Thymoquinone ameliorates obesity-induced metabolic dysfunction, improves reproductive efficiency exhibiting a dose-organ relationship

ABSTRACT

Women with obesity are more likely to have a complicated reproductive life. Insulin resistance and metabolic dysfunction are associated with obesity. Thymoquinone (TQ) is a well-known antioxidant, considered to be an AMPK-activator. The goal of this work was to investigate the ability of TQ to improve fertility and lactation and clarify the possible mechanism. Female C57BL/6 mice were subjected to High Fat Diet (HFD) supplemented with TQ (10% pmm) and TQ (20% pmm). Histopathological examination was conducted on mammary and ovarian samples. Metabolic and oxidant status was evaluated, and qRT-PCR analysis was performed to verify AMPK/PGC1α/SIRT1 metabolic pathway activity. The present study reports positive effects of TQ on ovarian metabolic function in a dose-dependent manner. TQ showed its positive effects on mammary gland metabolic function at lower dose. This is the first study that indicates these dose related impacts of TQ.

Abbreviations: AKT1: serine-threonine protein kinase 1; AMPK: 5′ AMP-activated protein kinase; CAT: catalase; CON: control; FBS: fasting blood sugar; GLUT1: glucose transporter 1; GSH: reduced glutathione; GSSG: Glutathione disulfide; HE: hematoxylin and eosin stains; HDL: high-density lipoprotein; HFD: high fat diet; IL-6: interleukin-6; K18: keratin 18; LD: lactation day; LDL: low-density lipoprotein; LKB1: serine-threonine liver kinase B1; MDA: malondialdehyde; mTOR: the mammalian target of rapamycin; NAD: nicotinamide adenine dinucleotide; NADH: nicotinamide adenine dinucleotide phosphate; NS: nigella sativa; PBS: phosphate-buffered saline; PGC1α: peroxisome proliferator-activated receptor gamma coactivator 1-alpha; SIRT1: sirtuin 1; SOD: superoxide dismutase; T-AOC: total antioxidants; TFAM: transcription factor A mitochondrial; TG: triglycerides; TNF-α: tumor necrosis factor-α; TQ: thymoquinone; TQ10: high fat diet + thymoquinone 10% ppm; TQ20: high fat diet + thymoquinone 20% ppm; UCP2: uncoupling Protein 2.

KEYWORDS:

• Thymoquinone
• lactation
• fertility
• metabolic dysfunction
• obesity

Introduction

A global notable increment in the prevalence of overweight and obesity has been observed (Stevens et al. 2012; Mendis 2014). The adverse effects of obesity on womens reproductive life are well known (Broughton and Moley 2017; He et al. 2018). Obesity contributes to inflammation status (Davis 2016), insulin resistance combined with increased insulin and leptin levels, and altered metabolic function. All lead to impaired ovulation (Moslehi et al. 2018), deterioration of conception ability (Gesink Law et al. 2006), postpartum lactation difficulties, delay in lactogenesis, and shorter breastfeeding period (Rasmussen et al. 2001; Amir and Donath 2007). In addition, the relationship between maternal obesity, offspring obesity, and growing metabolic problems in later life has been documented (Poston 2012; Dudele et al. 2017; Klein et al. 2018).

Food intervention and weight loss can ameliorate obesity’s impact on womens reproductive performance (Legro 2017) (Stang and Huffman 2016). Nigella sativa (NS) or black seeds are a plant that is very common in the traditional medicine in Asia. Thymoquinone (TQ) is the main active compound in this plant. The essential impact of this quinine returns to its antioxidant effect, it was widely studied, known for its benefits (Vanamala et al. 2012; Ahmad et al. 2013; Younus et al. 2018) and clinical use in the metabolic syndrome disorders (Abdelmeguid et al. 2010; Razavi and Hosseinzadeh 2014; Balbaa et al. 2016). TQ has a positive effect on glucose and lipid homeostasis (Ragheb et al. 2008a; Abdelmeguid et al. 2010; Abdelrazek et al. 2018). Clinical studies have shown its ability as an antitoxic agent in improving organ function by increasing the resistance to oxidative stress and enhancing mitochondria energy production (Nagi et al. 2010; Laskar et al. 2016; Firdaus et al. 2019; Safhi et al. 2019). TQ decreases the NADH/NAD⁺ ratio through the TQ redox cycle which is the main mechanism to activate AMPK/SIRT1 pathway by de-acetylating and activating LKB1, an upstream activator of AMPK (Ruderman et al. 2010; Velagapudi et al. 2017; Kou et al. 2018). Through this mechanism, TQ exhibits positive effects on health. TQ protects against liver and heart disease, promoting weight loss and energy expenditure by stimulating glucose and fatty acid oxidation in obese animals (Pei et al. 2016; Yang et al. 2016; Karandrea et al. 2017; Lu et al. 2018).

On the one hand, the positive effects of NS on lactation and milk production have been previously described but no study yet has investigated TQ impact on this critical physiological process (Hosseinzadeh et al. 2013). TQ is considered to be safe in pregnancy and has no side effects at a dose of 15mg/kg (AbuKhader et al. 2013). On the other hand, TQ benefits on fertility disorders are well documented (Koutabadi and Sadeghi 2015; Tüfek et al. 2015; Salahshoor et al. 2018). TQ exhibits antioxidant and anti-inflammatory therapeutic effects on ovarian health (Ural et al. 2016). In addition, it has been used as a remedy for Polycystic ovary syndrome (Arif et al. 2016; Javanshir et al. 2018a). The objectives of this study were to investigate the impact of TQ on metabolic function of the mammary gland and ovary through the reproductive life in an animal model of obesity. A possible mechanism was defined.

