Activated Tim-3/Galectin-9 participated in the development of multiple myeloma by negatively regulating CD4 T cells

ABSTRACT

The interaction between Tim-3 on T cells and its ligand Galectin-9 negatively regulates the cellular immune response. However, the regulation of Tim-3/Galectin-9 on CD4 T cell subsets in multiple myeloma (MM) remains unclear. The aim of this study was to investigate the relationship between the regulation of CD4 T cell subsets by the Tim-3/Galectin-9 pathway and clinical prognostic indicators in MM. Tim-3/Galectin-9 were detected by flow cytometry, PCR and ELISA in 60 MM patients and 40 healthy controls, and its correlation with clinical prognostic parameters was analyzed. The expressions of Tim-3 on CD4 T cells, Galectin-9 mRNA in PBMC and level of Galectin-9 protein in serum were significantly elevated in MM patients, especially those with poor prognostic indicators. In MM patients, Tim-3 was highly expressed on the surfaces of Th1, Th2, and Th17 cells, but lowly expressed on Treg. Moreover, level of cytokine IFN-γ in serum was negatively correlated with Tim-3⁺Th1 cell and Galectin-9mRNA, Galectin-9 protein level. In addition, cell culture experiments showed that the anti-tumor effect and the ability to secrete IFN-γ were restored by blocking the Tim-3/Galectin-9 pathway. In MM patients, Tim-3/Galectin-9 is elevated and associated with disease progression, by inhibiting the cytotoxic function of Th1, and also promoting Th2 and Th17 to be involved in immune escape of MM. Therefore, Tim-3/Galectin-9 may serve as a new immunotherapeutic target for MM patients.

1. Introduction

Multiple myeloma (MM) is the second most common hematologic malignancy characterized by clonal proliferation of plasma cells [1]. Due to the poor sensitivity and prognosis of traditional chemotherapy, the exploration of MM pathogenesis and novel therapeutic targets has become increasingly important, so as to improve the response rate and survival rate of patients [2,3]. Despite the malignant clones of plasma cells, immune escape and dysfunction caused by the proportion and dysfunction of T lymphocyte subsets in MM patients, is considered as one of the important reasons for the development of MM [4]. CD4 T cell subsets, including T helper 1 cells (Th1), T helper 2 cells (Th2), regulatory T cells (Treg) and T helper 17 cells (Th17), figure prominently in numerous diseases. Treg can down-regulate the immune response to self or exogenous antigens. For example, Treg plays an immunosuppressive role in malignant tumors by secreting IL-10, thereby promoting immune escape of tumor cells, which have a positive regulatory effect on tumor generation [5,6]. However, the role of Treg cells in MM remains unclear, and there are still many controversies [7–9]. Th17 cells are named for the specific secretion of interleukin 17 (IL-17), which promotes the mobilization, recruitment and activation of neutrophils, as well as the inflammatory response, thereby playing an important role in the development and progression of autoimmune diseases and tumors [10,11]. Treg cells and Th17 cells can inhibit each other in differentiation and function, thereby maintaining the immune balance of the microenvironment. Studies have shown that Th17/Treg imbalance is involved in the occurrence and development of MM [12]. IFN-γ, a cytokine belonging to the Th1 family, promotes the proliferation and differentiation of T cells and the killing ability of NK cells, leading to an enhanced anti-tumor effect of MM [13]. Th2 cells participate in antibody production and humoral immune response. One study has found increased Th2-associated cytokines,incluing IL-4 and IL-5, in the blood of asthma patients [14]. Th1 and Th2 cells are in dynamic balance under normal conditions. In MM the imbalanced ratio of Th1/Th2 cell can inhibit the proliferation of Th1 cells, and protect tumors from immune surveillance and attack, which is closely related to the occurrence, progression and prognosis of the disease. The decrease of Th2/Th1 ration was sustained by the significant reduction of Th2 cells. Interestingly,Ibrutinib significantly altered T-cell profiles, inducing in vivo changes in the Th2/Th1 ratio, primarily by limiting Th2 activation rather than by expanding the Th1 compartment [15,16].

