Effects of rutin supplementation on intestinal morphology, antioxidant capacity, immunity, and gut microbiota of laying hens fed a diet containing stored soybean meal

Abstract

Protein oxidation of soybean meal (SBM) during storage may have adverse effects on the intestinal health of laying hens. Moreover, rutin has anti-inflammatory and antioxidant properties which might be used as a feed additive to mitigate the intestinal damage caused by oxidised protein of SBM. This study aimed to investigate the effects of rutin supplementation on intestinal morphology, antioxidant capacity, immunity and caecal microbiota in laying hens fed a diet containing stored SBM. A total of 384 Hy-Line Brown laying hens (220 days) were randomly allocated into four groups with eight replicates of 12 laying hens each according to a 2 × 2 factorial arrangement with 2 types of SBM (FSM: SBM was stored in the cold storage warehouses at −20 °C for 45 days, and was considered as fresh and control SBM; RTSM: SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days) and 2 levels of rutin (0 and 500 mg/kg). The results showed that the RTSM diet decreased the ileal glutathione peroxidase (GSH-Px) activity, the jejunal superoxide dismutase 2 (SOD2) and ileal NAD(P)H: quinone oxidoreductase 1 (NQO1) mRNA expression levels (p < 0.05), and tended to decrease the jejunal superoxide dismutase 1 (SOD1), ileal glutathione peroxidase 1 (GPX1) and increase the jejunal interleukin-1β (IL-1β) and interleukin-4 (IL-4) mRNA expression levels. Dietary rutin decreased the jejunal crypt depth (CD) (p < 0.05), increased the jejunal total antioxidant capacity (T-AOC) and GSH-Px activities (p < 0.05), decreased the content of interferon-γ (IFN-γ) in the jejunum (p < 0.05), and significantly reduced levels of immunoglobulin G (IgG), IL-1β, tumour necrosis factor-α (TNF-α), IFN-γ, and IL-4 in the ileal mucosa (p < 0.05). Dietary rutin increased SOD2, nuclear factor E2-related factor 2 (Nrf2) and NQO1 mRNA expression levels in the jejunum and GPX1, Nrf2 and NQO1 mRNA expression levels in the ileum, and decreased nuclear factor-κB (NF-κB), IL-1β, IFN-γ and IL-4 mRNA expression in the jejunum and NF-κB, IL-1β, TNF-α, IFN-γ and IL-4 mRNA expressions in the ileum. What’s more, dietary rutin changed the caecal microbiota. PCoA analysis indicated significant structural differences among four groups (p < 0.05), and SBM × Rutin interactions were found in Actinobacteriota and unclassifiedk_norank_d_ Bacteria at the phylum level (p < 0.05). These results suggested that RTSM had slight adverse effects on the intestinal health, and dietary rutin improved intestinal morphology, exerted antioxidant and anti-inflammatory effects via Nrf2 and NF-κB signal pathways, and changed the composition of caecal microbiota.

Highlights

• The RTSM diet has adverse effects on the intestinal health of laying hens compared with the FSM diet.

• Dietary rutin improved the intestinal health by increasing the intestinal morphology, antioxidant capacity and anti-inflammatory effects.

• Dietary soybean meal and rutin changed the composition of caecal microbiota.

Keywords:

• Soybean meal
• rutin
• laying hen
• intestinal health
• immunity

Introduction

The gut barrier is composed of physical, chemical, immunological, and microbiological components, so gut health is determined by the properties of the intestinal wall and the properties of the microbes (Jeurissen et al. 2002). Multiple factors related to diets can negatively affect the delicate balance of components in the poultry gut, thereby affecting poultry’s health and performance (Yegani and Korver 2008). Oxidation reactions occur during the storage of food and feed proteins (Hellwig 2020). A study has shown that long-term storage of milk powder decreased its dispersibility, which was related to the level of protein carbonylation (Scheidegger et al. 2013). Later research showed that fish meal and chicken blood meal were prone to protein oxidation when stored at 45 °C and 20 °C, respectively (Frame et al. 2020b). SBM is an important raw material in feed due to its balanced amino acid composition and high protein (Beski et al. 2015). However, affected by raw material supply and market fluctuations, the storage of soybean was inevitable from production to animal intake. With the extension of storage time, the carbonyl content of protein in SBM increased, while the content of sulfhydryl decreased, then the protein oxidation of SBM occurred (Wu et al. 2014a; Hellwig 2020). Protein oxidation in diets impairs food functionality, reduces nutritional value, and alters physiological activities (Desbruslais and Wealleans 2022). The research found that heat-oxidised soy protein significantly increased protein carbonyl levels and decreased DPPH free radical-scavenging activity (Tang et al. 2012). Consumption of oxidised proteins may lead to oxidative stress of various tissues throughout the body (Estévez and Xiong 2019), and consumption of oxidised protein negatively affects the growth performance and immune function of broilers (Wu et al. 2014b; Chen et al. 2015). The heat-induced protein oxidation of SBM decreased growth performance and impaired the antioxidant status of broilers (Lu et al. 2019). According to the research, protein oxidised in SBM has a negative impact on the intestinal health of laying hens, such as reduced jejunal villus height and the ratio of villus height to crypt depth, etc (Wang et al. 2020).