Results and discussion

Dams evaluation

After 11 weeks, on the day of mating, the body weight in HFD groups was significantly higher than control (p < 0.05), with no significant decrease in body weight in TQ10 and TQ 20 groups (Figure 1A). This increment in HFD groups’ body weight was maintained throughout the whole pregnancy (Figure 1B). However, the body weight difference between control and fat diet groups was no longer present on lactation day (LD) 15 (Figure 1C). It was previously shown that lactation alters the whole body metabolism and protects from obesity (Hyatt et al. 2017). Numerous of studies discussed the changes in lipid metabolism that occurred during lactation as the release of dietary lipid from fat storage in adipose tissue to the mammary glandwith facilitated lipid transport into mammary gland tissue for milk synthesis which contribute to weight loss (Hamosh et al. 1970). In rodent studies, HFD groups lost most of their excessive fat during lactation (Steingrimsdottir et al. 1980; Buonfiglio et al. 2016). In non-reproduction group and after 28 weeks on the previous diets, the body weight was significantly higher in the fat diet groups with a significant reduction in TQ20 group (p < 0.05) (Figure 1D) (Zaoui et al. 2002; Le et al. 2004). In a parallel manner, HFD and TQ10 had a larger fat pad which was significantly reduced in TQ20 and CON (Table 1). Examing the mammary gland and other metabolic organ mass, in non-reproductive females groups, revealed that the mammary gland was significantly heavier in fat diet group, but this difference was not notable in lactating females group. A notable increment in liver mass in lactating females was observed when compared with non-reproducing females. This increment pursues an increment in lactating females’ weight which refers to its important role in the metabolic adaptation with lactation demands (Mowry et al. 2017). In addition, the liver mass increased in TQ10 and TQ20 groups while decreasing in HFD group on LD15 (Table 1) indicating an enhanced metabolic rate within TQ groups to meet the energy requirements of milk synthesis.

Table 1. Effects of TQ on FBS and metabolic organs mass in lactating and non-reproductive females.

	Lactating females on lactation day 15			Non-reproductive females after 28 weeks
	FBS mmol/L	Mammary gland (g)	Liver (g)	FBS mmol/L	Mammary gland (g)	Fat (g)	Liver (g)
Con	6.83 ± 0.7	0.34 ± 0.11	1.6 ± 0.3^ab	6.64 ± 0.88^a	0.12 ± 0.04^a	0.11 ± 0.15^a	0.99 ± 0.07^a
HFD	7.17 ± 0.66	0.37 ± 0.19	1.33 ± 0.52^a	7.93 ± 0.63^b	0.71 ± 0.38^b	2.93 ± 1.38^b	1.08 ± 0.1^ab
TQ10	6.37 ± 0.73	0.36 ± 0.15	1.82 ± 0.38^b	7.05 ± 0.84^ab	0.68 ± 0.31^b	2.89 ± 1.45^b	1.18 ± 0.1^b
TQ20	7.88 ± 0.89	0.37 ± 0.15	1.86 ± 0.2^b	6.5 ± 0.86^a	0.53 ± 0.41^b	1.41 ± 0.98^a	1.11 ± 0.12^ab

CON: control. HFD: high-fat diet. TQ10: high-fat diet+ thymoquinone 10% ppm. TQ20: high-fat diet+ thymoquinone 20% ppm. Data are expressed as mean ± SD of n = 6/group and values were considered significantly different at p < 0.05. Different letters show significant differences between the groups at p < 0.05.

Figure 1. Effect of TQ on body weight. (A) Weight gain before mating (n = 18/group). (B) HFD group kept a higher Weight gain through pregnancy (n = 16/group). (C) Weight gain did not differ on lactation day (LD) 15 (n = 6/group). (D) TQ20 decrease weight gain after 28 weeks experimental period (n = 6/group). Significant differences between various groups were determined by one-way analysis ANOVA test. Data are expressed as mean ± SD and values were considered significantly different at p < 0.05. Different letters show significant differences between the groups at p < 0.05. CON: control. HFD: high-fat diet. TQ10: high-fat diet+ thymoquinone 10% ppm. TQ20: high-fat diet+ thymoquinone 20% ppm.

After 11 weeks, the females were bred, as shown in Figure 2A, the pregnancy induction rate was measured by counting the successful pregnancies in the first week after mating, the pregnancy rate was the lowest in the HFD group (Gesink Law et al. 2006), and improved in the TQ10 and TQ20 groups to 50% and 60%, respectively. Pregnancy rate was higher in TQ20 than CON. High pregnancy mortality was noticed in the HFD group caused by birth difficulties resulting from the excess weight. We investigated the females’ ability to pursue lactation after birth, notably, HFD and TQ20 dams failed to sustain feeding the offspring after birth (38.89% and 33.33%), but lactation was improved in TQ10 and CON (50% and 84.21%), respectively. The surviving offspring rate at 2 weeks was increased in CON and TQ10 groups (p < 0.05), while decreased in HFD and TQ20 groups (Figure 2B). The obvious reason for lactation failure is impaired milk production and lack of maternal care.

