Fibrin gel as a scaffold for photoreceptor cells differentiation from conjunctiva mesenchymal stem cells in retina tissue engineering

Abstract

Stem cell-based therapies are attraction approaches for regenerative medicine for treating retinal diseases. One of the limitations in cell therapy is cell death following post-injection whit preventing functional integration with retinal tissue. Fibrin gel, a bio-polymeric material with excellent biocompatibility, provides numerous advantages as a tissue engineering scaffold and a stem cell carrier. Therefore, current research is focusing on developing fibrin hydrogel scaffolds to protect stem cells during delivery and to stimulate endogenous regeneration through interactions of transplanted stem cells and retinal tissue. In this study fibrin gel was used as hydrogel scaffold for immobilization of cells. The structural characteristics of fibrin gel scaffold were examined with SEM. Rheological properties of fibrin gel were measured by rheometer and biodegradation rate of fibrin were assayed for 2 weeks. After isolation of stem cells CJMSCs, the cells were differentiated into photoreceptor-like cells by exposing with taurin for 14 days in tissue culture plate (TCP group) and fibrin hydrogel (3 D group). The attachment of cells was analyzed with SEM and MTT. The expression of rhodopsin, PKC, CRX, recoverin, peripherin, nestin and RPE65 as photoreceptor-like cell markers was evaluated by immunocytochemistry and quantitative real-time PCR (RT-PCR) in TCP and 3 D groups. The results of SEM analysis showed CJMSCs were well attached in fibrin gels and there were good integrity between cells and scaffold. The elastic modulus and constant degradation of the gel contributes to the growth and proliferation of cells. There was no toxicity effect of fibrin hydrogel on cells and the viability of cultured cells was higher in 3 D fibrin gels in comparison with TCP groups. After 2 weeks, the expression of rhodopsin, PKC, CRX, peripherin, recoverin, nestin and RPE65 as special markers of photoreceptor cells were detected by Real time PCR and immunofluorescence that these expressions in 3 D groups were higher than TCP groups. In conclusion, our findings showed that application of readily available sources of adult stem cells like human conjunctiva stem cells encapsulated in fibrin gel could be interesting strategy to enhance photoreceptor progenitor cell numbers for repair and regeneration of retina disease such as photoreceptor injury.

Keywords:

• Retina
• conjunctiva mesenchymal stem cells
• tissue engineering
• photoreceptor
• fibrin hydrogel
• 3D culture

Introduction

Photoreceptor loss is the preliminary reason of blindness in degenerative diseases such as age-related macular degeneration and retinitis pigmentosa [1–3]. So far, there is no effective therapeutic strategy in rescuing photoreceptors and retinal function. Thus, there are few therapeutic methods for preserve or restore vision [4,5]. Stem cell based therapy represents a hopeful strategy to regenerate new photoreceptors or retinal pigment epithelial (RPE) cells [6–8].

Tissue engineering is a novel approach to enhance stem cell survival and differentiation into proper cell lineage using materials. During recent years, significant endeavours have been done to develop potentially applicable scaffold materials for tissue engineering and regenerative medicine [9–11].

The survival and engraftment of transplanted cells into host tissue is the largest challenges in stem cell-derived therapies. In general, only approximately less than 20% of the transplanted cells survive, significantly limiting their therapeutic potential [12]. While hydrogel design strategies can help mitigate the challenges of each phase of transplantation [12–14].

A scaffold acts as mimics of cellular environmental cues in the extracellular matrix (ECM) to provide appropriate signals to enhance cell survival and differentiation toward specific cell lineages. Synthetic materials have several limitations like biocompatibility concerns, the inability to support cell attachment, and undesirable degradation rate [12,15–17]. In contrast, fibrin gels as biopolymeric materials provides numerous advantages over synthetic materials such as excellent biocompatibility, nontoxic degradation products, promotion of cell attachment, controllable degradation rate which matches those of retinal tissue regeneration, and degradation in a controllable manner [18–20]. Moreover, the morphology, mechanical properties, and stability of fibrin hydrogel could be tuned by controlling the precursor concentration and ionic strength [21,22]. In addition, fibrin gel also presents high cell seeding efficiency, uniform cell distribution, adhesive property, and improved cellular interaction [23,24]. Additionally, fibrin gel mimics the natural blood-clotting process and self-assembles into a polymer network [25]. The ability for fibrin gel as injectable biomaterials to cure in situ makes it suitable hydrogel with minimally invasive delivery approaches. The ability of fibrin to cure in situ has been exploited to develop injectable for the repair of damaged tissue [26–28].