Flavonoids are considered powerful antioxidants that prevent oxidative damage and reduce inflammation, and mainly through direct scavenging of free radicals and activation of signalling pathways related to antioxidant effects such as the Nrf2 signal pathway to up-regulate cellular antioxidant enzymes exert antioxidant effects (Rice-Evans et al. 1996; Kansanen et al. 2013; Zhang and Tsao 2016). Inflammation and oxidative stress are closely related events that are tightly linked with one another (Niestroy et al. 2011; Zhang et al. 2014; Zhang and Tsao 2016), flavonoids suppress NF-κB activated pro-inflammatory signal transduction, thereby attenuating oxidative stress and improving intestinal barrier function (Luescher et al. 2017). Rutin is a kind of flavonoid, which has various activities, such as antioxidant, anti-inflammatory, anticancer, anti-allergic and so on (Yong et al. 2020). Studies have shown that dietary rutin improved the growth performance, intestinal barrier function, immunity and antioxidant capacity of broilers, which may be related to the Nrf2 pathway (Chen et al. 2022). Rutin was also able to significantly reduce levels of reactive oxygen species (ROS) production and block the activation of NF-κB inflammatory signalling pathway (Liu et al. 2019).

Protein oxidation occurs during the storage of soybean meal, and the oxidation of protein in soybean meal may adversely affect the gut health of laying hens. Rutin may be used as a feed additive to alleviate the adverse effect of stored SBM protein oxidation on laying hens. However, little research has focused on the effect of rutin supplementation on intestinal health in laying hens fed a diet containing stored SBM. The purpose of this study is to investigate the effects and mechanisms of dietary rutin supplementation on intestinal morphology, antioxidant capacity, immunity and caecal microbiota of laying hens fed a diet containing stored SBM.

Materials and methods

Experimental design, diets, and management

All procedures were conducted under the guidelines of Nanjing Agricultural University Institutional Animal Care and Use Committee (Certification No.: SYXK(Su)2017-0007).

Rutin purity was confirmed to be 96% and was provided by Jiangsu Bison Biotechnology Co., Ltd. SBM was purchased from Yihai Grain and Oil Industry Co., Ltd. (Jiangsu, P.R. China). SBM was separated into two treatment groups: FSM (SBM was stored in the cold storage warehouses at −20 °C for 45 days, to reduce the protein oxidation of SBM, and was considered as fresh and control SBM) and RTSM (SBM was stored in room temperature warehouse (15 °C to 25 °C), average temperature was 20 °C for 45 days). Protein carbonyl and free sulfhydryl levels were 7.89 nmol/mg protein and 8.02 nmol/mg protein in FSM, and 9.4 nmol/mg protein and 6.58 nmol/mg protein in RTBM, respectively. A total of 384 220-day-old Hy-Line Brown laying hens purchased from a commercial farm were allocated into one of four treatments with eight replicates of 12 laying hens. Laying hens were allowed free access to feed and fresh drinking water. After a preliminary experiment over one week, the birds were allotted randomly to one of four dietary treatments: (1) CON: FSM-corn basal diet; (2) RT: RTSM-corn basal diet; (3) R: FSM-corn basal diet with 500 mg/kg rutin; (4) RT + R: RTSM-corn basal diet with 500 mg/kg rutin. The basal diet was formulated to satisfy the nutrient requirements of laying hens (Table 1, NRC 1994. The test period was eight weeks. The bird house was electrically and automatically controlled at 18-25 °C and 40-60% humidity in a 16-h/8-h light/dark cycle.

Table 1. Composition and nutrient level of basal diet (as fed basis unless otherwise stated).

Item	Content
Ingredient (%)
Corn	64
Soybean meal	24
Limestone	9
Premix^a	3
Calculated nutrient levels
Apparent metabolizable energy (MJ/kg)	11.04
Crude protein (%)	16.16
Lysine (%)	0.80
Methionine + cystine (%)	0.62
Methionine (%)	0.34
Calcium (%)	3.6
Total phosphorus (%)	0.56
Available phosphorus (%)	0.37

^aSupplied per kg of diet: Vitamin A, 10,000 IU; vitamin D3, 3000 IU; vitamin E, 30 IU; vitamin K3, 1 mg; vitamin B1, 1 mg; vitamin B2, 6 mg; vitamin B6, 3 mg; pantothenic acid, 10 mg; vitamin B12, 0.02 mg; nicotinamide, 40 mg; folic acid, 0.3 mg; biotin, 0.1 mg; choline chloride, 500 mg; Fe (ferrous sulfate), 80 mg; Cu (copper sulfate), 8 mg; Mn (manganese sulfate), 100 mg; Zn (zinc oxide), 65 mg; I (calcium iodate), 0.8 mg; Se (sodium selenite), 0.3 mg; calcium, 3.6 g; phosphorus, 2.4 g; methionine, 1 g; sodium chloride, 3 g.