Figure 2. Effects of TQ on reproduction performance. (A) TQ10 increased successful lactation, while TQ20 increased pregnancy rate and reduced successful lactation. TQ groups decreased pregnancy mortality (n = 16/group). (B) TQ10 increased surviving offspring rate at 2 weeks old (n = 6/group). Significant differences between various groups were determined by one-way analysis ANOVA test. Data are expressed as mean ± SD and values were considered significantly different at p < 0.05. Different letters show significant differences between the groups at p < 0.05. CON: control. HFD: high-fat diet. TQ10: high-fat diet+ thymoquinone 10% ppm. TQ20: high-fat diet+ thymoquinone 20% ppm.

Offspring evaluation

We investigated the effect of obesity and TQ on litter size (Figure 3A). On day 18 of pregnancy, the number of fetuses increased in the TQ20 group and decreased in HFD. This difference was also notable after birth with higher litter size in the TQ20 group and less in HFD (p < 0.05). Surprisingly, by measuring litter size at 2 weeks, we found a notable offspring loss in TQ20 group with lowest litter size (p < 0.05). In contrast, in the TQ10 and CON groups, litter size was greater than the HFD group. The previous results indicated an improvement in fertility and pregnancy outcome but impaired lactation ability in the TQ20 group. As shown in (Figure 3), we also investigated offspring growth by measuring crown-rump length on day 18 of pregnancy and birth weight, the two parameters were significantly higher in the HFD group (p < 0.05) and normalized in TQ10 and TQ20 groups. This difference in offspring weight was observed at one week but no longer significant at two weeks (Figure 3B). Along with previous studies, deterioration in reproductive performance was observed in HFD group (Campos et al. 2008). In this study, TQ markedly improved reproduction performance by increasing successful pregnancy, fetus number, normalizing fetus crown-rump length, and offspring birth weight. These results are an agreement with previous studies about TQ’s protective effects on offspring health of diabetic pregnant mice and verify TQ potential advantages through programming offspring’s physiology (Al-Enazi 2007; Badr et al. 2011, 2013).

Figure 3. Effects of TQ on offspring and milk yield. (A) TQ20 increased fetus number and litter size at birth, while TQ10 increased litter size at 2 weeks old. (B) Weight gain of offspring through two weeks postpartum. (C) TQ decreased Crown-rump length. (D) TQ10 increased milk yield through lactation. Significant differences between various groups were determined by one-way analysis ANOVA test. Data are expressed as mean ± SD of n = 6/group and values were considered significantly different at p < 0.05. Different letters show significant differences between the groups at p < 0.05. CON: control. HFD: high-fat diet. TQ10: high-fat diet+ thymoquinone 10% ppm. TQ20: high-fat diet+ thymoquinone 20% ppm.

Milk yield

On LD 2 and LD 5, milk yield was markedly less in HFD group and markedly higher in TQ10 and TQ20 groups. On LD 10, there was no significant difference in milk yield between groups with a higher production in the TQ10 group (Figure 3C). According to our results, the TQ10 group had a better impact on lactation compared to TQ20. TQ10 ameliorated obesity negative effects on lactation performance. Litters survived by establishing early lactogenesis and increasing milk yield through lactation. This result paralleled a previous rodent study about the effect of oral NS extract on lactation performance and milk yield which indicated a higher milk production at a lower dose of oral NS extract (Hosseinzadeh et al. 2013).

Fasting blood sugar, insulin, leptin, prolactin secretion, and lipid profile

HFD-induced insulin resistance status is characterised by elevated fasting blood sugar (FBS), high insulin, and leptin levels. FBS was not significantly different on LD15 between the groups. In non-reproducing females, TQ markedly decreased FBS (Table 1). In addition, TQ decreased insulin and leptin levels in lactating females and in non-reproducing females (Figure 4A,B). TQ improved the blood prolactin level, which is an effect previously described at high oral dose of NS (Figure 4C) (Pakdel et al. 2017). TQ20 markedly improved the lipid profile in non-reproducing females by decreasing TG and LDL levels and elevating HDL level in the blood (Figure 4D). These results agreed with previous studies about the positive effects of TQ on the health status of metabolic syndrome and diabetic patients through its ability to normalize lipid profile and blood glucose (Ragheb et al. 2008b; Güllü and Gülcan 2013; Pakdel et al. 2017). Furthermore, these findings suggest the potential of TQ to improve ovarian function by reversing the alterations in the hypothalamic pituitary ovarian axis caused by obesity (Goldsammler et al. 2018).

Figure 4. Effects of TQ on plasma parameters. (A) TQ decreased insulin blood level. (B) TQ decreased leptin blood level. (C) TQ increased prolactin blood level. (D) TQ improved lipid profile. (E) TQ20 decreased TNFα level in blood, while TQ10 decreased TNFα level in mammary tissue. (F) TQ 10 decreased IL6 level in blood and mammary tissue. Significant differences between various groups were determined by one-way analysis ANOVA test. Data are expressed as mean ± SD of n = 6/group and values were considered significantly different at p < 0.05. Different letters show significant differences between the groups at p < 0.05. CON: control. HFD: high-fat diet. TQ10: high-fat diet+ thymoquinone 10% ppm. TQ20: high-fat diet+ thymoquinone 20% ppm.

