Peroxisome Proliferator-Activated Receptors (PPARs) levels in spermatozoa of normozoospermic and asthenozoospermic men

ABSTRACT

Interest in the role of male factor in infertility continues to mount with defects related to sperm movement considered as one of the more severe forms of subfertility. The peroxisome proliferator-activated receptor gamma (PPARγ) primarily regulates the expression of target genes involved in energy control as well as lipid and glucose metabolism. Although the pivotal roles of these receptors on female fertility have been reported, there are limited studies addressing PPARs role(s) in the male. This study was designed to determine and compare PPARα, PPARβ and PPARγ mRNA expression in sperm cells of normozoospermic and asthenozoospermic men. In addition, flow cytometric analyses, immunofluorescence and western blot were used to evaluate PPARγ protein levels in spermatozoa. We have compared the sperm PPARs mRNA relative expression in 27 normozoospermic and 28 asthenozoospermic samples and monitored sperm PPARγ protein levels in 39 normozoospermic and 40 asthenozoospermic samples using flow cytometry. We have also assessed in a sub-group of seven normozoospermic and eight asthenozoospermic samples, PPARγ protein levels by western blotting. Relative expression of PPARγ mRNA in normozoospermic men was found to be significantly higher (P = 0.004) than in asthenozoospermic men while PPARα and PPARβ relative expression was similar in the two groups. Likewise, PPARγ showed a positive correlation with motility (r = 0.34; P < 0.05), sperm concentration (r = 0.33) and the percentage of progressive motile spermatozoa (r = 0.31). In agreement with the mRNA behavior, sperm PPARγ protein levels as measured by flow cytometry (P = 0.066) and western blot (P = 0.089) showed a tendency to be higher in normozoospermic than asthenozoospermic men. The present study proposes a link between PPARγ gene expression level and motility in human sperm.

Abbreviations: PPARs: Peroxisome Proliferator-Activated Receptors; CASA: Computer Assisted Semen Analysis; TFA: Trans Fatty Acids; HTF: Human Tubal Fluid; PBS: Phosphate-Buffered Saline; PPP: Pentose Phosphate Pathway; PI3K: Phosphoinositide 3-Kinase; G6PDH: Glucose 6-Phosphate Dehydrogenase

KEYWORDS:

• PPARs
• sperm motility
• normozoospermia
• asthenozoospermia

Introduction

Peroxisome proliferator-activated receptors (PPARs) are ligand-activated transcription factors belonging to the nuclear hormone receptor super family. Three isotypes of PPARs including PPARα, PPARβ/PPARδ, and PPARγ have been identified in mammals (Huang 2008; Liu et al. 2015), which play significant roles regulating lipid and glucose metabolism, controlling inflammatory processes, tissue repair, apoptosis and cancer progression (Bionaz et al. 2013). Animal studies showed that PPARα is highly expressed in liver, kidney, intestine, and heart (Issemann and Green 1990). PPARβ is expressed ubiquitously throughout the body but is substantially more abundant in skeletal muscle when compared to PPARα or PPARγ (Bionaz et al. 2013). PPARγ was identified in several cell types, however, its expression in adipose tissue was particularly well-studied (Vitti et al. 2016).

Several reports revealed that PPARs are expressed in different compartments of the reproductive axis such as hypothalamus, pituitary, ovary, uterus, and testis where it is suggested that they regulate sexual maturation, embryo implantation, development of the fetus and mammary glands, trophoblast differentiation and lactation (Yang et al. 2008). Most studies to date have focused on the role of PPARs in female reproduction, ranging from ovarian function, gestation to communication between mother and fetus (Morrison et al. 2008; Vitti et al. 2016). Very few studies have addressed the role of PPARs in male reproductive function. Aquila et al. (2006) were the first to report the presence of PPARγ and its function in human-ejaculated spermatozoa (Aquila et al. 2006). Subsequently, studies have revealed the existence of PPARγ in pig (Santoro et al. 2013) and ram (Kadivar et al. 2016) spermatozoa. PPARγ is not the sole nuclear receptor present in mammalian spermatozoa since there are reports that human-ejaculated spermatozoa harbor other nuclear receptors including the progesterone receptor (Shah et al. 2005; De Amicis et al. 2011), the estrogen receptors α, and β and the androgen receptor (Aquila et al. 2004, 2007; Guido et al. 2011).