Sample collection

One bird per replication (8 birds per treatment, a total of 32 birds) was randomly selected for sampling on day 57 of the experiment. After laying hens were slaughtered, the jejunal and ileal tissues were rinsed immediately and flushed several times with ice-cold phosphate-buffered saline (pH = 7.4). The middle sections of the jejunum and ileum were taken aseptically and then put in a 4% paraformaldehyde-PBS for intestinal histomorphology. Moreover, the jejunal and ileal mucosa were scraped from the underlying tissue and stored in liquid nitrogen and stored at −80 °C. In addition, caecal contents were collected and then frozen in liquid nitrogen and kept at −80 °C for microbiota analysis.

Intestinal morphology

Use haematoxylin-eosin staining (HE) to measure jejunal and ileal morphology. In brief, the jejunum and ileum tissues were fixed with 4% paraformaldehyde-PBS. Then, the samples were processed by dehydrating, embedding, and sectioning. Slice the tissues with a microtome into 5 µm slices, and the sections were stained with HE. Villus height (VH) and crypt depth (CD) were measured.

Mucosal antioxidant parameters assay

Measurements of jejunal and ileal malondialdehyde (MDA) level, activities of total superoxide dismutase (T-SOD), T-AOC, and GSH-Px were performed using corresponding assay kits according to the manufacturer’s instructions (Nanjing Jiancheng Bio Co., Ltd., Nanjing, China).

Immunoglobulin and inflammatory cytokine assay

Elisa kits were used to assay the concentrations of secretory immunoglobulin A (sIgA), IgG, immunoglobulin M (IgM), IL-1β, IL-4, TNF-α, and IFN-γ in the tissue homogenates of the jejunum and ileum in accordance with the manufacturer’s instructions (Nanjing Jiancheng Bio Co., Ltd., Nanjing, China).

Quantitative Real-Time PCR

Total RNA was isolated from the tissues (intestinal mucosa) using RNAiso Plus (TaKaRa, Dalian, China). The concentration and purity of RNA were measured using Nano Drop ND-1000 (Nano Drop Technologies, Wilmington, DE) of optical density at 260 and 280 nm, and then, cDNA was synthesised using the Prime Script RT Master Mix reagent kit in accordance with the manufacturer’s instructions (TaKaRa, Dalian, China). Real-time PCR was carried out using a SYBR Premix Ex Taq Kit (TaKaRa, Dalian, China) in a 7300 Real-Time PCR System (Applied Biosystems). The expression abundance of target genes was normalised to that of β-actin, and the relative expression levels of the target genes were calculated according to the 2^-△△CT method (Livak and Schmittgen 2001). The primers including GPX1, SOD1, SOD2, Nrf2, Kelch-like ECH-associated protein 1 (Keap1), NQO1, NF-κB, IL-1β, IL-4, TNF-α, IFN-γ, and β-actin and their gene bank ID numbers are listed in Table 2.

Table 2. Sequences for real-time PCR primers.

Genes^a	Gene Bank ID	Primer Sequence (5'-3')		Product length (bp)
GPX1	NM_001277853.1	F	CGCTACAGCCGCCACTT	287
		R	TTCGGAGAATCCCACAACG
SOD1	NM_205064.1	F	TTGTCTGATGGAGATCATGGCTTC	98
		R	TGCTTGCCTTCAGGATTAAAGTGAG
SOD2	NM_204211.1	F	CAGATAGCAGCCTGTGCAAATCA	86
		R	GCATGTTCCCATACATCGATTCC
Nrf2	NM 205117.1	F	GATGTCACCCTGCCCTTAG	216
		R	CTGCCACCATGTTATTCC
Keap1	XM_010728179.1	F	TTCCACGCCTGCATCAACT	203
		R	GGTTTGTGCAGGGTGAGG
NQO1	NM_001277619.1	F	GTTCAATGCCGTGCTCTCAC	146
		R	CCGCTTCAATCTTCTTCTGC
NF-κB	NM_205134.1	F	AGGACTTAAAATGGCAGGAGAG	141
		R	GCTGTTCGTAGTGGTAAGTCTG
IL-1β	NM_204524.1	F	TGCCTGCAGAAGAAGCCTCG	204
		R	GACGGGCTCAAAAACCTCCT
TNF-α	NM204267	F	TGTGTATGTGCAGCAACCCGTAGT	229
		R	GGCATTGCAATTTGGACAGAAGT
IFN-γ	NM_205149.1	F	ATGTAGCTGACGGTGGACCT	196
		R	TTCACGCCATCAGGAAGGTT
IL-4	NM_001007079.1	F	GTGCCCACGCTGTGCTTAC	82
		R	AGGAAACCTCTCCCTGGATGTC
β-actin	NM_205518	F	TGCTGTGTTCCCATCTATCG	150
		R	TTGGTGACAATACCGTGTTCA

^aGPX1: glutathione peroxidase 1; SOD1: superoxide dismutase 1; SOD2: superoxide dismutase 2; Nrf2: nuclear factor E2-related factor 2; Keap1: Kelch-like ECH-associated protein 1; NQO1: NADPH:quinone oxidoreductase 1; NF-κB: nuclear factor-κB, IL-1β: interleukin-1β; TNF-α: tumour necrosis factor-α; IFN-γ: interferon-γ; IL-4: interleukin-4.