In recent years, mesenchymal stem cells (MSCs) have been defined as a promising source for different diseases due to the properties such as plasticity and neuroprotection. Moreover, in comparison with embryonic stem cells, MSCs possess some important advantages such as free from ethical issues and easiness of isolation and expansion. In particular, the possibility of deriving autologous MSCs makes them a great candidate for retinal diseases [29,30].

Until now, MSCs have been isolated and expanded in culture from different human tissue. The human conjunctiva stromal cells are one of the sources of mesenchymal stem cells (MSCs) [31,32]. The most important properties of conjunctiva stromal-derived MSCs (CJMSCs) are the expression of undifferentiated stem cells markers, such as Oct-4, Nanog and Rex-1. Furthermore, it has demonstrated that CJMSCs has the potential to differentiate into different types of cells such as osteoblast, adipocyte, and neural cells [33]. In addition, since the CJMSCs are generally isolated from the eye patient, it is possible to isolate the CJMSCs from the damaged retina and use it in the matrix of hydrogel for the treatment of retina diseases without the induction of immune system response [15,34].

In the present study, we investigated the directed differentiation of human CJMSCs cultured on a fibrin-based hydrogel into photoreceptor-like cells. Moreover, differentiation of CJMSCs into photoreceptor like cells on hydrogel scaffold was characterized by investigating their morphology and specific gene expression.

Material and methods

Fibrin gel preparation

For preparation of fibrin gel, 1.5 mg of fibrinogen (Sigma-Aldrich, St. Louis, MO) was dissolved in 0.5 ml M199 solution (Sigma, USA) and transferred to a 24-well culture dish. Then, 50 μl of foetal bovine serum and 15 μl of a thrombin solution (120 U/ml in 1 M sodium buffer; Sigma, USA) were added to the fibrinogen solution (3 mg/ml). The dish was then placed at 37 °C for 1 h to allow gelling to form a 3 D network structure.

Scanning electron microscopy scaffold characterization (SEM)

Scanning electron microscopy (SEM) was used as a tool for investigation of the fibrin scaffold microstructure and cell-seeded fibrin gels. Fibrin gels being freeze-dried in vacuum for 24 h, the scaffold constructs were observed under the SEM then fixed in 2.5% glutaraldehyde, and for SEM, cell-seeded fibrin gels were fixed with 2.5% (w/v)glutaraldehyde for 1 h at room temperature after 6 days in-culture. Thereafter, the samples were washed in phosphate-buffered saline (PBS), and then dehydrated through a graded series in 30%, 50%, 70%, 90%, 95% and 100% ethanol, vacuum dried, mounted onto aluminum stubs, and sputter coated with gold. Samples were examined with scanning electron microscope (KYKY EM-3200; Hitachi, Japan) at an accelerating voltage of 17–25 kV.

Rheology test

Rheological properties of fibrin gel were measured by a Physical MCR 300 rheometer (Anton-Paar, Ashland, VA) which operated in a constant stress mode. 25 mm parallel plate diameter was selected for the test, and the distance between the plates was 50 μm. onto the parallel plate, fibrin gels were placed directly, the plate was heated to 37 °C prior to beginning of the measurement. The tests were performed by dynamic method at small amplitudes of deformation (1%). small-amplitude oscillatory shear measurement at frequencies ranging from 0.1 to 10 rad/s for the fibrin gels with 3 and 4 mg/mL concentration of fibrinogen were studied to the storage (G’) and loss moduli (G”).

Biodegradable rate

Fibrin hydrogel is used to measure the biodegradable rate at 14 days. According to the preparation of fibrin gel, 30 mg of fibrinogen (Sigma, USA) was dissolved in 10 ml M199 solution (Sigma, USA) and transferred to a 48-well culture dish. Then, 5 μl of fetal bovine serum and 1 μl of a thrombin solution (120 U/ml in 1 M sodium buffer; Sigma, USA) were added to fibrin solution. The dish was then placed in to incubator at 37 °C for 1 h to allow the gel to form properly a 3 D network structure. Three samples were excluded from the 48-well plates and samples placed on aluminum foil in the oven at 25 °C for 40 min. Samples with a digital scale based on weight were five decimal places. The same for the other three samples for the next day and the following days were done within two weeks.

