Expression patterns and changes of the LCN2 gene in the testes of induced cryptorchidism and busulfan-treated mice

ABSTRACT

Lipocalin-2 (LCN2) was known to play various roles in different type cells; however, little was known about the effect of LCN2 in male fertility. In this study, we aimed to explore the expression pattern of LCN2 with increasing age in mice, and to obtain insight into the role of LCN2 in mice testes by induced cryptorchidism and busulfan-treated infertility. In situ hybridization showed that LCN2 was localized primarily in Leydig cells, but was absent in Sertoli and germ cells. Its expression in testes exhibited an age-related increase from day 1 to 8 months, then reduced by the twelth month. The mRNA and protein levels of LCN2 in the testes of both infertile models increased as measured by real-time PCR and western blotting, respectively. LCN2 mRNA and protein levels were higher (p<0.05) in busulfan treated mice than that of cryptorchidism. These observations have shown that LCN2 is developmentally regulated and highly expressed in the Leydig cells of mouse testes.

KEYWORDS:

• Cryptorchidism
• lipocalin-2
• male reproduction
• testis

Introduction

The lipocalin family is a large group of small extracellular proteins [Flower 1996] and it is found in plants, vertebrates, even insects [Guyonnet et al. 2009]. They are involved in the transport or storage of hydrophobic and chemically sensitive organic compounds, especially vitamins, lipids, steroids, and other secondary metabolites [Salier et al. 2004]. Lipocalin-2 (LCN2) is a recently characterized adipocytokine secreted primarily by adipose tissue. It has well established roles in the induction of apoptosis in hematopoietic cells, modulation of inflammation, and metabolic homeostasis [Lin et al. 2011; Zhang et al. 2014; Abella et al. 2015], and may play a role in male fertility. LCN2 is a 25-kDa lipocalin originally purified from human neutrophils and is highly expressed in rodent caput epididymis [Liu et al. 1997; Suzuki et al. 2004]. Early spermatogonia regulate LCN2 mRNA expression via the nuclear factor kappa-β pathway [Tanaka et al. 2002; Fujino et al. 2006]. It can also bind to sperm membranes and induce lipid raft movement to promote sperm capacitation [Watanabe et al. 2014].

Normally, in most mammals, spermatogenesis occurs continuously in the testes, which are located in the scrotum. The formation of adult Leydig cells is a continuous process which involves the gradual transformation of progenitors into the mature cell type [Chamindrani Mendis-Handagama and Siril Ariyaratne 2001]. Cryptorchidism can induce reversible oligospermia or azoospermia in rodents and humans via increased germ cell apoptosis [Li et al. 2015]. In the testes of cryptorchid mice, although spermatogonial germ cells are present their further differentiation is blocked [Beamer et al. 1988]. The seminiferous tubules of cryptorchid mice consist of Sertoli cells and undifferentiated type A spermatogonia [Kojima et al. 1997]. Leydig cells with degenerative nuclei have been observed in cryptorchid mice [Jung et al. 2015a]. Cryptorchidism can be experimentally induced. Some reports indicated a reduced serum testosterone level after 7 days of cryptorchidism in rat, that subsequently returns to a normal level by approximately day 28 [Risbridger et al. 1981; Sengupta 2013]. Busulfan (1,4-butanediol dimethanesulfonate) can induce prolonged azoospermia [Sanders et al. 1996]. In the testis, busulfan preferentially kills spermatogonial stem cells (SSCs). Greater than 95% SSCs can be lost, without affecting testicular somatic cell number, including Sertoli cells [Zohni et al. 2012]. Busulfan treatment significantly altered the steroidogenic environment in mice but did not affect Leydig cell number.

To date, male infertility rates of couples worldwide is approximately 3.5% and idiopathic infertility is mainly of genetic origin [Nishimune and Tanaka 2006; Krausz and Giachini 2007]. The identification of testes-specific factors is essential to develop tools to study the mechanisms of spermatogenesis to treat infertility. Here, we analyzed the pattern of LCN2 expression with increasing age in mice. We further compared LCN2 mRNA and protein levels in the testes of two different infertile mouse models to obtain insight into the role of LCN2.