16S rRNA gene sequencing and bioinformatics analysis

Total DNA was isolated from the caecal contents using the QIAamp DNA Stool Mini Kit (QIAGEN, Dusseldorf, Germany). Bacterial 16S rRNA gene sequences (V3-V4) were amplified with the 338 F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806 R (5′-GGACTACHVGGGTWTCTAAT-3′) primers. Amplicons were measured and purified before being sequenced on an Illumina MiSeq Sequencer. Majorbio Cloud Platform, a free web platform, was used to evaluate all the data (www.majorbio.com). The sequences were examined and classified into operational taxonomic units (OTUs) with 97% identity. Analysis of microbial community diversity at phylum and family levels were investigated and displayed on a bar map. Alpha diversity was visualised by Chao1, ACE, Shannon, and Simpson indices, and beta diversity was visualised by principal component analysis (PCoA).

Statistical analysis

The data were presented as mean and standard error of the means (SEM). The major effects of SBM, rutin, and their interactions were investigated by a general linear model (GLM) in SPSS 19.0 software. One-way analysis of variance (ANOVA) was performed, and Tukey’s multiple comparison test were used to assess differences between groups. Moreover, the difference was considered significant at p < 0.05. The ANOVA test with P between 0.05 and 0.10 was considered a trend towards significance.

Results

Intestinal morphology

As shown in Table 3 and Figure 1, there was no significant effect on the intestinal morphology of RTSM diet compared with the FSM diet (p > 0.05). Diet with 500 mg/kg rutin increased the CD in the jejunum (p < 0.05), and tended to increase the VH in the jejunum (p = 0.073) and VH/CD in the ileum (p = 0.072). Dietary supplementation of stored SBM and rutin had no significant interaction effect on the intestinal morphology of laying hens (p > 0.05).

Figure 1. Effects of rutin on the intestinal morphology of laying hens fed a diet containing stored soybean meal. (A) representative images of the jejunum of laying hens, stained with haematoxylin-eosin staining (HE); (B) representative images of the ileum of laying hens, stained with haematoxylin-eosin staining (HE); CON: a basal diet with soybean meal stored in cold storage warehouse; RT: a basal diet with soybean meal stored in room temperature warehouse; SBM: soybean meal; R: rutin.

Table 3. Effects of rutin on the intestinal morphology of laying hens fed a diet containing stored soybean meal.

Items^a	Groups^b				SEM^c	P-value^d
	CON	RT	R	RT + R		SBM	R	SBM × R
Jejunum
VH (μm)	990.94	720.31	1021.12	1014.20	47.06	0.122	0.073	0.141
CD (μm)	169.67	138.32	178.39	193.52	7.92	0.589	0.040	0.128
VH/CD	6.22	5.38	6.11	5.53	0.25	0.166	0.975	0.801
Ileum
VH (μm)	816.99	648.34	806.03	830.54	32.72	0.262	0.185	0.136
CD (μm)	179.47	140.59	166.79	150.94	8.25	0.107	0.944	0.489
VH/CD	4.88	4.85	5.24	5.96	0.20	0.394	0.072	0.347

^aVH: villus height; CD: crypt depth; VH/CD: villus height/crypt depth.

^bCON: a basal diet with soybean meal stored in cold storage warehouse; RT: a basal diet with soybean meal stored in room temperature warehouse; SBM: soybean meal; R: rutin.

^cSEM: standard error of mean.

^dSBM: soybean meal.

Intestinal antioxidant indexes

As illustrated in Table 4, compared with the FSM diet, the RTSM diet significantly increased the T-AOC level of the jejunum (p < 0.05). The addition of rutin increased the T-AOC activity of the jejunum (p < 0.05), and tended to increase T-SOD activity (p = 0.056). SBM and rutin had significant interaction effects on jejunal T-SOD and T-AOC activities of laying hens (p < 0.05). Meanwhile, in the ileum, compared with the FSM diet, the RTSM diet significantly decreased the ileal GSH-Px activity (p < 0.05). Dietary rutin increased the ileal GSH-Px activity (p < 0.05). However, no SBM × Rutin interaction was discovered in antioxidant indexes in the ileum (p > 0.05).

Table 4. Effects of rutin on antioxidant indices in the intestinal mucosa of laying hens fed a diet containing stored soybean meal.