Mammalian spermatozoa are unique cells that experience in their lifetime two completely different physiological and metabolic states. In the male genital tract, spermatozoa are quiescent cells while after ejaculation they become metabolically active. In that transition of states, sperm energy metabolism is enhanced in order to complete their maturation, to sustain their mobility and to permit the process of capacitation preparing them to fertilize an oocyte (Aquila et al. 2007; Guido et al. 2011). How the spermatozoon adjusts for such changing conditions has received much attention. What are the molecular integrators that allow these metabolic changes is one aspect of the question? Could the nuclear receptors found in spermatozoa be part of the answer (Rondanino et al. 2014)? Optimal sperm mobility is largely dependent on mitochondrial activity, sufficient energy metabolism and together with sperm count and sperm morphology it is an important male predictive factor for successful reproduction (Piomboni et al. 2012). By itself, asthenozoospermia represents more than 40% of all male infertility cases (Cooper et al. 2010) but despite its high prevalence the mechanisms linking asthenozoospermia with sperm metabolic deficiency or impaired energy metabolism are poorly understood. Earlier studies have shown that asthenozoospermic men have structural and functional alterations in sperm mitochondria leading to defects in respiratory activity (Piomboni et al. 2012). In addition, it has been reported that sperm fatty acid content and semen quality might be related. Eslamian et al. (2015) as well as Chavarro et al. (2011) demonstrated that high dietary intake of trans fatty acids (TFA) or high levels of TFA in spermatozoa were positively correlated with both asthenozoospermia and sperm count defects. This suggested that dietary habits may be partly responsible for the reduction in human semen quality that seems to be reported worldwide (Chavarro et al. 2011; Eslamian et al. 2012).

There are few studies concerning the presence of PPAR isotypes in human sperm cells that address their possible function in male reproduction. Taking into account, the observation that a negative correlation exists between TFA and PPARγ expression (Moschos et al. 2002) this prompted us to explore whether differences in sperm PPARγ mRNA relative expression and protein content could partly explain male subfertility/infertility. In this regard, this study was conducted to evaluate the expression of various subtypes of PPARs in asthenozoospermic and normozoospermic men.

Results and discussion

Semen samples of 27 normozoospermic men (motility > 60%, morphology > 4%, concentration > 15 million/ml) and 28 asthenozoospermic samples (motility < 40%) were evaluated (Table 1). Twelve (42.86%) and two (7.14%) men from asthenozoospermic group, and nine (33.33%) and four (14.81%) men from normozoospermic group had history of smoking and drinking alcohol, respectively (P > 0.05). An additional 39 normozoospermic samples (motility > 60%, morphology > 4%, concentration > 15 million/ml) and 40 asthenozoospermic samples (motility < 40%) were used to assess protein levels by flow cytometric analyses (Table 1). Seven (17.50%) and two (5.00%) men form asthenozoospermic group, and 10 (25.64%) and two (5.13%) men form normozoospermic group had a history of smoking and drinking alcohol, respectively (P > 0.05). For western blot analysis, sub-groups of normozoospermic samples (n = 7; motility > 60%, morphology > 4%, concentration > 15 million/ml) and asthenozoospermic samples (n = 8; motility < 40%) men were selected (Table 2).

Table 1. Characteristics of Normozoospermic and Asthenozoospermic samples used in study by qRT-PCR and Flow cytometric analysis (mean ± SD).