Isolation and culture of human conjunctiva mesenchymal stem cells

Human conjunctiva mesenchymal stem cells biopsies were obtained according to the instruction of Tehran University of Medical Sciences research assistant. Briefly, CJMSCs were isolated according to a protocol modified by Nadri et al. [31]. In brief, 2–3 mm² of conjunctiva biopsies {eye globes [from18- to 45-year-old (10men)] were obtained from the Central Eye Bank of Iran} and were kept in supplemented hormonal epithelial medium (SHEM) containing 50 mg/ml dispase II (Sigma Chemical Co.) and 100 mM sorbitol. Under a stereomicroscope, epithelial sheets removed and the isolated stromal tissue segments were cultured in culture medium and incubated at 37° C with 5% CO₂ in a humidified chamber. The culture medium contained DMEM/F-12 (1:1) (GIBCO-BRL) and supplemented with 10% knockout serum (GIBCO-BRL), 4 ng/ml basic FGF (Peprotech), 10 ng/ml human LIF (Chemicon, Temecula, CA) and 5 mg/ml insulin (Sigma Chemical Co.). Finally, the pellet of stromal cells was suspended in medium consisting of DMEM, 10% FBS, and 1% penicillin/streptomycin. After 24 h, nonadherent cells were eliminated by changing the medium. The media were changed every 3 days. HCJMSCs at passage 3 were used for the experiments. After 2 weeks, these cells developed into many clusters and could be used for further studies by flow cytometry analysis.

Flow cytometry analysis

The number of isolated CJMS cells was quantified by flow cytometry. The cultivated cells (two-passage cells of CJMSCs) were lifted with Trypsin/EDTA and counted. About 2 × 10⁶ cells were divided into different aliquots in amber-tinted 5 ml centrifuge tubes with 3% human serum. The pellets were washed twice with PBS and peremabilized by ice-cold MeOH for 20 min at room temperature. The cells were incubated on ice for 30 min and then resuspended in 400 μl PBS and pelleted by centrifugation for 10 min at 400g. Next, the cells were resuspended in 100 μl PBS and stained with FITC-conjugated anti-human CD31, CD34 (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany) and CD90, CD105 (eBioscience, San Diego, CA) at a concentration of 2 mg/ml at 4 °C for 30 min. The cells stained with FITC- or PE-labeled mouse IgG as negative controls. The cells were pelleted, washed twice with PBS, and fixed with 1% paraformaldehyde in PBS. After fixation, FACS analysis was performed on a FACSCalibur cytometer (Becton Dickinson, San Jose, CA) with CellQuest software. WinMDI 2.8 software (USA) used to create the histograms.

In vitro differentiation of CJMSCs into mesenchymal lineages

To confirm the mesenchymal nature of isolated cells, they were treated with appropriate osteo- and adipo-induction media, and their differentiation was confirmed by suitable staining methods including, alizarin red for osteogenic differentiation and adipogenic differentiation respectively.

Cell immobilization in the fibrin gel and induction into CJMSCs

For 3 D cell immobilization, CJMSCs with a concentration of 2 × 10⁵ cells/ml were added to 0.5 ml of prepared fibrinogen solution (3 mg/ml) and carefully mixed then added to 24-well culture dishes. Then, 15 μl thrombin solution (120 U/ml in 1 M sodium buffer) and 50 μl of FBS were added to the fibrinogen solution. The dish was placed in incubator for 1–2 h until gel formation; once the fibrin gel had set, 0.5 ml of M199 containing FBS 10% was added to the dish and the matrix was returned to the incubator. Seeded cells on a tissue culture polystyrene (TCP) plate were maintained in induction medium as our 2 D group. After 24 h, the basic medium was replaced with induction media in two steps. In first step, the growth medium of CJMSCs was replaced with the DMEM/F12 (Gibco, Gaithersburg, MD) and 1% penicillin/streptomycin supplemented with 10% FBS (Sigma, USA) for 24 h. In next step, due to differentiation of cells, they were incubated with differentiating media containing DMEM, supplemented with 50 uM taurine (Sigma-Aldrich) and 2% FBS for 14 days. In the cultured cells, medium were changed every 2–3 days with fresh medium. The cells were cultured in basic medium (DMEM/F12 medium containing 10% FBS were used as control group. At the end of this period, the cells were used for qPCR and immunocytochemistry analysis. The expression levels of the genes and proteins were compared with untreated cells.