Items^c	Groups^d				SEM^e	P-value^f
	CON	RT	R	RT + R		SBM	R	SBM × R
Jejunum
MDA (nmol/mg prot.)	1.01	1.00	1.20	1.17	0.06	0.841	0.131	0.947
T-SOD (U/mg prot.)	175.61^b	194.11^ab	222.80^a	188.67^ab	5.86	0.461	0.056	0.018
T-AOC (U/mg prot.)	0.94^b	0.84^b	1.31^b	2.68^a	0.16	0.002	<0.001	<0.001
GSH-Px (U/mg prot.)	17.64	22.54	14.97	15.88	1.88	0.450	0.229	0.603
Ileum
MDA (nmol/mg prot.)	0.79	1.05	0.79	0.34	0.15	0.748	0.237	0.240
T-SOD (U/mg prot.)	215.39	231.74	217.60	215.90	6.03	0.560	0.588	0.474
T-AOC (U/mg prot.)	0.70	0.72	0.76	0.70	0.06	0.889	0.880	0.760
GSH-Px (U/mg prot.)	60.64^b	36.28^b	104.5^a	67.1^ab	6.67	0.007	0.001	0.543

^a,bMeans within a row with different superscripts are different at p < 0.05.

^cMDA: malondialdehyde; T-SOD: total superoxide dismutase; T-AOC: total antioxidant capacity; GSH-Px: glutathione peroxidase.

^dCON: a basal diet with soybean meal stored in cold storage warehouse; RT: a basal diet with soybean meal stored in room temperature warehouse; SBM: soybean meal; R: rutin.

^eSEM: standard error of mean.

^fSBM: soybean meal.

Immunoglobulin and cytokine concentration in the intestine

The results of immunoglobulin and inflammatory cytokine in the intestinal mucosa were summarised in Table 5. The stored SBM diet had no significant effect on immunoglobulin and cytokines in the jejunal and ileal mucosa of laying hens (p > 0.05). Supplementing rutin in the diet significantly reduced the content of IFN-γ (p < 0.05), and had a tendency to decrease the content of TNF-α in the jejunum (p = 0.071), and significantly reduced levels of IgG, IL-1β, TNF-α, IFN-γ, and IL-4 in the ileum (p < 0.05). SBM × Rutin interactions were observed for levels of TNF-α and IFN-γ in the jejunum (p < 0.05), and tended to be significant on levels of sIgA (p = 0.087), IgG (p = 0.094) and IgM in the jejunum (p = 0.075).

Table 5. Effects of rutin on immunoglobulin and inflammatory cytokine in the intestinal mucosa of laying hens fed a diet containing stored soybean meal.

Items^c	Groups^d				SEM^e	P-value^f
	CON	RT	R	RT + R		SBM	R	SBM × R
Jejunum
sIgA (μg/mg prot.)	2.22	2.42	2.33	2.10	0.06	0.916	0.371	0.087
IgG (μg/mg prot.)	95.60	102.51	100.48	94.60	1.85	0.889	0.685	0.094
IgM (μg/mg prot.)	11.54	12.88	11.87	10.74	0.35	0.880	0.187	0.075
IL-1β (pg/mg prot.)	5.04	5.02	5.72	4.95	0.15	0.180	0.303	0.198
TNF-α (pg/mg prot.)	17.34^ab	19.07^a	17.51^ab	15.85^b	0.44	0.966	0.071	0.046
IFN-γ (pg/mg prot.)	22.11^ab	25.47^a	20.44^b	18.07^b	0.71	0.655	<0.001	0.014
IL-4 (pg/mg prot.)	8.48	8.36	8.86	8.10	0.18	0.233	0.874	0.391
Ileum
sIgA (μg/mg prot.)	1.53	1.37	1.42	1.35	0.04	0.123	0.374	0.529
IgG (μg/mg prot.)	81.52	80.42	74.77	73.37	1.68	0.707	0.045	0.965
IgM (μg/mg prot.)	7.12	7.54	7.02	7.46	0.34	0.549	0.901	0.988
IL-1β (pg/mg prot.)	5.12^ab	5.37^a	4.17^b	4.17^b	0.17	0.667	0.001	0.662
TNF-α (pg/mg prot.)	18.17^a	19.46^a	14.80^b	14.90^b	0.52	0.380	<0.001	0.451
IFN-γ (pg/mg prot.)	17.60^a	18.97^a	11.67^b	12.54^b	0.70	0.213	<0.001	0.780
IL-4 (pg/mg prot.)	9.01^a	9.33^a	6.24^b	5.89^b	0.35	0.982	<0.001	0.443

^a,bMeans within a row with different superscripts are different at p < 0.05.

^csIgA: secretory immunoglobulin A; IgG: immunoglobulin G; IgM: immunoglobulin M; IL-1β: interleukin-1β; TNF-α: tumour necrosis factor-α; IFN-γ: interferon-γ; IL-4: interleukin-4.

^dCON: a basal diet with soybean meal stored in cold storage warehouse; RT: a basal diet with soybean meal stored in room temperature warehouse; SBM: soybean meal; R: rutin.

^eSEM: standard error of mean.

^fSBM: soybean meal; R: rutin.