qRT-PCR analysis
	Normozoospermic	Asthenozoospermic
Number	27	28
Age (in year)	34.48 ± 0.95	36.96 ± 1.34
Sperm concentration (million/ml)	98.93 ± 6.94^a	49.50 ± 3.68^b
Sperm motility (%)	78.65 ± 2.02^a	25.97 ± 1.63^b
Progressive motile spermatozoa (%)	60.57 ± 2.93^a	15.73 ± 1.52^b
Non-progressive motile spermatozoa (%)	18.08 ± 1.59^a	10.24 ± 0.96^b
Immotile spermatozoa (%)	21.35 ± 2.02^a	74.03 ± 1.63^b
VCL (µm/s)	111.30 ± 5.66^a	74.72 ± 6.38^b
VSL (µm/s)	56.98 ± 3.29^a	35.43 ± 3.28^b
VAP (µm/s)	73.95 ± 3.83^a	46.91 ± 3.89^b
LIN (%)	51.14 ± 1.35	46.88 ± 2.30
STR (%)	76.65 ± 1.13	73.68 ± 1.95
WOB (%)	66.54 ± 1.10	62.79 ± 2.15
ALH (µm)	2.73 ± 0.12^a	2.09 ± 0.19^b
BCF (Hz)	18.20 ± 0.39^a	14.13 ± 1.17^b
Flow cytometric analysis
Number	39	40
Age (in year)	36.11 ± 1.01	36.86 ± 1018
Sperm concentration (million/ml)	99.77 ± 6.71^a	59.83 ± 5.33^b
Sperm motility (%)	79.06 ± 1.83^a	26.51 ± 1.56^b
Progressive motile spermatozoa (%)	62.28 ± 2.38^a	16.27 ± 1.34^b
Non-progressive motile spermatozoa (%)	16.78 ± 1.37^a	10.24 ± 0.90^b
Immotile spermatozoa (%)	21.19 ± 1.79^a	73.49 ± 1.56^b
VCL (µm/s)	110.99 ± 4.39^a	74.79 ± 5.03^b
VSL (µm/s)	55.82 ± 3.08^a	35.25 ± 2.68^b
VAP (µm/s)	72.99 ± 3.26^a	46.61 ± 3.17^b
LIN (%)	49.77 ± 1.41	45.80 ± 1.78
STR (%)	75.49 ± 1.29	73.47 ± 1.61
WOB (%)	65.54 ± 0.95^a	61.69 ± 1.53^b
ALH (µm)	2.73 ± 0.08^a	2.04 ± 0.14^b
BCF (Hz)	17.92 ± 0.40^a	14.48 ± 0.99^b

VCL = curvilinear velocity; VSL = straight line velocity; VAP = average path velocity; STR = VSL/VAP (straightness); ALH = amplitude of lateral head, and BCF = beat cross frequency. ^a,b Values with different superscripts within rows differ (P < 0.05).

Table 2. Characteristics of Normozoospermic and Asthenozoospermic samples used in study by western blotting analysis (mean ± SD).

	Normozoospermic	Asthenozoospermic
Number	7	8
Age (in year)	33.14 ± 1.40	33.13 ± 3.57
Sperm concentration (million/ml)	130.57 ± 12.09^a	86.88 ± 14.13^b
Sperm motility (%)	78.86 ± 3.04^a	29.88 ± 2.89^b
Progressive motile spermatozoa (%)	60.57 ± 7.25^a	17.75 ± 3.30^b
Non-progressive motile spermatozoa (%)	18.29 ± 4.56	12.13 ± 2.27

^a,b Values with different superscripts within rows differ (P < 0.05).

The data below demonstrate that the PPARα, PPARβ, and PPARγ transcripts were present in human-ejaculated spermatozoa. Analysis was performed by the comparative 2^−(ΔΔCT) method. When normozoospermic and asthenozoospermic groups were compared, we observed that the relative expression of PPARα mRNA did not differ between normozoospermic (1.17 ± 0.08) and asthenozoospermic men (1.03 ± 0.09) (Figure 1A). Similarly, the level of PPARβ transcript was unaltered between normozoospermic (1.39 ± 0.19) and asthenozoospermic samples (1.01 ± 0.14) (Figure 1B). Knowing the importance of PPARs in metabolism we analyzed whether a correlation existed with patient BMI. This was not the case.

Figure 1. PPARs mRNA relative expression in human spermatozoa based on qRT-PCR. Comparisons of PPARα (A), PPARβ (B) and PPARγ (C) mRNA relative expression in normozoospermic (n = 27) and asthenozoospermic (n = 28) groups (mean±SD). Relative expression of PPARα as well as PPARβ mRNA did not differ between two groups (P > 0.05) while relative expression of PPARγ mRNA was higher in normozoospermic than asthenozoospermic men (P = 0.004).