Oxidative stress

HFD decreased the total antioxidant capacity by decreasing T-AOC and GSH/GSSG ratio in the blood of lactating females (Table 2). The level of inflammatory markers (TNFα and IL6) was markedly elevated in the blood of HFD lactating females, HFD non-reproducing females, and HFD lactating females’ mammary tissue (Figure 4E,F). These results tie well with previous studies wherein HFD-induced obesity increased tissue inflammation leading to impaired ovarian function (Skaznik-Wikiel et al. 2016) and milk production (Hernandez et al. 2012). TQ10 increased the antioxidant capacity (T-AOC, GSH/GSSG) in the blood of lactating females and relieved inflammatory markers in lactating females’ mammary tissue,. These results are in agreement with previous studies about TQ anti-inflammatory effects (Alkharfy et al. 2018; Firdaus et al. 2018; Xu et al. 2018; Al-Brakati et al. 2019). TQ20 decreased TNFα but not IL6 in the blood of lactating and non-reproductive females, but markedly elevated those inflammatory markers in lactating females’ mammary tissue. As shown in Table 2, TQ showed antioxidant effects by elevating the antioxidant enzyme activities in lactating females’ blood (CAT and SOD). These effects of TQ in elevating antioxidant enzymes in numerous organs are previously described (Alam et al. 2018; Khan 2018). TQ decreased the level of MDA in blood and mammary tissue of lactating females in a dose-dependent manner. Nevertheless, TQ antioxidant effects were not dose-dependent in the mammary tissue of lactating females (CAT, SOD, and GSH/GSSG).

Table 2. Effects of TQ on the redox status in blood and mammary tissue of lactating females on lactation day (LD) 15.

Blood of lactating mice
	T-AOC U/mg protein	MDA (nmol/ml)	SOD (U/mg protein)	CAT (U/mg protein)	GSH (Ug/ml)	GSH/GSSG
CON	5.33 ± 0.88	3.11 ± 0.5^a	49.51 ± 2.11^b	9.68 ± 0.85^b	56.94 ± 8.55^b	0.51 ± 0.09^bc
HFD	4.3 ± 0.92	6.09 ± 1.52^c	33.12 ± 2.77^a	2.82 ± 0.98^a	31.75 ± 5.8^a	0.27 ± 0.05^a
TQ10	5.55 ± 0.6	4.17 ± 0.97^b	45.62 ± 2.83^b	3.67 ± 0.89^a	89.96 ± 9.14^c	0.95 ± 0.23^c
TQ20	4.81 ± 0.56	3.54 ± 0.87^a	48.56 ± 4.2^b	6.42 ± 0.89^b	76.24 ± 5.9^c	0.44 ± 0.06^ab
Mammary tissue of lactating mice
	MDA (nmol/ml)	SOD (U/mg protein)	CAT (U/mg protein)	GSH (Ug/ml)	GSH/GSSG
CON	0.25 ± 0.44^a	2.41 ± 0.32^b	22.3 ± 1.46^b	2.91 ± 0.58^b	1.35 ± 0.15
HFD	1.48 ± 0.39^b	1.08 ± 0.4^a	19.16 ± 1.94^a	1.43 ± 0.3^a	1.03 ± 0.24
TQ10	0.28 ± 0.08^a	1.74 ± 0.44^ab	24.16 ± 2.15^b	2.67 ± 0.36^b	1.04 ± 0.16
TQ20	0.26 ± 0.09^a	1.46 ± 0.36^ab	24.5 ± 2.36^b	2.45 ± 0.36^b	1.16 ± 0.23

CON: control. HFD: high-fat diet. TQ10: high-fat diet+ thymoquinone 10% ppm. TQ20: high-fat diet+ thymoquinone 20% ppm. Data are expressed as mean ± SD of n = 6/group and values were considered significantly different at p < 0.05. Different letters show significant differences between the groups at p < 0.05.

Mammary gland histopathological evaluation

Milk synthesis and secretion are the main functions of the mammary gland. At the onset of pregnancy, proliferation, and differentiation of the epithelium begin to form grape-shaped milk secretion system called alveoli. The density of the epithelial area increases compared to the adipose area revealing alveolar lumens structures and expanded ducts within the parenchymal tissue. After parturition and during lactation, the alveolar luminal area expands, milk is produced by luminal secretory cells, and stored within the lumen of alveoli (Richert et al. 2000; Anderson et al. 2007). The architecture of the mammary gland epithelium can be easily observed using whole mount at all stages of the development (Plante et al. 2011a), while measuring the alveolar lumens area is a clear evidence of lactation establishing and evolution (Anderson et al. 2007). These two tests can give important insights into mammary gland development and function.

Analyzing mammary gland in HFD pregnant and lactating females showed a weak in development and disruption of mammary gland morphology causing metabolic dysfunction and impaired lactogenesis (Flint et al. 2005; Kamikawa et al. 2009; Hernandez et al. 2012). In our study, through analyzing mammary gland by whole mount on day 18 of pregnancy, we found that obesity disturbed mammary gland morphology. Mammary epithelial density in pregnant mice was reduced in HFD and TQ20 comparing to CON and improved in TQ10 (Figure 5). Analyzing mammary gland morphologies in H&E samples from lactating females on LD 15, we found that HFD altered development of the alveolar lumens necessary for milk production. In the HFD group the prevalence of alveolar lumens area in the parenchymal tissue was minimal, with larger adipocytes. TQ10 markedly improved alveolar lumens prevalence and density, while alveolar lumens in HFD and TQ20 were irregular with deteriorating areas in the parenchymal tissue (Figure 6).