Antioxidant and immunity related mRNA expression

Effects of rutin on the mRNA levels of antioxidant and immune function associated genes in the jejunal and ileal mucosa of laying hens fed a diet containing stored SBM were demonstrated in Table 6. The RTSM diet decreased the mRNA level of SOD2 (p < 0.05), and tended to decrease the mRNA expressions of SOD1 (p = 0.050) and increase the mRNA expressions of IL-1β (p = 0.050) and IL-4 (p = 0.054) in the jejunal mucosa. Dietary supplementation of rutin significantly raised the mRNA expressions of SOD2, Nrf2 and NQO1 (p < 0.05), but decreased the mRNA expressions of NF-κB, IL-1β, IFN-γ and IL-4 (p < 0.05). The addition of stored SBM and rutin had significant interaction effects on the SOD1, SOD2 and IL-1β mRNA expressions in the jejunum (p < 0.05). The RTSM diet significantly decreased the mRNA expression levels of NQO1 (p < 0.05), and tended to decrease the mRNA expression of GPX1 in the ileum of laying hens (p = 0.095). Rutin supplementation significantly increased the mRNA expression levels of GPX1, Nrf2 and NQO1, but decreased the mRNA expression levels of NF-κB, IL-1β, TNF-α, IFN-γ and IL-4 in the ileal mucosa (p < 0.05). In addition, there were trends of interactive effects of SBM and rutin on TNF-α (p = 0.067) and IL-4 (p = 0.067) the mRNA expressions in the ileum.

Table 6. Effects of rutin on mRNA levels of antioxidant and immune function related genes in the intestinal mucosa of laying hens fed a diet containing stored soybean meal.

Items^d	Groups^e				SEM^f	P-value^g
	CON	RT	R	RT + R		SBM	R	SBM × R
Jejunum
GPX1	1.00	0.86	1.28	1.03	0.11	0.369	0.296	0.819
SOD1	1.00^ab	1.05^ab	1.23^a	0.85^b	0.05	0.050	0.879	0.011
SOD2	1.00^b	0.96^b	2.12^a	1.01^b	0.12	0.003	0.002	0.005
Nrf2	1.00	1.10	1.18	1.22	0.03	0.279	0.025	0.692
Keap1	1.00	1.23	0.89	1.06	0.08	0.220	0.371	0.846
NQO1	1.00^b	1.03^ab	1.23^a	1.19^ab	0.03	0.966	0.003	0.567
NF-κB	1.00^a	0.88^ab	0.41^c	0.52^bc	0.06	0.938	<0.001	0.253
IL-1β	1.00^a	1.01^a	0.60^b	0.95^a	0.07	0.050	0.002	0.057
TNF-α	1.00	0.85	1.12	0.73	0.08	0.103	0.978	0.454
IFN-γ	1.00^a	1.08^a	0.47^b	0.38^b	0.07	0.971	<0.001	0.441
IL-4	1.00^ab	1.18^a	0.59^c	0.74^bc	0.06	0.054	<0.001	0.628
Ileum
GPX1	1.00^ab	0.78^b	1.86^a	1.30^ab	0.13	0.095	0.005	0.452
SOD1	1.00	0.98	0.93	0.92	0.05	0.897	0.534	0.951
SOD2	1.00	1.17	1.41	0.86	0.15	0.537	0.871	0.247
Nrf2	1.00	1.12	1.20	1.29	0.04	0.197	0.033	0.872
Keap1	1.00	0.73	1.12	0.92	0.09	0.223	0.423	0.855
NQO1	1.00^b	0.88^b	1.44^a	1.22^ab	0.05	0.013	<0.001	0.419
NF-κB	1.00^a	0.82^ab	0.46^b	0.55^b	0.06	0.665	0.001	0.232
IL-1β	1.00	0.97	0.64	0.85	0.06	0.418	0.038	0.288
TNF-α	1.00^ab	1.15^a	0.96^ab	0.84^b	0.04	0.824	0.023	0.067
IFN-γ	1.00	1.10	0.85	0.89	0.05	0.441	0.049	0.694
IL-4	1.00^a	1.11^a	0.81^ab	0.62^b	0.05	0.630	<0.001	0.067

^a,b,cMeans within a row with different superscripts are different at p < 0.05.

^dGPX1: glutathione peroxidase 1; SOD1: superoxide dismutase 1; SOD2: superoxide dismutase 2; Nrf2: nuclear factor E2-related factor 2; Keap1: Kelch-like ECH-associated protein 1; NQO1: NADPH: quinone oxidoreductase 1; NF-κB: nuclear factor-κB, IL-1β: interleukin-1β; TNF-α: tumour necrosis factor-α; IFN-γ: interferon-γ; IL-4: interleukin-4.

^eeCON: a basal diet with soybean meal stored in cold storage warehouse; RT: a basal diet with soybean meal stored in room temperature warehouse; SBM: soybean meal; R: rutin.

^fSEM: standard error of mean.

^gSBM: soybean meal.

Caecal microbiota communities

Compared with the FSM diet, the RTSM diet had no significant effect on α-diversity of caecal microbiota (Figure 2, p > 0.05). Dietary supplementation of rutin significantly increased the Simpson index (Figure 2D, p < 0.05). However, no SBM × Rutin interaction was found in α-diversity (Figure 2, p > 0.05). PCoA analysis was used to investigate the similarity or difference of sample community composition. The contribution rates of the first principal axis (PC1) and the second principal axis (PC2) to sample clustering are 17.3% and 13.07%, respectively, and PCoA analysis indicated significant structural differences among four groups (Figure 3, p < 0.05).