Our observations showed that PPARα mRNA is present in human spermatozoa. Although former studies revealed that PPARα are expressed in Leydig cells, cells of seminiferous tubules (both Sertoli cells and germ cells), as well as in ram spermatozoa (Latini et al. 2008; Kadivar et al. 2016), limited information were available as to the function of this receptor in male germ cells. Most studies on PPARα focused on the function of this receptor in non-reproductive tissues and suggest that PPARα is largely expressed in tissues with high lipid catabolism (Montagner et al. 2011) where it regulates genes involved in lipid metabolism (Abbott 2009). One study by Barak et al. (2002) reported that PPARα might influence spermatozoa fertility by promoting lipid storage mobilization and alteration of their phospholipid composition. PPARα and female reproduction was analyzed and it was shown that PPARα-null mice remained viable and fertile (Latini et al. 2008) but their neonatal mortality rate was greatly increased (Yessoufou et al. 2006). It was hypothesized that PPARα could have an important role in maternal-fetal nutrient exchange (Yang et al. 2008). Meanwhile, the PPARα transgenic mice showed a severe defect in mammary gland development and lactation during pregnancy, resulting in 100% neonate mortality (Yang et al. 2006a). To date, PPARα roles include: regulating insulin secretion during fasting (Lefebvre et al. 2006), skin wound healing assistance (Michalik et al. 2001), suppression of prolonged inflammatory responses (Devchand et al. 1996), regulation of adipose tissue mass upon aging, prevention of age-dependent lesions of the liver, kidney and heart, enhancement of longevity (Howroyd et al. 2004), hepatic adaption to fasting/feeding (Montagner et al. 2011) and coupling of the circadian clock with nutrient and energy metabolism (Yang et al. 2006b). Our observations may add to this already long list of actions and suggest that PPARα could also play a role in mammalian reproduction.

Moreover, we report the presence of the PPARβ mRNA in human spermatozoa. Earlier reports have shown the expression of this receptor in Sertoli and Leydig cells of adult rats (Braissant et al. 1996) while one of the latest study, identified the PPARβ mRNA in ram spermatozoa (Kadivar et al. 2016). To our knowledge, there is little known with regard to PPARβ's role(s) in human sperm cells and, only few studies are available regarding the function of this receptor in the female reproductive system. Using PPARβ knockout mice it was shown that most embryos died at around day 10 due to placenta defects (Barak et al. 2002; Nadra et al. 2006; Reilly and Lee 2008). In a small number of surviving PPARβ^−/- pups, growth retardation and reduced abdominal fat mass were recorded (Barak et al. 2002). Beside the male or female reproductive systems, the rather ubiquitous expression of this PPAR variant, makes it difficult to ascribe a specific function (Wagner and Wagner 2010). In addition, limited studies have been conducted on this receptor and most of them were conducted in rodents (Karpe and Ehrenborg 2009). The consensus is that PPARβ acts as an efficient regulator of fatty acid catabolism and energy homeostasis (Peters et al. 2000; Barak et al. 2002). Animal transgenic studies in adipose tissue and muscle identified PPARβ as a key regulator of fat-burning, a role that opposes the fat-storing function of PPARγ (Evans et al. 2004).

In the present study, the presence of PPARγ in normozoospermic and asthenozoospermic samples was monitored by real-time PCR, flow cytometry, immunofluorescence, and western blotting approaches. Interestingly, the relative expression of PPARγ mRNA was significantly elevated in normozoospermic samples (1.63 ± 0.32) when compared to asthenozoospermic (0.72 ± 0.14; P = 0.004) (Figure 1C). In addition, we observed that PPARγ transcript was positively correlated with both sperm concentration and motility and negatively correlated with the percentage of immotile cells (Table 3). To analyze whether the higher relative expression of PPARγ mRNA in normozoospermic vs. asthenozoospermic samples was associated with a higher protein content, the presence of this protein was evaluated in ejaculated sperm either using flow cytometry analyses and western blotting with an antibody raised against the human PPARγ protein. Flow cytometry (Figure 2) and western blot (Figure 3) both revealed that the PPARγ protein content was found to be lower in the asthenozoospermic group when compared to the normozoospermic group. The proportion of sperm positive for PPARγ protein tended to be higher in normozoospermic (30.47 ± 4.14) than asthenozoospermic (18.82 ± 2.36) and a clear tendency was recorded (P = 0.066). Likewise, western bolt analysis revealed that level of PPARγ protein tended to be higher (P = 0.089) in normozoospermic (1.09 ± 0.10) than asthenozoospermic samples (0.73 ± 0.16).

Table 3. Correlation between PPARγ mRNA relative expression based on qRT-PCR analysis and PPARγ protein levels measured by flow cytometric analysis and sperm parameters in total population (normozoospermic and asthenozoospermic samples).

	r
	PPARγ mRNA relative expression (n = 55)	PPARγ protein level (n = 79)
Age (year)	0.00	−0.12
Sperm concentration (million/ml)	0.33*	0.20*
Sperm motility (%)	0.34*	0.31*
Progressive motile spermatozoa (%)	0.31*	0.23*
Non-progressive motile spermatozoa (%)	0.12	0.24*
Immotile spermatozoa (%)	−0.34*	−0.32*
VCL (µm/s)	−0.02	0.011
VSL (µm/s)	0.01	0.14
VAP (µm/s)	0.04	0.12
LIN (%)	0.06	0.17
STR (%)	0.10	0.10
WOB (%)	0.16	0.19
ALH (µm)	0.03	0.08
BCF (Hz)	0.07	0.15

VCL = curvilinear velocity; VSL = straight line velocity; VAP = average path velocity; STR = VSL/VAP (straightness); ALH = amplitude of lateral head, and BCF = beat cross frequency. *Correlation coefficient in bold were significant at p ≤ 0.05.