T cell immunoglobulin mucin-3(Tim-3), a recently discovered negative regulators of immunity that acts by binding with Galectin-9, thereby inhibiting T cell-mediated immune responses and inducing immune tolerance [17,18]. Tim-3 is commonly expressed on multiple tumor cells, strongly suggesting its potential role in tumor progression [19,20]. Recently, Tim-3 has also been confirmed to be expressed in hematological maligance, especially highly expressed on T cells in acute myeloid leukemia (AML) petients, targeting the Gal-9/Tim-3 axis effectively combined with induction chemotherapy increases the likelihood of complete remission in AML patients [21]. In addition, increased expression of Tim-3 can also be found in lymphoma-derived vascular endothelial cells (ECs) [22]. Tim-3 promotes tumor progression through multiple mechanisms, including promoting tumor cell migration and invasion, and directly inhibiting CD4 T cells by activating IL-6-STAT pathway, thereby inhibiting Th1 differentiation and activation of mTOR function in primary AML cells [23]. Regardless of the different expressions of Tim-3 on different immune cells, Tim-3 indeed plays an important regulatory role. Based on the understanding of the above studies, it remains unknown what role does Tim-3/Galectin-9 play in CD4 T cell subsets (Th1, Th2, Th17, and Treg cells), as well as its specific expression in MM patients.

To understand the role of Tim-3/Galectin-9 pathway in the dysfunction of CD4 T cell subsets, and to clarify the mechanism of Tim-3/Galectin-9 pathway in MM patients and the relationship betweetn disease progression. On this basis, we studied the expression and role of Tim-3/Galectin-9 pathway in MM patients.

2. Materials and methods

2.1. Patients

A total of 60 patients in the Blood Diseases Center from March 2019 to March 2022 were enrolled in this study. All patients were newly diagnosed with multiple myeloma according to the 2019 NCCN Clinical Practice Guidelines [24]. There were 32 males (53.33%) and 28 females (46.67%), with an average age of 61.45 ± 12.34 years. At the same time, 40 healthy controls were involved in the study, including 21 males and 19 females, with an average age of 62.32 ± 13.22 years. There was no statistically significant difference in the demographics between the two groups. The study was approved by the Ethics Committee of the First Affiliated Hospital of Xinjiang Medical University, and all patients signed informed consent. Clinical Trial Registration Number-ChiCTR20180223-78 (Table 1).

Table 1. Clinical characteristic of multiple myeloma patients.

Characteristics	Values	N (%)
Age	≥65	27 (45.0)
	<65	33 (55.0)
Gender	Male	32(53.33)
	Female	28 (46.67)
ISS Stages	I	28 (46.67)
	II	20 (33.33)
	III	12 (20.0)
Serum LDH	≥220 U/L	23 (38.33)
	<220 U/L	37 (61.67)
SFLCR	High (≥100 or ≤0.01)	20 (33.33)
	Low (0.01 < sFLCR < 100)	40 (66.67)
Osteolytic damage	Yes	13 (21.67)
	No	47 (78.33)
Chromosome	Abnormal	19 (31.67)
	Normal	41 (68.33)

2.2. Flow cytometry

PBMC were isolated from whole blood by Ficoll Hypaque density gradient centrifugation, and the cell density was adjusted to 2 × 10⁶cells/ml. CD4 cells were analyzed with mAb, surface and intracellular antibody staining of the cells was combined, including anti-CD3-V450, CD4-APC/CY7, CD25-BV605, CD196-PerCP, CD183-APC, IL-17A-PE-CY7, Foxp3-FITC,

Tim-3-PE or isotype-matched control. All samples were tested by FACS Aria II (BD). The percentage of CD4T cells,Tim-3⁺ CD4⁺T cells, Tim-3⁺CD4⁺CD183⁺ CD196^-T cells, Tim-3⁺CD4⁺CD183^-CD196^-T cells, Tim-3⁺CD4⁺CD25⁺Foxp3⁺T cells, and Tim-3⁺CD4⁺IL-17⁺T cells were analyzed. Data analysis were performed using FlowJo software. All antibodies and reagents were purchased from BD Biosciences.

2.3. Tim-3⁺CD4 T sorting

PBMC in the peripheral blood of MM patients was isolated by Ficoll method. Anti-CD3/CD28-stimulated PBMC were incubated for 30 min on ice with anti-human CD3, CD4 and Tim-3 monoclonal antibodies.The Tim-3⁺T cells wre selected in FACS Aria II. The data were analyzed by FlowJo software. The purity of the sorted cells was above 95% by flow cytometry.