Figure 5. Histopathological evaluation by whole mount examination in the mammary gland of all experimental groups. (A) Representative whole mount gland from CON, HFD, TQ10, TQ20 mice on pregnancy day 18 after staining with Carmine (10X). (B) The columns showed mammary epithelial density, which disrupted by HFD group and increased in TQ10 group. Significant differences between various groups were determined by one-way analysis ANOVA test. Data are expressed as mean ± SD of n = 3/group and values were considered significantly different at p < 0.05. Different letters show significant differences between the groups at p < 0.05. (C) Representative whole mount gland from CON, HFD, TQ10, TQ20 mice on lactation day (LD) 15, first row (10X), second row (20X) larger adipocytes in HFD group. CON: control. HFD: high-fat diet. TQ10: high-fat diet+ thymoquinone 10% ppm. TQ20: high-fat diet+ thymoquinone 20% ppm.

Figure 6. Histopathological evaluation by hematoxylin and eosin (HE) in the mammary gland on lactation day (LD) 15 of all experimental groups (20X). (A) Representative HE-stained sections of the mammary glands from CON, HFD, TQ10, TQ20 lactating mice. (B) The columns showed alveolar Lumens area. HFD altered development of the alveolar Lumens, while TQ10 alveolar Lumens increases area. Significant differences between various groups were determined by one-way analysis ANOVA test. Data are expressed as mean ± SD of n = 6/group and values were considered significantly different at p < 0.05. Different letters show significant differences between the groups at p < 0.05. CON: control. HFD: high-fat diet. TQ10: high-fat diet+ thymoquinone 10% ppm. TQ20: high-fat diet+ thymoquinone 20% ppm.

Ovarian histopathological evaluation

The majority of follicles in HFD (non-reproduction) group were developed to early stages (including primary, secondary, and antral follicles) or were atretic follicles (Sohrabi et al. 2015), while the majority of follicles in CON was developed to the later follicular stages (Graafian follicles or the corpus luteum stage). TQ10 and TQ20 markedly improved ovarian histology and ameliorated HFD effects on follicle development, by increasing the number of Graafian follicles, ovulated oocytes, and corpus luteum (Figure 7). This result agrees with previous research about the positive effects of TQ on female ovarian health and ovulation (Arif et al. 2016; Javanshir et al. 2018b).

Figure 7. Histopathological evaluation by hematoxylin and eosin (HE) in the ovarian tissues of all experimental groups (10X). (A) Representative hematoxylin and eosin of ovarian tissues from CON, HFD, TQ10, TQ20 non-reproductive females after 28 weeks on diets. (B) The columns showed that TQ20 increased the number of Graafian follicles and corpus luteum per ovary. (p) primary follicle; (SF) secondary follicle; (A) antral follicle; (AF) atretic follicle; (GF) Graafian follicles; (CL) corpus luteum; (O) ovulated oocyte. Significant differences between various groups were determined by one-way analysis ANOVA test. Data are expressed as mean ± SD of n = 3/group and values were considered significantly different at p < 0.05. Different letters show significant differences between the groups at p < 0.05. CON: control. HFD: high-fat diet. TQ10: high-fat diet+ thymoquinone 10% ppm. TQ20: high-fat diet+ thymoquinone 20% ppm.

mRNA expression of genes involved in mitochondrial function and metabolism in mammary and ovarian tissues

HFD altered mRNA expression of genes involved in energy metabolism and mitochondrial function in both ovarian and mammary tissues negatively. In mammary gland at a lower dose, TQ increased mRNA expressions of genes involved in mitochondrial function and metabolism (Ampk, Pgc1α, and Sirt1) while TQ increased mRNA expressions of genes involved in mitochondrial function and metabolism (Ampk, Pgc1α, and Sirt1) in ovarian tissue in a dose-dependent manner (Figure 8).

Figure 8. Effects of TQ on mRNA genes expression of mitochondrial function and metabolism. (A) In mammary K18, Ampk, Akt1, Mtor, Glut1. (B) In mammary Sirt1, Pgc1α, Ucp2, Tfam. (C) In ovary Ampk, Akt1, Mtor, Glut1. (D) In ovary Sirt1, Pgc1α, Ucp2, Tfam. Significant differences between various groups were determined by one-way analysis ANOVA test. Data are expressed as mean ± SD of n = 6/group and values were considered significantly different at p < 0.05. Different letters show significant differences between the groups at p < 0.05. CON: control. HFD: high-fat diet. TQ10: high-fat diet+ thymoquinone 10% ppm. TQ20: high-fat diet+ thymoquinone 20% ppm.

Milk synthesis is a complex process using several different pathways to regulate milk protein, fat, and lactose synthesis (Anderson et al. 2007). Nutrition and energy content in the diet can affect the quantity of milk components. With a pivotal role for insulin and mTOR in regulating this process, insulin controls protein and lactose synthesis through activating mTOR pathway which induces transcription of several genes including glucose transporter 1 GLUT1 (Menzies et al. 2009; Bionaz and Loor 2011; Bionaz et al. 2012). The equiponderant connection between mTOR pathway and AMPK pathway is obvious and necessary to launch lactogenesis. The AMPK pathway acts as a sensor of cell energy and takes control at the beginning of lactation which confirms this pathway role in establishing lactation. Activation of AMPK induces the expression of the transcriptional coactivator PGC1α in the mammary tissue, which is known to stimulate mitochondrial biogenesis, Phospho-AMPK decreases with mid lactation, and increases again in cases of prolonged lactation (Bionaz et al. 2012). Although activating the AMPK pathway could negatively influence the mTOR pathway, its effect on milk protein synthesis is minor (Bionaz et al. 2012). More recent studies have implicated down-regulation of the AMPK pathway in the pathogenesis of insulin resistance and metabolic syndrome (Ruderman et al. 2013). Unlike AMPK, mTOR activity is increased during overnutrition conditions such as HFD. Clinical investigations have described the link between the mTOR pathway and metabolic disorders such as insulin resistance status (Dann et al. 2007). This mechanism could explain the beneficial effects of TQ at low dose intervention in establishing early lactogenesis, increasing milk production, and restoring mitochondrial function in the mammary gland of HFD females by inducing a positive balance between these two pathways.