Results and discussion

Expression patterns of the LCN2 in the mouse testes

Previous studies showed that LCN2 is involved in the development and maturity of sperm, however, its pattern of expression and regulation in the testes is not clear. Our initial step in studying LCN2 was to determine which cells in the mouse testes were the source of LCN2 mRNA. We utilized in situ hybridization of adult mouse testes and the results indicated that the LCN2-specific hybridization signals were primarily limited to Leydig cells. Sertoli and germ cells showed a lack of expression (Figure 1). We next assessed whether LCN2 expression was developmentally-regulated. We detected our initial hybridization signals in 30 days after birth, the strongest positive signal occurred from 40 days to 8 months of age, then decreased by 12 months of age (Figure 1). These results indicate that LCN2 expression occurs in Leydig cells and is regulated developmentally.

Figure 1. In situ hybridization (ISH) of Lipocalin-2 (LCN2) mRNA from CD-1 mice of different ages. Testes tissues were collected at different ages and assessed by ISH. The figure showed LCN2 was mainly expressed in Leydig cells. Day 1, 10, 20, and 30 testis had almost no ISH signals. Day 40 and 60, month 4 and 8 testis showed strong positive signals. And the signals were decreased in month 12 testis. D: days; M: months; Bar = 100 μm.

Similar reports have shown that LCN2 is expressed equally in both the germ and somatic cell fractions from 3-week-old testes [Tanaka et al. 2002; Fujino et al. 2006]. We identified a pattern of LCN2 expression from 1 day to 12 months after birth in normal CD-1 mice, there was no obvious LCN2 signal until 30 days after birth; the strongest positive signal occurred from 40 days to 8 months of age, then decreased in 12 months of age. It was similar to testosterone, which had age-dependence. In postnatal days 7, 21, 35, 90, and 20 months, testosterone synthesis in Leydig cells was none, low, intermediate, high, intermediate, respectively [Chen et al. 2009]. The decrease of testosterone is often accompanied by a series of clinical manifestations, such as infertility [Emmelot-Vonk et al. 2008]. This age-dependence of LCN2 expression was related to Leydig cell synthesis and secretion of testosterone during testicular differentiation. A role for LCN2 in the regulation of cell differentiation has been previously shown in adipogenesis, oral squamous cell carcinoma, and spermatogenesis [Tanaka et al. 2002; Lin et al. 2012; Lilja et al. 2012].

Pathology of testes in induced cryptorchidism and busulfan-treated mice

To begin to elucidate the function of LCN2, bilateral cryptorchid mice were created or treated with busulfan to induce infertility. Busulfan, an alkylating agent, causes a time-dependent apoptosis of germ cell populations [O’Shaughnessy et al. 2008]. Cryptorchidism typically results in hypo-spermatogenesis with Leydig cell degeneration and impaired testicular function [Jung et al. 2015a], this is due to germ cell apoptosis mainly in spermatocytes and round spermatids. As our results showed, testes size was reduced with bilateral cryptorchidism at 30 days after the procedure (Figure 2A). Histopathological examination indicated that some tubules contained only elongated spermatids and Sertoli cells. Significant epithelial damage and a narrowing of the seminiferous tubules and nearly all tubules were devoid of germ cells in the busulfan-treated mice but not in cryptorchidism model. There was a complete absence of highly differentiated cells (Figure 2B and 2C). After 30 days the size of the busulfan-treated mice testes had also decreased (Figure 2A). It is reduced steroid secretion from Leydig cells that eventually leads to testicular atrophy [Dutta et al. 2013]. Only a single layer of cells next to the basement membranes remained after a 30-day busulfan treatment (Figure 2B and C). These results agree with those previously reported [Jung et al. 2015b; Qin et al. 2016].

Figure 2. Pathology of testes in induced cryptorchidism and busulfan-treated mice. (A) Photographs of testes removed from experimental and control mice. Testes sizes were decreased following cryptorchidism and busulfan-treatment. (B and C) Show the histological sections of testes (100×, 400×, respectively). The diameters of seminiferous tubules was decreased and almost germ cells disappeared in busulfan-treated testis. Note the lack of highly differentiated cells in bilateral cryptorchid testis. Bar = 25 μm.