2.4. Co-culture system

The enriched Tim-3⁺CD4 T cells were cultured in 96 plates coated with CD3 and CD28 (eBioscience) for 24 h. Then, Tim-3⁺CD4 T cells were concultued with multiple myeloma cell line, RPMI 8226, U266 and H929 were purchased from the American Type Culture Collection. All cells were cultured in RPMI-1640 medium (Gibco/BRL, Grand Island, NY, U.S.A.) supplemented with 10% (RPMI 8226 and H929) or 15% (U266) fetal bovine serum and 100 U/ml penicillin streptomycin in an incubator with 5% carbon dioxide at 37°C for 48 h. At the same time, Galectin-9 recombinant protein (ACRO Biosystems,10 μ/ml) was added to the co-culture system. Anti-Tim-3 (10 μg/ml, e Biosciences) blocking antibody was added to the co-culture system. PBS was added as blank. The specimen was incubated with PMA, ionomycin, and BFA for 5 h. Afterwards, cells were collected and analyzed for apoptosis using flow cytometry. The levels of cytokine IFN-γ, IL- 4, IL-17, and IL-10 in the culture supernatants were measured by ELISA.

2.5. Measurement of Cytokine and Galectin-9 levels

Serum sample were stored at −80°C. Plate ELISA assay was carried out to detect Galectin-9 protein, IFN-γ, IL-4, IL-17 and IL-10 according to manufacturer’s instruction (Uscn, Life Science Inc.). The absorbance at 450 nm (OD450) was measured with a microplate reader. The levels of cytokine and Galectin-9 protein in serum were calculated according to the standard curve.

2.6. Quantitative real-time PCR

Total RNA was extracted from the peripheral blood using Trizol reagent (GIBOG Company). Complementary DNA (cDNA) was reverse transcribed from 1 μg of total RNA using TransScript First-Strand cDNA Synthesis SuperMix kit according to the manufacturer’s instructions. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal control (Table 2).

Table 2. Sequences of primers used in RT-PCR assays.

Marker	Sequences(5’-3’)
Galectin-9	Forward Primer CGCCATCCCACCTATGATGT
	Reverse Primer TACAGCCCTCCCAGAATGGT
GADPH	Forward Primer CATGAGAAGTATGACAACAGCCT
	Reverse Primer AGTCCTTCCACGATACCAAAGT

Amplification conditions were as follows: pre-denaturation: 95°C for 30 s, 1 cycle; Real time PCR reaction: 95°C for 5 s, 60°C for 20 s, 40 cycles. The relative Galectin-9 transcript level was determined using the 2^−ΔΔCt method.

2.7. Statistical analysis

All statistical analyses were performed in GraphPad Prism software (GraphPad Software, San Diego, CA, version 9.0). All data were expressed as mean ± SD. Two groups were compared by t-test, and multiple groups were compared by one-way ANOVA. LSD test was used for pairwise comparison between multiple groups. Pearson method was used for correlation analysis. In all cases, p < 0.05 was considered statistically significant.

3. Results

3.1. Tim-3 expressed on the surface of CD4 T cells and subsets

The expression of Tim-3 on CD4⁺T cells was detected by flow cytometry, as the flow cytometry figure shown in Figure 1(A). Compared with the healthy controls, the proportion of Tim-3⁺CD4 T cells in the peripheral blood of MM patients was significantly increased (3.67 ± 1.16% vs. 1.57 ± 0.17, p < 0.0001, Figure 1(B)), indicating an increased expression of Tim-3 on CD4 T cells in MM patients. The expression of Tim-3 on subsets of CD4 T cells was detected by flow cytometry, as the flow cytometry figure shown in Figure 1(C,D). The proportions of Tim-3⁺Th1(2.82 ± 0.54% vs. 1.49 ± 0.22%, p < 0.0001, Figure 1(E)), Tim-3⁺Th2(1.39 ± 0.24% vs. 1.25 ± 0.22%, p = 0.0053, Figure 1(E)), Tim-3⁺Th17(2.51 ± 0.69% vs. 1.48 ± 0.21%, p < 0.0001, Figure 1(F)) cells were significantly higher than those in healthy controls. Tim-3⁺Th1/Tim-3⁺Th2(2.07 ± 0.42 vs. 1.22 ± 0.26, p < 0.0001, Figure 1(G)), Tim-3⁺Th17/Tim-3⁺Treg (1.63 ± 0.55 vs. 0.85 ± 0.24, p < 0.0001, Figure 1(G)) were also significantly higher than those in healthys control. However, the percentage of Tim-3⁺Treg cell in MM patients was lower than that in healthy controls (1.61 ± 0.41% vs. 1.82 ± 0.38%, p = 0.0145, Figure 1(F)). The above data showed that Tim-3 was highly expressed on the surface of Th1, Th2, and Th17 cells, while lowly expressed on the surface of Treg cells in MM patients.