Mammary glands are high metabolic demand organs specially during lactation. The gland microenvironment adapts during the lactation cycle to prepare for milk production (Richert et al. 2000). Mitochondrial function is related to milk production, A massive increase in the density of mammary cell mitochondria inner membranes and major changes in mitochondrial structural composition are observed during the lactation cycle to stimulate energy production in the mammary gland (Rosano and Jones 1976; Hadsell et al. 2010). TQ10 up-regulated () gene expression of Ampk, Pgc1α, and Sirt1 indicate improved mitochondria function and biogenesis with down-regulation of Tfam and Ucp2 compared to the HFD group. TFAM and UCP2 functions appear to be complicated and tissue-specific (Mattiasson and Sullivan 2006; Picca and Lezza 2015), Mammary glands are associated with white adipose tissue which plays a critical role in milk fat production. Reduction of Tfam in mice adipose tissue increases mitochondrial oxygen consumption rates leading to greater mitochondria oxidation capacity and uncoupling. As a result, mice increase energy expenditure to protect from HFD-induced obesity and insulin resistance (Vernochet et al. 2012). UCP2 has also been implicated in numerous metabolic syndrome studies. In one study, activation of SIRT1protects against diabetes and stimulates insulin secretion by repressing UCP2 in pancreatic tissue (Shoba et al. 2009). In another study, up-regulation UCP2 restores mitochondria function to ameliorate cardiovascular disorders (Deng et al. 2017). Moreover, Polymorphisms in TFAM and UCP2 have been implicated in the growth and fertility as well as, milk production of dairy cows (Clempson et al. 2011). Despite their role in mitochondrial biogenesis, TQ regulates mammary gland mitochondria by decreasing Tfam and Ucp2 gene expression which may be a potential therapeutic mechanism to increase insulin sensitivity in mammary tissue.

In addition, TQ10 up-regulates keratin 18 (K18), a luminal marker, resulted in improved alveolar lumens development. TQ10 up-regulates serine-threonine protein kinase 1(Akt1) in mammary gland tissue, which was previously described in milk synthesis and yield (Lemay et al. 2007). The effects of TQ on the regulation of Akt1, Mtor, and Glut1 gene expression could change nutrient uptake by the mammary gland which could impact milk composition and this requires further investigation.

HFD has been previously described to trigger follicle cell development and loss through activation of insulin signaling and mTOR pathways (Wang et al. 2014; Nteeba et al. 2017). Akt1 is a positive regulator of mTOR that mediates the activation of mTOR by insulin. Akt1 is also a key regulator of energy metabolism that inhibits AMPK (Xu et al. 2012). Activation of the Akt1/mTOR pathway is associated with inhibition of LKB1/AMPK signaling. This relationship between AMPK and mTOR pathways, as energy homeostasis regulators, could have crucial clinical importance as a target for metabolic disorders treatment (Xu et al. 2012). Improvement in fertility is associated with enhancing insulin sensitivity and activating the SIRT1 pathway in obese individuals (Vick et al. 2006; Ujvari et al. 2014). The role of AMPK in insulin resistance and metabolic syndrome was previously described (Ruderman et al. 2013). SIRT1 is proved for its role in increasing insulin sensitivity and restoring mitochondria function (Zhou et al. 2014; Zhang et al. 2015). Expression of PGC1α is also decreased in insulin-resistant subjects and in old ages, and increased on cellular energy demand, including exercise and fasting (Kim et al. 2008; Bournat and Brown 2010). As parallel with that described above, studies have confirmed the existence of an AMPK-SIRT1-PGC1α cycle that controls the cell’s energy and redox states (Ruderman et al. 2010). AMPK and SIRT1 regulate gluconeogenesis and glycolysis through activativation of the transcriptional coactivator PGC1α (Cantó and Auwerx 2009; Wan and Castellani 2014). TQ20 implicated its positive effects in enhancing insulin sensitivity and improving metabolic function in the ovary by increasing mRNA gene expressions of (Ampk, Pgc1α, and Sirt1) in ovarian tissue. Moreover, TQ20 decelerates follicle development by down-regulating Akt1and Mtor gene expression. The impact of TQ in down-regulating the AKT pathway was previously described (Chen et al. 2018). Obesity-induced mitochondrial dysfunction which affected ovarian function and altered infertility (Grindler and Moley 2013), the association between mitochondrial dysfunction and insulin resistance is well described in the literature (Montgomery and Turner 2015). TQ20 enhanced mitochondria biogenesis and functions in ovarian tissue by up-regulating Ucp2 and Tfam genes expression significantly (p < 0.05). HFD-induced obesity could increase oocyte mitochondria biogenesis; however, oocytes from HFD mice exhibit impaired mitochondria function contributing to decreased energy production, higher oxidative stress, and oocyte dysfunction (Grindler and Moley 2013). UCP2 is widely distributed in the female reproductive tract, lower UCP2 contributed to impaired oocyte quality caused by higher ROS production. What is more, there was a correlation between decreased UCP2 expression in the ovaries and female age (Fu et al. 2004).