Determination of cell viability with the MTT assay

To study the viability of cells in the fibrin gel (3 D) and cell culture plate (2 D), a 3-[4,5-dimethyl-2-thia-zolyl]-2, 5-diphenyl-2H-tetrazolium bromide (MTT) assay was done after 2, 4, 6, and 8 days of cell seeding for comparison of the fibrin 3 D scaffold. At each day, the cells and matrices were incubated with 600 ml from 5 mg/ml MTT for 4 h; then, the medium was removed and 400 ml prepared DMSO was added to dissolve the formazan crystals sufficiently. Aliquots were pipetted into the wells of a 96-well plate and tested by anenzyme-labeled instrument (BioTek, Winooski, VT), and the UV absorbance at 570 nm for each well was measured.

Gene expression

Control and differentiated cells from the 2 D and 3 D groups were collected using 0.25% trypsin/EDTA. Total RNAs were extracted using RNeasy plus mini kit according to the manufacturer’s instructions (Qiagen, Hilden, Germany). Complementary DNA (cDNA) was synthesized by means of First Strand cDNA Synthesis kit (Takara Bio, Inc., Japan). Relative gene expression analysis was done using real-time PCR. The expression of different genes including rhodopsin, PKC, CRX, recoverin, and peripherin a housekeeping gene HPRT1, was analyzed. Real-time PCR used specific primers (Table 1), in the 7500 real-time PCR system (Applied Biosystems, Foster City, CA). In each reaction, Power SYBRH Green PCR Master Mix was mixed with specific primers and 10 ng cDNA in a total volume of 20 μl. Annealing temperature was 55 °C for all genes. Relative gene expression was analysed by comparative Ct method, 2^−DDCt.

Table 1. Specific primers used for qPCR amplification.

Genes	Primer sequences	Size (bp)	Annealing melt
Rhodopsin	F: GGCTGGTCCAGGTACATCC R: GCCTCCTTGACGGTGAAG	179	62
PKC	F: TTTTCCAAGAAAATGCCCCG R: CACGAAGGGGCCAGTACCAT	287	60
CRX	F: CAG GGTTCAGGTTTGGTTC R: CATCTGTGGAGGGTCTTG	149	60
Recoverin	F: GCCTTCTCCCTCTACGAC R: TTT CTCTGT AAGTTTATCATCATC	198	60
Peripherin	F: ACCCCGAGGAATCTGAGAGC R: ATGAGGGGGAGATCCACGTT	229	60
HPRT1	F: CCTGGCGTCGTGATTAGTG R: TCAGTCCTGTCCATAATTAGT CC	125	57

All Ct values calculated from the target genes were normalized to an internal control such as HPRT1 and calibrated using calculation from the undifferentiated CJMSCs. For each experiment, there were at least three different patient samples for each stage and these were done in duplicates.

Immunofluorescent analysis

Immunofluorescent staining was used for characterization of the CJMSCs -derived Photoreceptor cells after 14 days. The cells were fixed and permeabilized with 0.5% Triton X-100 for 10 min. Then the cells were reacted with primary antibodies for rhodopsin (1:500; Abcam, Cambridge, MA), RPE65 (1:500; Abcam), Nestin (1:500; Abcam), b-tubulin III (1:500; Abcam) at 4° C for 24 h, and then reacted with secondary antibody, anti-mouse IgG (Sigma Chemical Co.), at room temperature for 1 h was applied in a dark place at ambient temperature. In addition, the cells were incubated with 4′,6′-diamidino-2-phenylindole hydro-chloride (DAPI; Sigma, USA.) for 30 s. The preparations were photographed using a fluorescence microscope (Olympus BX51, Japan). Control experiments were similarly done.

Statistics

A statistical significant difference between 2 D and 3 D groups was considered at p < .05. Statistical significant differences and quantitative data in the latency of each group were tested by using ANOVA (one-way) test. This was used to analyze variance using Excel software.

Results

SEM observations of fibrin gel

The SEM photographs of fibrin gels are shown in Figure 1(A). It demonstrated that the matrix forms a uniform porous, fibrous scaffold that is composed of fibres within the Scanning Electron Microscopy Scaffold Characterization scale. Additionally, it shows that fibrin gel pores have similar highly interconnectivity and possess a size diameter in the range of 10–200 μm. there are proportionate space between the porosity of the medium and the evaporation of the medium in Freeze Dry, that can be seen porosity and structure scaffold.