Figure 1. The expression of Tim-3 on CD4 T cells in the peripheral blood of MM patients. (A) Gating strategy for Tim-3⁺CD4⁺Tcells. (B) The expression of Tim-3 on the surface of CD4 T cells in peripheral blood of MM patients and healthy control were analyzed. (C) Gating strategy for Th1 cells, Th2 cells, Th17 cells and Treg cells. (D) Tim-3 expression on the surface of CD4 T cells in healthy control group and MM patients detected by flow cytometry. (E) Comparison of the percentages of Tim-3⁺Th1 and Tim-3⁺Th2 cells in healthy controls and MM patients. (F) Comparison of the percentages of Tim-3⁺Th7 and Tim-3⁺ Treg cells in healthy controls and MM patients. (G) Comparison of Tim-3⁺Th1/Tim-3⁺Th2 and Tim-3⁺Th17/Tim-3⁺Treg in healthy controls and MM patients.*p = .01–.05, **p < .01, ***p < .001, ****p < .0001.

3.2. The expression of related cytokines. Correlation between Tim-3 and cytokines

The changes of serum cytokine levels in the peripheral blood of MM patients and healthy controls were detected by ELISA. Compared with healthy controls, the level of IFN-γ was significantly lower(5.45 ± 0.5pg/ml vs. 11.51 ± 0.97pg/ml, p < 0.0001, Figure 2(A)), and the levels of IL-4(7.89 ± 0.65pg/ml vs. 6.14 ± 0.45pg/ml, p < 0.0001, Figure 2(A)), IL-17(36.88 ± 5.25pg/ml vs. 20.04 ± 4.25pg/ml, p < 0.0001, Figure 2(A)), and IL-10 (22.81 ± 5.08pg/ml vs. 18.03 ± 4.18pg/ml, p < 0.0001, Figure 2(A)) were significantly higher in MM patients. IFN-γ/IL-4 was lower (0.70 ± 0.10 vs. 1.88 ± 0.19, p < 0.0001, Figure 2(A)), while IL-17/IL-10 was higher (1.55 ± 0.38 vs. 1.18 ± 0.37, p < 0.0001, Figure 2(A)) in MM patients than those in healthy controls. These results indicated that cytokine levels are markedly altered in MM patients. The correlation between Tim-3 expressed on CD4 T cell subsets and corresponding cytokines in MM patients was analyzed, and Tim-3⁺Th1 cells were found negatively correlated with IFN-γ, positively correlated with IL-4 (Figure 2(B)). Tim-3⁺Th2 cells were negatively correlated with IFN-γ, positively correlated with IL-4 and IL-10 (Figure 2(C)), Tim-3⁺Th17 cells were positively correlated with IL-17 (Figure 2(D)), and Tim-3⁺Treg cells were positively correlated with IL-17 and IL-10 levels (Figure 2(E)).

Figure 2. Cytokines changed in the serum of patients.(A) The cytokine levels of IFN-γ, IL-4, IL-10 and IL-17 in healthy controls and MM group were tested by ELISA. (B) In MM patients, Tim-3⁺Th1 was negatively correlated with IFN-γ, positively correlated with IL-4, but not with IL-17 and IL-10. (C) Tim-3⁺Th2 was negatively correlated with IFN-γ, positively correlated with IL-4 and IL-10, but not with IL-17. (D) Tim-3 ⁺Th17 was positively correlated with IL-17, but not with IFN-γ, IL-4 and IL-10.(E) Tim-3⁺Treg was positively correlated with IL-17 and IL-10, but not with IFN-γ and IL-4. *p = .01–.05, **p < .01, ***p < .001, ****p < .0001.

3.3. Expression of Galectin-9 mRNA and its correlation with Tim-3 on CD4 T cell subsets and cytokines

Next, qRT-PCR was used to detect Galectin-9 mRNA in PBMCs of healthy controls and MM patients. Galectin-9 mRNA were significantly higher in MM patients compared with the healthy controls (2.29 ± 0.40 vs 1.04 ± 0.29, p < 0.0001, Figure 3(A)). To investigate the relationship between Galectin-9 and Tim-3, we analyzed the correlation between Galectin-9 mRNA and Tim-3 expression on CD4 T cells and subsets, as well as the correlation between Galectin-9 mRNA and cytokine levels. In MM patients, Galectin-9 mRNA was positively correlated with Tim-3⁺CD4 T cells (Figure 3(B)), Tim-3⁺Th1 cells, Tim-3⁺Th2 cells and Tim-3⁺Th17, but not with Tim-3⁺Treg cells (Figure 3(C)). Galectin-9 mRNA was positively correlated with IL-4 and IL-17, while negatively correlated with IFN-γ (Figure 3(D)).