Figure 2. Alpha diversity. (A) Chao1; (B) ACE; (C) Shannon; (D) Simpson; values on each bar with no common letter differ significantly (p < 0.05); CON: a basal diet with soybean meal stored in cold storage warehouse; RT: a basal diet with soybean meal stored in room temperature warehouse; SBM: soybean meal; R: rutin.

Figure 3. Principal coordinates analysis (PCoA); CON: a basal diet with soybean meal stored in cold storage warehouse; RT: a basal diet with soybean meal stored in room temperature warehouse; SBM: soybean meal; R: rutin.

At the phylum level (Figure 4A), Bacteroidota and Firmicutes were the dominant microbiota. SBM × Rutin interactions were found in Actinobacteriota and unclassifiedk_norank_d_ Bacteria at the phylum level (p < 0.05). Compared with the CON group (Figure 4B), the abundance of Actinobacteriota was significantly increased in the R group, the unclassifiedk_norank_d_Bacteria abundance was significantly decreased in RT and R groups (p < 0.05). The microbiota composition at the family level was shown in Figure 4C. At the family level (Figure 4D), the relative abundance of Lachnospiraceae was significantly decreased in the group supplemented with rutin (p < 0.05). SBM × Rutin interaction was significant difference in Ruminococcaceae at the family level (p < 0.05) and the relative abundance of Ruminococcaceae in R group was greatest.

Figure 4. Composition and distribution of caecal microbiota at phylum and family levels of laying hens. (A) overall microbiota compositions at the phylum level; (B) the relative abundances of microbiota at the phylum level; (C) overall microbiota compositions at the family level; (D) the relative abundances of microbiota at the family level; values on each bar with no common letter differ significantly (p < 0.05); CON: a basal diet with soybean meal stored in cold storage warehouse; RT: a basal diet with soybean meal stored in room temperature warehouse; SBM: soybean meal; R: rutin.

Discussion

The small intestine epithelium is widely folded into crypts and villi, which not only enhance the absorptive surface area for nutrients, electrolytes, and water, but also form the physical barrier of the intestine (Circu and Aw 2012; Feng et al. 2017; Patra et al. 2019). The transition of intestinal cells to proliferative and growth arrest is thought to be mediated by the biological redox balance of cellular signalling events (Sandstrom et al. 1995; Circu and Aw 2012; Rosero et al. 2015). Jejunal crypt depth showed a positive linear relationship with dietary spray-dried bovine plasma protein oxidation levels in growing pigs fed a diet containing oxidised protein (Frame et al. 2020a). In this study, compared with the FSM diet, the RTSM diet had no significant effect on intestinal morphology in laying hens. This might be related to the experimental animal species and the level of oxidation of SBM proteins. Weaned rats’ jejunal morphology was enhanced by increasing jejunal VH after receiving an additional 500 mg/kg rutin in their diet for 21 days (Zhang et al. 2022). The study revealed that dietary rutin supplementation increased jejunal VH and VH/CD in aged laying hens (Li et al. 2022b). In this study, diet with rutin increased the CD of the jejunum and tended to increase the VH of the jejunum and the VH/CD ratio of the ileum in laying hens. The results indicated that rutin supplementation could improve the intestinal health by affecting the intestinal morphology of laying hens.

Protein oxidation of raw materials induced in different ways leads to changes in the intestinal antioxidant status of body (Tang et al. 2012; Lu et al. 2019). Previous study found that the heat-oxidised soy protein increased levels of ROS and MDA in serum and tissues as well as decreased T-AOC and antioxidant enzyme activities in mice (Tang et al. 2012). The heated SBM diet increased the jejunal ROS levels and MDA concentrations, additionally, decreased the total SOD and GSH-Px activities in broilers (Lu et al. 2019). In this study, the RTSM diet decreased ileal GSH-Px activity affected by oxidation of proteins in stored SBM. Meanwhile, dietary supplementation with rutin increased the activity of T-AOC in the jejunum and GSH-Px in the ileum and tended to increase the activity of T-SOD in the jejunum. It is similar to that dietary rutin could increase the activities of SOD and T-AOC of broiler jejunal mucosa (Chen et al. 2022). This indicated that dietary RTSM with protein oxidation may reduce the activities of intestinal antioxidant enzymes, and dietary rutin can alleviate the adverse effects of RTSM on the intestine.