Figure 2. PPARγ protein expression in human spermatozoa based on flow cytometric analysis. Percentage of PPARγ protein-positive spermatozoa in normozoospermic (n = 39) and asthenozoospermic (n = 40) groups after flow cytometric analysis (mean±SEM). The proportion of sperm positive for PPARγ protein tended to be higher in normozoospermic than in asthenozoospermic men (P = 0.066).

Figure 3. PPARγ protein expression in human spermatozoa based on western blot analysis. (A) PPARγ protein content in normozoospermic (n = 7) and asthenozoospermic (n = 8) men based on western blot analysis (mean±SEM), (P > 0.05). As seen using flow cytometry (Figure 2), western bolt analysis revealed that level of PPARγ protein tended to be higher in normozoospermic than asthenozoospermic men (P = 0.089). (B) Western blot detection of PPARγ protein in four samples of ejaculated spermatozoa (two normozoospermic = NOR and two asthenozoospermic = AST). ACTB was used as a loading control.

In addition, using the same antibody and immunofluorescence microscopy the localization of PPARγ in human sperm cell was analyzed. We show that PPARγ localized mainly to the sperm midpiece and post-acrosomal regions. Reactivity was also observed in the cytoplasmic droplet (Figure 4A–C for normozoospermic sample and Figure 4D-F for asthenozoospermic sample). Human adipose cells were used as qualitative and semi-quantitative references for PPARγ detection. A strong reactivity towards the antibody was recorded in the nuclear compartment and to a lesser extent in the cytosolic compartments (Figure 4G–I). When looking at the entire population (normozoospermic + asthenozoospermic samples; n = 79) the presence of PPARγ was positively correlated with sperm concentration and motility (both total motility as well as progressive and non-progressive motility). On the contrary, a negative correlation was found with the percentage of immotile cells (Table 3). We found no association whatsoever between PPARγ protein presence and PPARs mRNA content with patient age, BMI, smoking status, environmental exposures, risky occupations and more refined sperm motility parameters as revealed by CASA analyses including: curvilinear velocity, straight line velocity, average path velocity, straightness (straight line velocity/average path velocity), amplitude of lateral head, and beat cross frequency (data not shown).

Figure 4. PPARγ protein localization by Immunocytofluorescent Assay. (A-C): Representative immunolocalization of PPARγ in ejaculated spermatozoa of a normozoospermic man. (A) DAPI for nuclear staining. (B) PPARγ detection. (C) Merged images of (A) & (B). PPARγ localized mainly to the sperm midpiece and post-acrosomal regions. A reactivity was also observed in the cytoplasmic droplet. (D-F): Representative immunolocalization of PPARγ in ejaculated human spermatozoa from an asthenozoospermic man. (D) DAPI for nuclear staining. (E) PPARγ detection. (F) Merged images of (D) & (E). PPARγ localized mainly to the sperm midpiece and post-acrosomal regions. A reactivity was also observed in the cytoplasmic droplet. (G-I): Representative immunolocalization of PPARγ in human adipose cells. (G) DAPI for nuclear staining. (H) PPARγ detection. (I) Merged images of (G) & (H). In human adipose cells used as qualitative and semi-quantitative references for PPARγ detection, a strong reactivity towards the antibody was recorded in the nuclear compartment and to a lesser extent in the cytosolic compartments.

In agreement with earlier reports in pig, ram and already in human (Aquila et al. 2006; Santoro et al. 2013; Kadivar et al. 2016) we confirmed here the presence of PPARγ mRNA in spermatozoa. In human spermatozoa, contrary to its expected subcellular localization for a nuclear receptor acting as a transcription factor, PPARγ was mainly localized in sperm midpiece and post-acrosomal region, while the tail is almost completely unstained. Aquila et al. (2006) first showed the presence of this nuclear receptor in human sperm and although the localization appears similar to our observations there are some differences that can be due to the different antibodies or techniques used. In adipose cells, considered as a reference, PPARγ was both nuclear and cytosolic as expected for a transcription factor. The non-nuclear localization of PPARγ in human sperm is however in agreement with its proposed non-genomic signaling action in this particular cell type (Aquila et al. 2006). Other nuclear receptors such as the progesterone receptor and both estrogen receptors alpha and beta were shown to be present in ejaculated human spermatozoa where they were also suspected to regulate cellular processes through non-genomic mechanisms (Cato et al. 2002; Shah et al. 2005; Aquila et al. 2006).