Figure 3. Expression of Galectin-9 mRNA and its correlation with Tim-3 on CD4 T cell subsets and cytokines. (A) The level of Galectin-9 mRNA in the peripheral blood of MM patients and healthy controls. (B and C) Correlation between Galectin-9 mRNA and Tim-3 on CD4 T cells and its subsets. Galectin-9 mRNA was positively correlated with Tim-3 ⁺CD4 T (B), Tim-3⁺Th1 cells, Tim-3⁺Th2 cells and Tim-3⁺Th17, but not with Tim-3⁺Treg cells (C). (D) Correlation between Galectin-9 mRNA and cytokines. Galectin-9 mRNA was negatively correlated with IFN-γ, positively with IL-4 and IL-17, but not with IL-10.*p = .01–.05, **p < .01, ***p < .001, ****p < .0001.

3.4. Change of Galectin-9 protein level in serum of patients with MM

Galectin-9 protein excreted into peripheral circulation is emerging as a mechanism of induce local immunosuppression. We observed Galectin-9 level in serum by ELISA. Mean level of Galectin-9 protein in serum of MM patients was higher than in healthy controls (3.28 ± 0.57 pg/ml vs. 1.67 ± 0.31 pg/ml, p < 0.0001, Figure 4(A)). We next conducted a correlation analysis of Galectin-9 protein level, CD4 T cell subsets, and cytokines. The level of Galectin-9 protein in MM patient was positively correlated with Tim-3⁺CD4 T cells (Figure 4(B)), Tim-3⁺Th1 cells, Tim-3⁺Th2 cells and Tim-3⁺Th17, but not with Tim-3⁺Treg cells (Figure 4(C)). Galectin-9 protein level was positively correlated with IL-4 and IL-17, while negatively correlated with IFN-γ (Figure 4(D)). These results indicate that the change in Galectin-9 is related to the imbalance of CD4 T subsets and cytokines in MM patients. High levels of Galectin-9 protein may promote the proliferation and differentiation of Th1, Th17 cells.

Figure 4. The level of Galectin-9 protein in serum and its correlation with Tim-3 on CD4 T cell subsets and cytokines. (A)The level of Galectin-9 protein in serum of MM patients and healthy controls. (B and C) Correlation between the level of Galectin-9 protein and Tim-3 on CD4 T cell and its subsets. Galectin-9 protein level was positively correlated with Tim-3⁺CD4 T (B), Tim-3⁺Th1 cells, Tim-3⁺Th2 cells and Tim-3⁺Th17, but not with Tim-3⁺Treg cells (C). (D) Correlation between Galectin-9 protein level and cytokines. Galectin-9 protein level was negatively correlated with IFN-γ, positively with IL-4 and IL-17, but not with IL-10.*p = .01–.05, **p < .01, ***p < .001, ****p < .0001.

3.5. The level of Tim-3 expression on CD4 T cell subsets and the level Galectin-9 with different ISS stage of MM patients

We analyzed Galectin-9 mRNA, level of Galectin-9 protein in serum, proportion of Tim-3⁺CD4 T cell subset and cytokine level in MM patients with different ISS stage. Tim-3⁺CD4 T cells gradually increased in ISS stage I, II and III, and there was a significant difference in Tim-3⁺ CD4 T cells in each stage. The proportion of Tim-3⁺Th1 cells was higher in ISS III patients than in ISS I and II. The proportion of Tim-3⁺Th17 cells in ISS stage II and stage III patients were higher than that in stage I. There was no statistically significant difference in the proportion of Tim-3⁺Th2 and Tim-3⁺Treg cells in ISS stage (Figure 5(A)). MM patients with ISS stage III had the highest Galectin-9 mRNA in PBMCs (Figure 5(E)), Galectin-9 protein (Figure 5(F)) and IL-17 (Figure 5(B)) levels in serum, and the lowest IFN-γ (Figure 5(B)) levels. The changing trend of IL-17 in ISS stage was similar to that Tim-3⁺Th17 cells, but the trend of IFN-γ and Tim-3⁺Th1 was opposite. The more advanced the stage, the higher Tim-3⁺CD4 T cell subset ratio (Figure 5(C)) and IL-17/IL-10 ratio (Figure 5(D)), but the lower IFN-γ/IL-4 ratio (Figure 5(D)). These results indicate that the highly expressed Tim-3 on CD4 T, Th1 and Th17 cells, especially high level of Galectin-9 and IL-17 is associated with disease progression, whereas low level of IFN-γ is associated with disease progression.

