]. This observation is consistent with our results showing that survival of C2C12 cells plated on NOV can be increased by incubation with IGF-1.

The possibility that different mechanisms could account for adhesion of endothelial and myoblast cells on NOV is reinforced by our data showing that neither heparin nor chondroitin A, B or C prevent adhesion of C2C12 cells on NOV, whereas heparan sulfate proteoglycans (HSPG) may be involved in the adhesion of endothelial cells to NOV [29]. These observations suggest that NOV utilize and signal through different receptors in different cell types.

We have previously reported that a C-terminal fragment of NOV (32 kDa) is probably generated by a natural cleavage of the full-length protein [9, 20, 27]. To date, no function has been assigned to this part of NOV. Our results show that C2C12 cells adhered to C-Ter and to the full-length NOV protein in a similar manner. The C-Ter form of NOV contains the TSP1 and the CT domains. It has been reported [18] that a recombinant fragment corresponding to the isolated TSP1 domain of CYR61 (CCN1) was able to inhibit adhesion of fibroblasts to NOV and that the type 1 repeat of the thrombospondin (TSP1) molecule also supports attachment of C2C12 cells [53]. Thus, these observations suggest that the TSP1 domain of NOV is involved in C2C12 cell adhesion on C-Ter. However, in contrast to the C-Ter domain of NOV, this part of thrombospondin-1 did not induce spreading of C2C12 myoblasts [53], suggesting that adjacent TSP1 sequences in NOV might also be important in this process.

Integrins mediate different types of cell-matrix adhesions from dot-like focal complexes to stress fiber-associated focal contacts which can form fibronectin bound fibrillar adhesions [54]. Our results reveal that C2C12 cells plated on either NOV or on C-Ter exhibit protrusive morphologies with multiple lamellipodia regions enriched in F-actin reminiscent to the morphology of C2C12 cells plated on thrombospondin [53]. Filopodia and lamellipodia have been associated with focal complexes [47]. Recently, it has been shown [55] that filopodia and lamellipodia are composed of a distinct subset of (Tyr)-phosphorylated proteins such as talin, VASP and p130Cas at the tips of filopodia, whereas FAK, vinculin or paxillin were detected only in lamellipodia. Consistent with this report, we observed lamelliopodia and found an increase in FAK phosphorylation in C2C12 cells adherent to NOV or to C-Ter as compared to N-Ter- or Poly L-Lysine- mediated adhesion.

Synergetic effects between adhesion and growth factors effects have been described in regulating cell growth, differentiation, survival, and apoptosis. Integrins receptors regulate growth factor signaling through the protein phosphatase SHP2, which dephosphorylates PDGF-R and IGF-R [56, 57]. Integrins receptor occupancy has been shown to increase the recruitment of SHP2 and to regulate the appropriate phosphorylation of these receptors, leading to enhanced cellular responses, such as migration and DNA synthesis [56, 57]. In contrast to a previous report [28] showing that adhesion of primary vascular smooth muscle cells to NOV did not affect cell proliferation, we observed that DNA synthesis in C2C12 myoblasts deprived of serum could be stimulated when plated on NOV. Moreover integrin occupancy by NOV molecules resulted in an increased response of C2C12 cells, to FGF2 and to PDGF for cell proliferation and to IGF-1, for cell survival. The responses on NOV were greater than those observed on fibronectin substrates. Whether SHP-2 recruitment and the kinetics of FGF 2, PDGF, and IGF-1 receptors phosphorylation are modified upon integrin occupancy by NOV remains to be elucidated.

It is not known thus far whether an integrin β 1-NOV interaction is involved in the inhibition of myoblasts differentiation observed ex vivo [25]. It has also to be determined whether such an interaction may play a role during myogenesis in vivo. Integrin β1 regulates myoblasts fusion, the assembly of muscle fibers cytoskeleton [35], and the maintenance of myotendinous junctions. Inasmuch as NOV was found to be expressed in mouse myotendinous junctions [23], it is possible that via its interaction with integrin β1 it could also participate to junction integrity.

In conclusion, our results indicate that NOV as an adhesive protein could play an important role in myoblast physiology and could exert additive effects with growth factors in cell survival and proliferation.

ACKNOWLEDGEMENTS

We thank Dr. H. Kleinman and Dr. J. Plouët for critical reading of this manuscript. J. Lafont. was a recipient of a fellowship from the Fondation pour la Recherche Médicale.