Our qRT-PCR data showed that PPARγ mRNA content in normozoospermic samples was significantly higher than in asthenozoospermic samples. In addition, we observed a positive correlation between PPARγ presence and spermatozoa mobility. These observations are in agreement with those of Kadivar et al. (2016) who recently demonstrated that PPAR (α, β, and γ) mRNAs were significantly more abundant in highly motile ram spermatozoa when compared to ram sperm samples of lower motility (Kadivar et al. 2016). Our data are also consistent with reports showing that prostaglandins, natural agonists of PPARγ, can increase human sperm motility (Aitken and Kelly 1985; Aitken et al. 1986; Aquila et al. 2006). This suggests that PPARγ is likely to be a player in determining optimal sperm movement. In this context, it is not surprising that Datta et al. (1999) reported that the use of rosiglitazone, a PPARγ agonist, resulted in the activation of the AKT pathway, a downstream effector of the phosphoinositide 3-Kinase (PI3K) signaling cascade known to be regulated by PPARγ in many cell types. In addition, knowing the critical role devoted to insulin in sperm’s glucose metabolism via the regulation of glucose 6-phosphate dehydrogenase (G6PDH) and glycogen synthase enzymes (Aquila et al. 2006), it seems logical that PPARγ, an insulin signaling integrator, was correlated with sperm motility. Altogether, our findings suggest that PPARγ in human sperm is associated with optimal motility regardless of normozoospermic and asthenozoospermic condition.

Spermatozoa metabolism and energy production are not restricted to the availability of glucose, as other substrates may be used in different proportions depending on the mammalian species and also the maturation state of sperm cells (Piomboni et al. 2012; Liu et al. 2015). Ultimately indispensable in mammalian sperm functions, the pentose phosphate pathway (PPP) and pathways relying on the use of lipid substrates through fatty acid oxidation are also important for energy metabolism in sperm (Lenzi et al. 1992; Miki 2006; Piomboni et al. 2012; Qiu et al. 2016). In the latter case, PPARγ might also be involved since it is known in other cell types to be a lipid-activated transcription factor (Tontonoz et al. 1994). Therefore, it is not that farfetched to hypothesize that, in addition to glucose-driven sperm energy production, PPARγ could also regulate lipid-driven sperm energy production. In that respect, it has been reported that there are significant differences in fatty acid composition between astheno/oligozoospermic and normozoospermic males (Zalata et al. 1998). More precisely, it was reported that asthenozoospermic men have higher concentration of saturated or trans fatty acids in their sperm membrane than normozoospermic men (Conquer et al. 1999; Aksoy et al. 2006; Tavilani et al. 2007) and that a high intake of trans fatty acids has negative effects on sperm concentration too (Attaman et al. 2012; Jensen et al. 2013; Chavarro et al. 2014; Eslamian et al. 2015). In one recent study, it was shown that dietary intake of total trans fatty acids was correlated with asthenozoospermia (Eslamian et al. 2015). Of note was the observation that dietary trans fatty acids significantly reduced the accumulation of PPARγ in rat adipose tissue (Saravanan et al. 2005; Morrison et al. 2008). Assuming that sperm cells behave similarly, high trans fatty acids dietary intake could lead to decreased levels of PPARγ in spermatozoa, explaining part of the mobility loss.

PPARs mRNA are present in human spermatozoa. Although the presence of PPARγ in human sperm was already known, that of PPARα and PPARß is now added to the list. We confirm that PPARγ is present in human spermatozoa mainly in the midpiece compartment supporting a putative nongenomic action.PPARγ mRNA is significantly more abundant in normozoosperia as compared to asthenozoospermia. Corresponding protein levels as measured by flow cytometric and western blotting showed a tendency to be higher in normozoospermic than asthenozoospermic men. This preliminary study opens the road for more exploration regarding PPARs roles in sperm as well as for the potential use of known PPARγ agonists in some infertile situations.