Figure 5. Tim-3 on CD4 T cell, levels of cytokines and Galectin-9 protein, Galectin-9 mRNA level in different MM clinical stages. (A) Proportion of Tim-3⁺CD4 T cell, Tim-3⁺Th1, Tim-3⁺Th2, Tim-3⁺Th17 and Tim-3⁺Treg in MM patients with different ISS stages. (B) Level of IFN-γ, IL-4, IL-17, IL-10 in MM patients with different ISS stages. (C) Tim-3⁺Th1/Tim-3⁺Th2 and Tim-3⁺Th17/Tim-3⁺Treg ratio in different MM clinical stages. (D) IFN-γ/IL-4 and IL-17/IL-10 ratio in different MM clinical stages. Galectin-9 mRNA (E) and the level of Galectin-9 in serum (F) in different MM clinical stages. Compared with ISS I stage:*p = .01–.05, **p < .01, ***p < .001, ****p < .0001. Compared with ISS II stage: ^#p = .01–.05, ^##p < .01, ^###p < .001, ^####p < .0001. NS: no significant.

3.6. Correlation between the proportion of Tim-3⁺CD4 T cells, Galectin-9 mRNA and Galectin-9 protein level in serum with clinical parameters in MM patients

The proportion of Tim-3⁺CD4 T cells and Galectin-9 mRNA and the level of Galectin-9 protein had no significance in gender, age and osteolytic lesions (Figure 6(A–C)). The proportion of Tim-3⁺CD4 T cells, Galectin-9 mRNA and the level of Galectin-9 protein were strongly associated with levels of sFLCR (Figure 6(A–C)). For chromosome abnormalities, we mainly analyzed the indicators of poor prognosis, such as 17p- and chromosome 14 translocation, and found that the high level of Tim-3⁺CD4 T cells, Galectin-9 mRNA and Galectin-9 protein level were associated with adverse chromosomal abnormalities (Figure 6(A,B)). Tim-3⁺CD4 T cells were associated withLDH (Figure 4(A)), whereas Galectin-9 mRNA and Galectin-9 protein level were not (Figure 6(B,C)).

Figure 6. Correlation between the levels of Tim⁺CD4 T cells, Galectin-9 mRNA and the level of Galectin-9 protein and clinical characteristics in MM patients.(A) Correlation analysis between Tim-3⁺CD4 T cells and characteristics of MM patients, including age, gender, dehydrogenase level, sFCLR, osteolytic damage, and chromosome. (B) Correlation analysis between the level of Galectin-9mRNA and the characteristics of MM patients, including age, gender, dehydrogenase level, sFCLR, osteolytic damage, and chromosome. (C) Correlation analysis between the level of Galectin-9 protein in serum and the characteristics of MM patients, including age, gender, dehydrogenase level, sFCLR, osteolytic damage, and chromosome.*p = .01–.05, **p < .01, ***p < .001, ****p < .0001.

3.7. Effect of Tim-3/Galectin-9 pathway blockade on CD4 T cells in MM patients

Flow cytometry was used to detect the apoptosis of multiple myeloma cell lines (RPMI 8226, U266 and H929). Cytokines (IFN-γ, IL-4, IL-17, IL-10) were detected in culture supernatants by ELISA. In the anti-Tim-3 antibody group, the apoptosis of MM tumor cells and IFN-γ were remarkably increased (p < 0.0001) (Figure 7(A,B)). On the contrary, IL-4, IL-17, and IL-10 were significantly decreased in the cultured supernatant of all three MM tumor cell lines (Figure 7(B)). Compared with the anti-Tim-3 antibody group:*p = .01–.05, **p < .01, ***p < .001, ****p < .0001.

Figure 7. Tim-3/Galectin-9 pathway regulated the function of CD4 T cells in MM patients. Cytokines changes with or without blockage of Tim-3/Galectin-9 pathway. Tim-3⁺CD4 T cells were isolated from MM patients. The data points were from different subjects. (A) Cell apoptosis rate of MMCLs in different culture detected by Annexin V-FITC/PI using flow cytometry. Representative flow cytometry results of three MMCLs (UR: Late apoptosis cells, LR: Early apoptosis cells). (B) Bar graph depicting the rate of apoptotic cells and the levels of IFN-γ, IL-24, IL-17 and IL-10 in each group.