As shown in these results, TQ impacted mammary gland and ovary differently. TQ up-regulated (Ampk, Pgc1α, and Sirt1) genes expression in mammary tissue at a lower dose, While it up-regulated these genes in ovarian tissue at a higher dose (p < 0.05). This explains the improved oxidative status and reduced inflammatory markers of TQ10 lactating females’ mammary gland. In addition, TQ20 down-regulated Tfam and Ucp2 gene expression in mammary tissue, while it up-regulated both genes in ovarian tissue (p < 0.05). Mitochondrial transcription factors seemed to be expressed or regulated in a tissue-specific manner during lactation (Laubenthal et al. 2016). Furthermore, TQ down-regulated Akt1, Mtor, and Glut1 gene expression in both ovarian and mammary tissues at a higher dose, which could refer to its previously described role as anti-cancer agent (Yi et al. 2008; Rajput et al. 2013).

In conclusion, HFD-induced obesity contributed to metabolic dysfunction in both mammary gland and ovary adding to a deteriorated reproductive ability. TQ ameliorated these effects by the activation of genes involved in AMPK/PGC1α/SIRT1pathway. Through this pathway, TQ induced its anti-inflammatory, antioxidant, anti-hyperlipidemia, and anti-hyperglycemia positive impact. TQ showed its previously described actions on ovarian function in a dose-dependent manner, but those actions were combined with a low dose in the mammary gland. This study is the first report about this discrimination in TQ dose effects on different organs.

Materials and methods

Animals care

In this study, all experimental procedures and animal care were carried out in accordance with the ethical standards laid down in the Guidelines for Laboratory Animals Care, Jiangsu Province (China) and in the 1964 Declaration of Helsinki and its later amendments. Female C57BL/6 mice 3 weeks of age and weighing 18 g were obtained from Shanghai Slack Laboratory Animals Co., Ltd. and divided to four groups, 18 mice in each group: control diet (CON), High Fat diet (HFD), HFD supplemented with TQ 10% pmm (TQ10), and HFD supplemented with TQ 20% pmm (TQ20). TQ powder (≥98%) was purchased (Cataloque No: 274,666, Sigma-Aldrich, MERCK Ltd. Hong Kong, China) and sent to (Collaborative Medicine Bioengineering Co., Ltd. Jiangsu, China) where it was added to the diets. The mice were maintained under standard laboratory conditions: a temperature of 25°C, a relative humidity of 60–70%, and a 12-h light/dark cycle. The mice fed a standard commercial pellet diet and water for one week before started the above-mentioned diets for 11 weeks. After mating, the first day of gestation was determined by the presence of spermatozoids in the vaginal smears. Pregnant mice were housed individually in metal cages under the above-mentioned conditions and diets. After birth, only lactating females with four or more pups were included in the study. C57BL/6ʹ females tend to a nervous behavior and eating pups especially at first pregnancy because of lack of experience, so pregnancy must be induced more than once to get enough lactating females. The mice were sacrificed using cervical dislocation on LD 15, subgroups of mice were sacrificed on pregnancy day 18, and subgroups of mice (non-reproduction) were sacrificed after 28 weeks of starting the previous diets.

Weigh-suckle-weigh

On LD 2, 5, and 10, lactating females were subjected to a weigh-suckle-weigh experiment based on a previous rats study (Morag 1970), in which pups were removed from dams for 4 h which allowed the milk supply to replenish and pups to grow hungry. Pups were then weighed, returned to dams and suckled for 30 min, then weighed again. The difference between the final and initial litter weight represents milk yield for one dam then milk yield was estimating per pup for one bout of nursing.

Tissues preparations

Blood was collected from the carotid artery. Plasma was immediately separated by centrifugation (4000 g, 15 min, 4ºC) and stored at −80ºC until it was used in an assay. In lactating females groups and on LD15, bilateral abdominal mammary glands (the fourth mammary gland) were excised. The right gland was spread on a glass slide for whole-mount staining, whereas the left gland was weighed then divided after removing the lymph node, a part was preserved at −80ºC in Trizol for later RNA isolation and other part was in Paraformaldehyde 4% in phosphate-buffered saline (PBS) for hemotoxylin and eosin stains (HE) staining. In subgroups of pregnant mice, on pregnancy day 18, the right bilateral abdominal mammary gland was excised and spread on a glass slide for whole-mount staining, the fetuses were excised, and every fetus’ crown-rump length was measured. In non-reproductive females, ovaries were excised, right ovary was preserved at −80ºC in Trizol for later RNA isolation, and left ovary was in Paraformaldehyde 4% in PBS for H&E staining.

Whole-mount examination of mammary gland

Mammary glands were spread on glass slides, fixed in Carnoy’s fixative absolute ethanol, chloroform, and glacial acetic acid at a volume ratio of (6:3:1) overnight, washed with 70% ethanol, and rehydrated with decreasing concentrations of ethanol followed by distilled water. The glands were stained 3–4 h in carmine alum (1 g carmine and 2.5 g aluminum potassium sulfate in 500 ml dH2O), and dehydrated again through serial ethanol baths 70%, 80%, 90%, and 100% then with xylene, according to the method explained in (Plante et al. 2011b). The gland was photographed with a digital camera under a dissecting microscope, and the image was analyzed using Image-J NIH software, quantitative assessment of mammary gland epithelial density area was performed according to the protocol described by John N McGinley and Henry J Thompson (McGinley and Thompson 2011).