Materials and methods

Semen samples collection, preparation, and evaluation

This study received the approval of the Royan Institute Ethics Committee (Tehran, Iran). Semen samples were collected via masturbation according to the World Health Organization (WHO 2010) guidelines in andrology practice from men undergoing infertility treatment referred to the Royan Institute Infertility Center. Each participant provided an informed consent for their enrolment and were submitted to a general questionnaire consisting of demographic issues, medical and drug personal histories, smoking status, alcohol intake, as well as personal infertility history.

We utilized semen samples having less than 1 million leukocyte per milliliter. To eliminate abnormal and round cell sperm, semen samples were washed with Human Tubal Fluid (HTF) medium. Exclusion criteria encompassed the presence of urogenital infections, systemic and chronic diseases (e.g. renal and liver diseases, type 2 diabetes), osteometabolic disorders, malignancy, oral supplement compliance as well as nutritional aspects such as fatty acid and vitamin supplements intakes. Sperm motility and concentration were determined with a CASA system (Computer-assisted sperm analysis; SCATM, Microptic, Version 4.2, Barcelona, Spain).

Pre-wash, RNA extraction, and cDNA synthesis of sperm cells

After semen processing, for high-quality sperm RNA extraction, samples were washed twice with HTF medium. Then, in order to inactivate the cellular RNases and protect the RNA quality, soluble cells in PBS/HSA 2% were centrifuged (14,000 rpm) for 10 min, whereupon the cellular pellets were snap-freezed and moved to a − 70°C freezer. Total RNA isolation was carried out on sperm cells according to the ‘RNeasy plus universal Mini Kit Qiagen (Hilden, Germany)’ following the manufacturer recommendation. The quality and integrity of extracted RNA was evaluated by the A260/280 ratio using a Biowave II (WPA, Cambridge, UK) spectrophotometer and agarose gel electrophoresis (1%) (Bio-Rad, Stanford, USA). Only the samples showing integrity of the RNA (both 18S and 28S rRNA bands), the absence of DNA contamination by electrophoresis and, A260/280 ratio > 1.9 were used for cDNA synthesis. Total RNA was reversed-transcribed into cDNA using TAKARA perfect real-time cDNA synthesis kit (Doraville, GA, USA) on a thermocycler apparatus (Master cycler gradient Eppendorf, Hamburg, Germany).

Real-time PCR (qRT-PCR) analysis

The amount of PPARα, PPARβ, and PPARγ transcripts were defined by real-time PCR (Step One Plus, Applied Biosystems, California, USA). ACTB was selected as a housekeeping gene to normalize all target genes. Primer design were performed for all three PPARs target genes and ACTB using the Perlprimer Software (version 1.1.21) and the NCBI primer Blast (Table 4). Moreover, to check the efficiency of the designed primers, human adipose tissue was used as a positive control. Abdominal adipose tissue samples were prepared by the local surgery room operators. The samples were snap-frozen in liquid nitrogen, then stored at −80^◦C. Afterwards, tissue samples were quicklygrinded in liquid nitrogen. Total RNA were extracted for all samples, using the RNeasy Plus universal mini kit (QIAGEN, Germany); then followed by cDNA synthesis by using the PrimeScript RT Reagent Kit (TAKARA, Japan) according to the manufacturer's instructions. Data analysis was performed by the comparative 2^−(ΔΔCT) method.

Table 4. Sequences of the primers used for the quantification of the housekeeping gene (ACTB) and target genes.

Gene	NIH GenBank accession No.	Product length (bp)	Primer sequence 5´- 3´
ACTB	NM_001101.5	131	F: TCCCTGGAGAAGAGCTACG R: GTAGTTTCGTGGATGCCACA
PPARα	NM_001001928.3	124	F: ATGGTGGACACGGAAAGCC R: CGATGGATTGCGAAATCTCTTGG
PPARβ/δ	NM_006238.5	191	F: CAGGGCTGACTGCAAACGA R: CTGCCACAATGTCTCGATGTC
PPARγ	NM_005037.6	100	F: ACCAAAGTGCAATCAAAGTGGA R: ATGAGGGAGTTGGAAGGCTCT