According to studies, the formation and expression of the regional immune system in the gastrointestinal tract is generally independent of systemic immunity (Cunningham-Rundles and Lin 1998). Nutrients have fundamental and regulatory effects on the immunological response of the gastrointestinal tract, and therefore, on host defense (Cunningham-Rundles and Lin 1998). The chicken gut-associated lymphoid tissue is made up of many tissues and cells that are in responsible for generating mucosal immune responses and maintaining intestinal homeostasis (Brisbin et al. 2008). Research has shown that protein oxidised SBM diets significantly increased the contents of IL-1β in the duodenum and IL-6 and TNF-α in the ileum of laying hens (Wang 2019). However, in this study, the impact of RTSM on intestinal immunoglobulin and cytokine content was not significant. This may be related to the degree of oxidation of stored soybean meal and the feeding environment. Studies have shown that supplementation of polyphenols with normal or high-fat diets can increase sIgA level (Pierre et al. 2014). In this study, dietary rutin significantly reduced IFN-γ, and tended to reduce the content of TNF-α, while reducing ileal IgG, IL-1β, TNF-α, INF-γ and IL-4 content in the jejunum of laying hens. The results showed that rutin had an anti-inflammatory effect on laying hens. Studies have indicated that rutin had an anti-inflammatory effect in the LPS-induced mouse mastitis model, manifested by inhibition of NF-κB pathway activation (Su et al. 2019). What’s more, the study has demonstrated that dietary supplementation of rutin regulated immune indicators by regulating the expression of intestinal immune genes of aged laying hens (Li et al. 2022b).

Further evaluation of gut mucosal anti-inflammatory and antioxidant genes found that RTSM has a slight adverse effect on intestinal antioxidant capacity and immunity at the genetic level, and the addition of stored SBM and rutin had significant interaction effects on the SOD1, SOD2 and IL-1β mRNA expressions in the jejunal mucosa and ileal mucosal TNF-α and IL-4 the mRNA expressions. Oxidative stress was directly related to inflammation, as oxidants in the body were activators of NF-κB, which a key regulator of inflammation (Gessner et al. 2017).The study has shown that flavonoids have anti-inflammatory effects in vitro and in vivo by inhibiting the activation of NF-κB and inducing Nrf2 to trigger antioxidant and cytoprotective effects (Rahman et al. 2006). Studies showed that rutin decreased oxidative stress or oxidative impairment via Nrf2 signalling pathway (Tian et al. 2016; Singh et al. 2019). In this study, diet with rutin up-regulated the mRNA expression levels of SOD2, Nrf2 and NQO1 in the jejunum and GPX1, Nrf2 and NQO1 in the ileum, but decreased the mRNA expression levels of NF-κB, IL-1β, IFN-γ and IL-4 in jejunal mucosa and NF-κB, IL-1β, TNF-α, IFN-γ and IL-4 in ileal mucosa. Dietary with 500 mg/kg rutin decreased the NF-κB, IL-2 and TNF-α mRNA expressions and upregulated mRNA expressions of genes related to intestinal antioxidant capacity in jejunal mucosa of broilers, and the results were similar to our findings (Chen et al. 2022). Study showed that rutin had an anti-inflammatory effect in the LPS-induced mouse mastitis model, manifested by inhibition of NF-κB pathway activation (Su et al. 2019). This suggested that rutin activated the Nrf2 signal pathway but inhibited NF-κB signalling pathways, thereby exerting antioxidant and immune regulation effects of laying hens fed a diet containing stored SBM.

The gut immune system defends against infections and the entry of excessive intestinal microbes while also maintaining immune tolerance to existing intestinal bacteria (Abraham and Medzhitov 2011). The research showed that oxidised rice bran protein affected the α-diversity of the gut microbiota and influenced the microbial composition at the phylum and genus levels in mice (Li et al. 2022a), and the protein oxidation induced by high-oxidative damaged pork also altered the gut microbiota of mice (Ge et al. 2020). In this study, the RTSM diet had no significant effect on caecal microbiota. SBM and rutin had a significant interaction effect on Actinobacteriota and unclassifiedk_norank_d_Bacteria at the phylum level. This might be related to protein source and storage conditions. Previous studies showed that dietary polyphenol supplementation increased the sIgA level, and the mechanism may be relevant to the gut microbiota (Han et al. 2023). In this experiment, the results showed that there were differences in caecal microbiota at both phylum and family levels among groups. Dietary rutin decreased the Lachnospiraceae at the family level. The study showed that Lachnospiraceae were associated with quercetin (a metabolite of rutin) production (Riva et al. 2020). It showed that rutin’s regulation of caecal microbiota may be related to its secondary metabolite quercetin. It has been reported that rutin significantly reduced the abundance of rumen microbes (Oskoueian et al. 2013). It was suggested that changes in the caecal microbiota were closely related to the antibacterial effect of rutin and the metabolism of microorganisms on rutin.

Conclusions

In conclusion, RTSM had slight adverse effects on the intestinal health, and dietary rutin improved intestinal morphology, exerted antioxidant and anti-inflammatory effects via Nrf2 and NF-κB signal pathways, and changed the composition of caecal microbiota.

Disclosure statement

No potential conflict of interest was reported by the authors.

Data availability statement

The data that support the findings of this study are available from the corresponding author, Yanmin Zhou, upon reasonable request.

Additional information

Funding

This work was supported by the Nutrition Regulation Innovation Team of Jiangsu Modern Agricultural Industry (Laying Hens) Technology System [grant numbers 61KA210022].