LCN2 mRNA and protein expression in mouse testes

Since LCN2 mRNA levels increased with age, we examined whether the level of LCN2 was altered by induced cryptorchidism and busulfan treatment. When LCN2 mRNA and protein levels were compared between the two models, LCN2 mRNA and protein levels were higher in busulfan treated mice than that of cryptorchid induced mice (Figure 3). Compared with controls, both these experimental treatments resulted in strong positive in situ hybridization signals (Figure 3A). These results were also reflected by a significant increase of LCN2 mRNA in the testes of induced cryptorchidism and busulfan-treated mice (Figure 3B). This correlates with an up-regulation of the LCN2 gene and a decreased number of germ cells associated with the role of LCN2 in regulating apoptosis. A similar role was found in the mammary gland and uterus where LCN2 is proposed to induce neutrophil apoptosis [Joel et al. 2002; Kehrer 2010]. Furthermore, LCN2 protein levels were more than two-fold higher in these groups (Figure 3C).

Figure 3. Lipocalin-2 (LCN2) mRNA and protein expression in mouse testes. (A) Shows increased positive hybridization in both testis of induced cryptorchidism and busulfan-treated mice. (B) A significant increase in LCN2 expression by real-time PCR between the control group and the experimental groups (p<0.05). LCN2 expression was higher in busulfan-treated testis than that of cryptorchidism testis (p<0.05). (C) Shows a significant increase in LCN2 protein levels by western blot analysis in the busulfan-treated group (p<0.01). But there was no significant difference in LCN2 protein levels between the control group and the induced cryptorchidism group (p>0.05). Bar = 50 μm.

However, the LCN2 protein level was very low or undetectable in the testis of cryptorchid mice. The increase in LCN2 may be associated with its role in regulating cell death and survival [Lin et al. 2011; Jin et al. 2011]. Differentiation of the Leydig cell population is under the paracrine action of Sertoli cell-secreted factors [Tremblay 2015], busulfan treatment affects testicular Sertoli cells and Leydig cell number, but not in cryptorchidism. Zhang et al. [2014] demonstrated that LCN2 production in adipocytes is highly responsive to metabolic stress, cytokines, and nutrient signals. These results suggest that a signal from Sertoli cells to Leydig cells may play an important role in regulated LCN2 expression in testes development.

Materials and methods

Animals and treatment

Healthy male CD-1 mice were maintained with 12 h light and dark cycles, and fed and watered ad libitum. Testis tissues were collected at 1 d, 10 d, 20 d, 30 d, 40 d, 60 d, 4-month, 8-month, and 12-month of age, respectively. They were put into liquid nitrogen for quick freezing, then kept in the -80°C refrigerator until tested.

Eighteen 6-week-old CD-1 mice (26-28 g) were equally divided into 3 groups randomly: control group, bilateral cryptorchidism group, and busulfan treatment group. Cryptorchidism was performed according to the method of Dutta et al. [2013]. Briefly, a tiny incision in the linea alba was cut apart after injection of chloral hydrate, and the testes were seamed with an absorbable suture in the abdominal cavity. Busulfan (Sigma, St. Louis, USA) was dissolved in dimethyl sulfoxide (DMSO) and diluted with an equal volume of normal saline. This solution was injected intraperitoneally at 45 mg/kg [O’Shaughnessy et al. 2008]. All mice were euthanized by cervical dislocation after 30 d. Testes were quickly removed for testing. Animal procedures were approved by the Institutional Animal Care and Use Committee of the South China Agricultural University.

Histological analysis

The testes were fixed in 10% formalin for more than 24 h, dehydrated in ethanol, and then embedded in paraffin. Tissue sections of 5 μm were mounted onto glass slides, dried at 37°C for 24 h, stained with hematoxylin and eosin (H&E) and observed using a light microscope.

In situ hybridization

In situ hybridization (ISH) was performed as described by Qi et al. [2015]. Briefly, total RNAs from mouse testes were reverse-transcribed and the hybridization probe template was amplified with the corresponding primers (Table 1). Digoxigenin-labeled antisense or sense RNA probes were prepared by using digoxigenin RNA labeling kit (Roche Applied Science, Basel, Switzerland). Frozen sections were mounted on slides, which were treated by 3-aminopropyltriethooxysilane (APES, Sigma), and fixed in 4% paraformaldehyde solution with PBS for 1 h in room temperature. Hybridization was carried out at 55°C for 16 h and bound probes were detected using alkaline phosphatase-conjugated anti-Digoxigenin antibody (1:5000, Roche) and nitroblue tetrazolium (0.4 mM) and 5-bromo-4-chloro-3-indolyl phosphate (0.4 mM) as substrates. The sections were counterstained with 1% methyl green. The positive signal of ISH was visualized as a dark brown color.