Flow cytometric analysis of sperm PPARγ

According to the ‘Fixation/Permabilization Solution Kit-BD’ manufacturer recommendation, ten million sperm cells were taken from each sample and washed with 500 µl PBS (1800g for 5 min). Pellets were incubated with Fix-perm (BD Cytofix/Cytoperm, San Jose, CA, USA) for 20 min at room temperature. After a blocking step with the secondary host serum 10% (v/v) detection was carried out by using a rabbit polyclonal anti-PPARγ antibody (cat# PA3-821A; Thermo Scientific, Waltham, Massachusetts, USA, 1:100 dilution in blocking solution) as primary antibody and a goat anti-rabbit FITC (cat# 31,583; Pierce, 1:200 dilution in blocking solution) as secondary antibody. An aliquot of each sample was incubated without primary antibody to generate negative controls (called iso). Human adipose cells were used as positive controls in order to evaluate the accuracy of the technique and the quality of the primary antibody (Chawla et al. 1994). Finally, samples were analyzed in a flow cytometer (BD FACS Calibur; Becton-Dickinson, San Jose, CA, USA) and data were treated using the flowing software (version 2.4.1, Finland).

Immunocytofluorescent assay

Sperm cells were washed in PBS (1X), and a uniform smear was prepared on Poly-L-Lysine coated slides. Cells were then fixed in paraformaldehyde 4% (w/v), washed in PBS-Tween 0.05% (v/v), permeabilized with Triton X-100 (0.5%) and blocked in secondary host serum 10% (v/v). Finally, primary and secondary antibodies were used as described above. In addition, for each sample, one slide without primary antibody was used as a negative control (Grasa et al. 2008). Human adipose cells were cultured in four well plates (fourth passage) and utilized as positive controls. The slides were examined under a fluorescence microscope (Nickon 50i, Tokyo, Japan).

Western blotting analysis

Semen samples were prepared by washing twice with PBS and sperm protein were extracted by lysis buffer. Bradford assay (Thermo Scientific, Rockford, USA) were utilized for protein concentration measurement. Twenty µg protein were used for each sample. Proteins were subjected to electrophoresis onto 12% SDS-polyacrylamide gels and transferred onto polyvinylidene difluoride membranes (Amersham, GE Healthcare Life Sciences, Pittsburgh, USA). Then, membranes were blocked with 2% BSA (Sigma, USA) and 1% skimmed milk proteins (Cell Signaling Technology, USA) at room temperature, 2 h for PPARγ and with 2% BSA only at room temperature, 2 h for ACTB. Membranes were hybridized with primary antibodies overnight at 4°C [PPARγ (1:1000, Thermo Scientific, Waltham, Massachusetts, USA) and Monoclonal ACTB (1:10,000, proteintech, USA) diluted in 2% BSA blocking buffer)]. After three washes with TBST, bands were detected following 1.5 h incubation with secondary antibodies at room temperature [Peroxidase-conjugated goat anti-rabbit IgG and anti-mouse IgG (all purchased from Sigma, USA) used for PPARγ and ACTB, respectively]. Antibody binding was visualized on the membranes by enhanced chemiluminescence detection (Thermo Scientific, Rockford, USA). Image analysis was performed using the ImageJ software v 1.50i (National institutes of health, USA). The changes in PPARγ protein level were subsequently normalized to ACTB and calculated in regard to the normozoospermic group.

Statistical analysis

Data were initially tested for normal distribution using Kolmogorov–Smirnov test (UNIVARIATE procedure). Data with positive skewness, including PPARα, PPARβ, and PPARγ, were log-transformed prior to analysis and data with negative skewness, including WOB and BCF, were reflected and then log-transformed before analysis. Next, data were analyzed using T TEST procedure. Given that data associated with PPARγ protein did not have normal distribution, non-parametric tests were used for statistical analysis. In this regard, the differences in PPARγ levels between normozoospermic and asthenozoospermic samples were analyzed using Mann–Whitney U test. Additionally, the relationship between PPARγ and sperm parameters values was analyzed using the Spearman rank correlation. All analyses were conducted in SAS (SAS, 2013). Differences with P < 0.05 were considered significant.

Authors’ contributions

The main project contributor: MM; Supervisors participated effectively in designing and managing the project: AS, AA; Collaborated effectively in data interpretation, manuscript drafting and copy-editing: JD; Carried out the statistical analyses and helped interpret the results: VA; Offered CASA data and collaborated in data collection: VE; Contributed in setting up the qPCR protocols for gene expressions: FS; Collaborated for the western blots techniques: TR, PR.

Acknowledgments

The authors express their gratitude to the Embryology and Andrology Departments of Royan Institute and the participation of staff from the Flow cytometry and proteomics laboratories for their expertise.

Disclosure statement

The authors declare no conflicts of interest.

Additional information

Funding

This research was supported by The Royan Institute (Tehran, Iran). (Grant number: 94000060).