4 Discussion

Tim-3, an immune checkpoint receptor, is mainly expressed on the surface of CD4, CD8, regulatory T cells and other immune cells (e.g. monocytes, dendritic cells, and natural killer cells), playing an inhibitory role in the proliferation of T cells in anti-tumor immunity [25,26]. Tim-3 can form an important immunomodulatory effect after binding to Galectin-9. The specific manifestations of this effect are as follows: on the one hand, effector Th1 and Th17 cells can be removed during the immune effector phase. On the other hand, T-cell-mediated immune responses can be inhibited and immune tolerance can be induced, thereby playing an important role in immune escape of malignant tumor and infections [18,19]. Galectin-9 has been found highly expressed in liver cancer, resulting in the disturbance of T cell function, thereby inhibiting the immune response and inducing immune escape [27]. In multiple hematologic diseases, such as myelodysplastic syndrome and acute myeloid leukemia, the increased expression of Tim-3 are involved in the occurrence of the disease and promote its progression [28,29]. The immunosuppression patterns based on the changes of immune checkpoint vary greatly among hematologic malignancies, especially Tim-3. The changes and effects of Tim-3/Galectin-9 on CD4 T cells in MM remain unknown and controversial.

In our study, Tim-3 and Galectin-9 were found highly expressed in MM patients compared with the healthy controls, which was consistent with Gang An and Batorov [30,31]. These results suggested that Tim-3/Galectin-9 may be a potential target for MM pathogenesis. Several studies have shown that Tim-3, after binding with the ligand Galectin-9, regulated the activity of T cells through death receptor 3 signaling and promoted immune escape from tumors [32,33]. Furthermore, high levels of Tim-3 on CD4 T cells and Galectin-9 mRNA and level of Galectin-9 protein in serum were associated with higher-risk clinical indicators (more advanced stage, high levels sFLCR) and biological (chromosome 17p-or/and chromosome 14 translocation) characteristics. High levels of sFLCR, and abnormal chromosome 17 were all considered to be promoters of tumor progression. Detection of serum free light chain (FLC) is a highly sensitive indicator to test the presence of clonal plasma cells in vivo. β2-microglobulin and LDH are indicators related to tumor burden. We observed a positive correlation between Tim-3⁺CD4 T cells and LDH. The present study and Li Bingxin found that Galectin-9 was not associated with bone destruction of MM [34]. Therefore, it is speculated that the Tim-3/Galectin-9 pathway is involved in the clonal proliferation of plasma cells, and is closely related to the adverse outcome of MM. Our study has mainly found that Tim-3⁺CD4 T cells and Galectin-9 levels emerged as powerful predictors of MM. Therefore, we hypothesized that this pathway provides inhibitory immune signals and plays an immune escape role in MM.

CD4 T cells play an important anti-tumor role in tumor diseases [35]. Studies have reported that adaptive T cell immune dysregulation exists in multiple myeloma [36]. As we have found in a series of studies, the increased expression of Tim-3 on CD4 T cells in MM patients led to diminished antitumor immunity of CD4 T cells, which in turn promoted the progression of MM. In addition, we analyzed the expression of Tim-3 on CD4 T cell subsets and the correlation between Galectin-9 and CD4 T cell subsets. The imbalanced Tim-3⁺Th1/Tim-3⁺Th2 and Tim-3⁺Th17/Tim-3⁺Treg were found in MM patients. Galectin-9 levels were positively correlated with the levels of Tim-3⁺Th1 cells and Tim-3⁺Th2 cells. Some authors found that MM patients had imbalance of Th1/Th2 and Th17/Treg [15,38]. Based on our current findings, it is postulated that the Tim-3/Galectin-9 pathway will lead to the disturbance of the CD4 T cell subsets described above.

Cytokine IFN-γ secreted by Th1 can mediate cellular immunity, which plays a dominant anti-tumor role, and Th2 is mainly involved in humoral immunity [39]. In our study, Tim-3 was highly expressed on Th1 and Th2, Tim-3⁺Th1 was negatively correlated with IFN-γ, and Tim-3 ⁺Th2 was positively correlated with IL-4. It is speculated that, due to the excessively stimulated Tim-3/Galectin-9 negative signaling pathway, the differentiation of Th2 cell and Th2-mediated humoral immune function were enhanced, the anti-tumor effect of Th1 cells was inhibited, while Tim-3⁺Th1 cells with defective anti-tumor function were increased, thereby inhibiting the production of cytokine IFN-γ and attenuating anti-tumor effect, which conducive to escaping immune surveillance and attack, resulting in promoted MM progression. In Zhu C's study, Tim-3 was highly expressed on Th1 and led to imbalanced T cell differentiation by binding with Galectin-9 [40]. At the same time, Tim-3 was also found highly expressed on Th2 cells in MM patients, thereby increasing IL-4 secretion by binding with Galectin-9, and promoting the differentiation of Th0 cells into Th2 cells. The immune response gradually transformed from Th1 to Th2, ultimately making the body produce a dominant response dominated by Th2 cells. Th2 cells and cytokines secreted by them can weaken the immune clearance of the body against tumors, thereby inducing immune tolerance of MM disease and promoting the proliferation of myeloma cells.