Table 1. Primers used in this study.

Gene name	Primer sequences (5’-3’)	Accession number	Length (pb)	Application
LCN2	GGGCTGTCGCTACTGGAT	NM_008491.1	444	In situ hybridization
	TTGGTATGGTGGCTGGTG
LCN2	TGAGTGTCATGTGTCTGGGC	NM_008491.1	134	Real-time PCR
	GAACTGATCGCTCCGGAAGT
GAPDH	AAGAAGGTGGTGAAGCAGG	NM_008084.3	111	Real-time PCR
	GAAGGTGGAAGAGTGGGAGT

Real-time PCR

Total RNAs was extracted from testes tissues using Trizol Reagent (Invitrogen Trading Co., Ltd., Shanghai, China). RNA was reverse-transcribed into cDNAs using PrimeScript reverse transcriptase reagent kit (Perfect real time; TaKaRa, Dalian, China). For real-time PCR (RT-PCR), cDNA was amplified using a SYBR^® Premix Ex Taq™ II kit (TaKaRa) on the BIORAD-CFX96™ Real-Time System (BioRad). All reactions were run in triplicate and data were analyzed according to the 2^−△△Ct method [Pfaffl 2001]. RT-PCR was performed as reported previously with LCN2 sequence-specific primers and GAPDH was used as the reference gene [Zhang et al. 2016]. The corresponding primer sequences used for RT-PCR were listed in Table 1.

Western blot analysis

Tissue samples were processed using the Mammalian Protein Extraction Kit containing protease inhibitors (CWBIO, Beijing, China). Lysates were centrifuged at 4°C and the supernatant fractions were mixed with 4×SDS sample buffer, and then boiled. Total proteins were separated using 10% polyacrylamide gels and transferred onto polyvinylidene difluoride membranes (Millipore, USA). Membranes were blocked in 1×TBST (Tris-buffered saline, 0.1% Tween-20; CWBIO) containing 5% non-fat dry milk (Amresco, USA), and hybridized overnight with an anti-LCN2 antibody (dilution 1:1000; abcam) at 4°C. Membranes were then incubated by species-specific secondary antibodies (goat anti-IgG mouse, dilution 1:5000; Beijing ComWin Biotech Co., Ltd.) for 1 h at room temperature. The membrane was incubated in ECL solution (Millipore), and the gel image was captured using a BioRad imaging camera and analyzed using the BioRad gel imaging system software (Quantity One) to estimate the optical density of the protein bands.

Statistical analysis

Statistical analysis was done using IBM SPSS 23.0 software (SPSS Inc., Chicago, IL, USA). Differences were compared using a t-test between 2 groups. In all cases, difference was considered significant at the level of p<0.05.

Declaration of interest

This project was financially supported by the National Science Foundation Project, China (31502131 and 31572585). The authors report no declarations of interest.

Acknowledgment

The authors thank all the staff.

Additional information

Notes on contributors

Zhenlong Kang

Helped with the design of the study and manuscript revision: ZT; Carried out all experiments: ZK, NQ; Participated in coordination and data collection: ZT. Analyzed and interpreted data, and wrote the manuscript: YL. All authors read and approved the final manuscript.

Na Qiao

Helped with the design of the study and manuscript revision: ZT; Carried out all experiments: ZK, NQ; Participated in coordination and data collection: ZT. Analyzed and interpreted data, and wrote the manuscript: YL. All authors read and approved the final manuscript.

Zhigang Tan

Helped with the design of the study and manuscript revision: ZT; Carried out all experiments: ZK, NQ; Participated in coordination and data collection: ZT. Analyzed and interpreted data, and wrote the manuscript: YL. All authors read and approved the final manuscript.

Zhaoxin Tang

Helped with the design of the study and manuscript revision: ZT; Carried out all experiments: ZK, NQ; Participated in coordination and data collection: ZT. Analyzed and interpreted data, and wrote the manuscript: YL. All authors read and approved the final manuscript.

Ying Li

Helped with the design of the study and manuscript revision: ZT; Carried out all experiments: ZK, NQ; Participated in coordination and data collection: ZT. Analyzed and interpreted data, and wrote the manuscript: YL. All authors read and approved the final manuscript.