H & E staining

The left ovary in three non-reproductive females each group and a part of left mammary gland in six lactating females each group was fixed in Paraformaldehyde 4% in PBS for 24 h and embedded in paraffin. Hematoxylin and Eosin (HE) staining was performed on 5 mm serial to analyze the histopathological changes of ovarian follicle cells and mammary alveolar lumens. HE sections were observed with a CX31 RTSF microscope (Olympus Corporation, Tokyo, Japan). In lactating mammary glands, alveolar Lumens area was measured using Image-J NIH software (McGinley and Thompson 2011). In non-reproductive females’ ovaries, follicular stages were classified to early stage follicles (primary follicles; secondary follicles; antral follicles) and later stage follicles (Graafian follicles; corpus luteum) according to the Erickson’s classification (Williams and Erickson 2012). Graafian follicle: the oocyte is surrounded by cumulus oophorus cells, and is adjacent to a single large antrum (an ovum develops prior to ovulation). Corpus luteum: It is the remains of the ovarian follicle that has released a mature ovum during a previous ovulation. Only later stage follicles were observed and counted per one ovary to estimate ovulation.

Measurement of plasma parameters

Plasma insulin, leptin, and prolactin concentrations were measured using the mice ELISA kits (Huijia Biotechnology, Xiamen, P. R. China), according to the manufacturer’s instructions. Blood glucose was tested using One Touch Sure Step test strips (LifeScan, Milpitas, California, USA). Triglycerides (TG), High-density lipoprotein (HDL), and low-density lipoprotein (LDL) were measured by corresponding commercial kits (Jiancheng Bioengineering Institute, Nanjing, P. R. China).

Oxidative stress biomarkers and activities of antioxidant enzymes

The activity of superoxide dismutase (SOD), catalase (CAT), and malondialdehyde (MDA) levels and total antioxidants (T-AOC), reduced glutathione (GSH), Glutathione disulfide (GSSG) were assayed by corresponding kits (Jiancheng Bioengineering Institute, Nanjing, P. R. China). The levels of tumor necrosis factor-α (TNF-α), interleukin-6 (IL-6) in the plasma (TNF-α and IL-6) in the tissue were measured using the mice ELISA kits (Huijia Biotechnology, Xiamen, P. R. China), according to the manufacturer’s instructions.

Total mrna isolation and quantitative RT-PCR (qRT-PCR)

Total RNA of tissues was extracted with Trizol reagent according to the manufacturer’s protocol (Applied Biosystems, Foster City, CA, USA). The concentration of total RNA in each sample was quantified by NanoDrop Spectrophotometer (ND2000, Thermo, and Waltham, MA, USA). A SYBR green-based qRT-PCR kit was used according to the manufacturer’s instructions in a 7900HT instrument (Applied Biosystems, Forster, CA, USA). The specificity of the product was assessed from melting curve analysis. Gene expressions were determined using the 2^−ΔΔCt method. The primer’s sequences for the genes are shown in Table 3.

Table 3. Primer’s sequences of C57BL/6 mice for qRT-PCR.

Gene	Forward (5ʹ to 3ʹ)	Reverse (5ʹ to 3ʹ)
Ampk	GAAGATCGGACACTACGTGC	AGTCCACGGCAGACAGAATC
Akt1	ATCCGCTGCCTGCAGTGGACC	CCTTGTCCAGCATGAGGTTCTCC
Mtor	GCAGATTTGCCAACTACC	TCTCCGGCCCTCATTTCG
Glut1	GTGGGCCTCTTTGTTAATCG	CACATACATGGGCACAAAGC
K18	CGAGGCACTCAAGGAAGAAC	CTTGGTGGTGACAACTGTGG
Pgc1α	ACAGCTTTCTGGGTGGATTGAAGTG	AGACTGTCCAGTGTCTCTGTGAGGA
Sirt1	CTGTTTCCTGTGGGATACCTGACT	ATCGAACATGGCTTGAGGATCT
Ucp2	CACGCAGCCTCTACAATG	TCAGCACAGTTGACAATGG
Tfam	GAAGAACGCATGGAGGAGAG	TTCTGGGGAGAGTTGCAGTT
β-Actin	TGTCACCAACTGGGACGATA	GGGGTGTTGAAGGTCTCAAA

Statistics

All measurement values were expressed as means ± Standard deviation. Significant differences between groups were determined by one-way analysis of variance (ANOVA) using SPSS 16.0 software (SPSS Inc. Chicago IL., USA) for windows. A difference was considered significant at (p < 0.05) level.

Authors’ contributions

Responsible for the concept and design of the studies: GWL, YHS; Carried out the whole mount, H&E, the histopathological evaluation, RT-PCR procedure, and wrote the manuscript: SH; Carried out the assay of oxidative stress, plasma parameters, and analyzed the data: GQW; Assisted with the animal experiments: MG, GQ; Edited the manuscript: MZ.

Acknowledgments

The authors are very thankful to Prof. Guowei Le for his support and guides during the research work. We are also very thankful to the State Key Laboratory of Food Science and Technology of Jiangnan University for providing facilities and all necessary equipment.

Disclosure statement

No potential conflict of interest was reported by the authors.

Additional information

Funding

This work was supported by the 1State Key Laboratory of Food Science and Technology, Jiangnan University, Wuxi [214122];the National Natural Science Foundation of China [31571841].