Recently, the disorder of Th17/Treg immune balance in the immune microenvironment of MM has aroused the attention of researchers again. Th17 cells in normal organisms are involved in the response to chronic in flammation and triggers defense against bacteria and viruses by producing IL-17 and IL-6 [41]. IL-17, one of the most important cytokines secreted by Th17 cells, is also secreted at high levels in cancers [42,43]. Th17/Treg imbalance in MM patients, IL-6 stimulates Th17 cells to produce IL-17 involved in the proliferation of multiple myeloma cells and promote the progression of multiple myeloma, and further application of antibodies blocking IL-17A to treat Vk*MYC mice can reduce the accumulation of Th17 cells in the bone marrow and delay disease progression [15,44]. Treg cells infiltration in the bone marrow of MM patients is not different from that of healthy individuals,and data on the effect of Treg cells on patient outcome and treatment response are also lacking [45]. In the present study, Tim-3 was found highly expressed on Th17 cells and IL-17 level was significantly increased, and both were positively correlated with Galectin-9 levels. Although Tim-3 expression was lower on Treg cells, it was not correlated with Galectin-9 level, so we cinsidered that Tim-3+Th17 played a dominant role in the imbalance of Tim-3+Th17/Tim-3+Treg. Therefore, we speculated that Tim-3/Galectin-9 can increase IL-17 secretion through excessive differentiation of Th cells into Th17, promote tumor cell proliferation in MM patients, and tumor cells escape immune cell surveillance, which is not conducive to tumor clearance. The increased expression of Tim-3/Galectin-9 may enhance Th17/IL-17 immune responses as a negative regulatory signal, and play an important role in the formation and maintenance of IL-17 cytokine-dominant immune responses in MM disease. These data suggest that up-regulation of the Tim-3/Galectin-9 pathway is involved in the balance and functional changes of CD4 T cell subsets, especially the role of Th1, Th2, and Th17 cells in MM and the function of related cytokines, including IFN-γ, IL-4, and IL-17.

The interaction between Tim-3 and Galectin-9 contributes to the immune dysfunction of hepatocellular carcinoma,blocking Tim-3/Galectin-9 signaling can restore the function of effector T-cells in hepatitis B virus-associated hepatocellular carcinoma [46]. To further validate the effect of Tim-3/Galectin-9 pathway on CD4 T cell function in MM patients, we blocked the Tim-3/Galectin-9 pathway by adding anti-Tim-3 antibodies to cell cultures in vitro. In vitro Cell cultures study showed that blocking this pathway could accelerate the apoptosis of MM tumor cells, increase the secretion level of IFN-γ, and decrease the levels of IL-17 and IL-10 in the cell culture supernatant in vitro. Blocking the pathway is beneficial to reverse the failure of T cells, restore the function of CD4 T cells, correct the disturbance of their cytokine secretion, and thus restore anti-tumor immunity. These results suggested that Tim-3/Galectin-9 pathway may promote the progression of MM by inhibiting Th1 and enhancing the immune response of Th2 and Th17 cells. The immune function of CD4 T cells will be restored on the condition that the Tim-3/Galectin-9 pathway is blocked, thereby improving the prognosis of MM patients. Therefore, Tim-3/Galectin-9 signaling pathway may serve as a novel target of immunotherapy for MM patients. Individualized treatment can be provided for patients by closely monitoring the level of Tim-3/Galectin-9 pathway and timely adjusting the therapeutic regimen.

Authors' Comtributions

Jianhua Qu was designed the study concept. Rui Zhang was conducted experimental studies, analyzed data and prepared the manuscript. Shuang Chen and Tingting Luo was conducetd experimental studies. Sha Guo was analyzed the data. All authors have read and agreed to the published version of the manuscript.

Acknowledgements

Zhenghao Zhang, PhD is acknowledged for assistance with experiment.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

Natural Science Foundation of Xinjiang Uygur Autonomous Region [2022D01C754].