Figure 1. SEM morphological photographs can be seen as a three-dimensional open porous and interconnected porosity (A). Cells can be observed in the hydrogel, grown and legs spread out (B).

Figure 1(B) shows a SEM image obtained from photoreceptor cells in the fibrin scaffold. SEM assessment demonstrated good attachment of cells and complete integrity between the cells and hydrogel. The overall results indicated that the CJMSCs were well attached on all the gels and the original round shape of the cells changed to photoreceptor-like shape.

Rheology test

Rheology test was applied to measure the mechanical properties of fibrin hydrogel. We compared the storage and loss modulus, (G′) and (G″), by plots (Figure 2A), which indicated viscous and elastic characteristic of the hydrogel.

Figure 2. Rheology test was applied to measure the mechanical properties of fibrin hydrogel, viability of Photoreceptor cells was in 3 D fibrin hydrogels with an elastic modulus <100 Pa (A). The results reflected the maintenance of microstructure 3 D hydrogel, At first, substantial amount of biodegradation after the first day were evaluated biodegradable rate (B).

For more explanation, elastic response is the storage modulus (G′) and the viscous response is the loss modulus (G″). According to Figure 2(A), (G′) and (G″) values were moderately constant. The (G´) got the values much over zero and were exclusively in excess of (G˝). The results reflected the maintenance of microstructure 3 D hydrogel. Moreover, viability of Photoreceptor cells was in 3 D fibrin hydrogels with an elastic modulus <100 Pa (Figure 2A).

Biodegradable rate

Biodegradable rate is an essential factor in tissue engineering. Fibrin hydrogel has been used to measure the rate of biodegradable. The results showed that the rate of biodegradation was impressive but then was less biodegradability. Hydrogel biodegradable at different times showed that the degradation process is linear and constant (Figure 2B). Constant biodegradation rate of the hydrogel contributes to the growth and proliferation of cells.

Cell culture of conjunctiva mesenchymal stem cells

The spindle-shaped mesenchymal stem cells from human conjunctiva stromal cells were isolated by adhesion of these cells onto the surface of the tissue-culture polystyrene (TCPS) dishes. These cells were utilized for future experiments. After 2 weeks, fibroblast-like cells with spindle-shaped morphology appeared on TCPS dishes (Figure 3A).

Figure 3. Mesenchymal stem cells from human conjunctiva stromal cells (A). CMSCs were treated with appropriate osteo- and adipo-induction media, alizarin red for osteogenic differentiation and adipogenic differentiation, respectively (B,C). Flow cytometry analysis of conjunctiva stromal fibroblast-like cells: Fibroblast-like cells (two passage cells) are analyzed by fluorescence-activated cell sorting and Cell Quest software for the expression of certain markers (D).

In vitro differentiation of CJMSCs into mesenchymal lineages

To confirm their mesenchymal nature, the isolated cells were treated with appropriate osteo- and adipo-induction media, and their differentiation was confirmed via appropriate staining including, alizarin red (for osteogenic differentiation) and oil red (for adipogenic differentiation) staining (Figure 3(B, C)).

Flow cytometry analysis of CJMSCs

CJMSCs (two-passage cells from all donors) were analyzed for expression of surface antigenic characteristics at passage 2 by flow cytometry, as shown in Figure 3(D). The analysis revealed that the expression of surface antigens, such as Thy-1 (CD90) and SH2 (CD105), was strongly positive, but CD31 and CD34 were negative.

Certain properties of isolated cells by our approach convinced us that they were MSCs. These cells were simply difierentiated into mesenchymal lineages in appropriate media and maintained this potential up to passage 10. It has been shown that MSCs express a high level of CD105 (known as end-oglin, SH2), CD90 (known as Thy-1) and lack expression of hematopoietic epitopes (CD31, CD34). Flow cytometry analysis of CJMSCs is in agreement with these previous data. Furthermore, our isolated cells showed the same morphological characteristics of MSCs such as high proliferation capacity, clonogenic potential, spindle-shaped morphology, and difierentiation into different lineages.

Cell viability of cell immobilization in fibrin gel and cell plating

To explore the survival and activity of CJMSCs-derived photoreceptor cells in fibrin gel, 2 D plating and control group, MTT assay was used to quantify cell viability. Figure 4 shows the increasing MTT activity of CJMSCs-derived photoreceptor cells cultured in each three conditions versus time.

Figure 4. Determination of cell viability with MTT assay. MTT assays were explored the survival and activity of CJMSCs -derived photoreceptor-like cells seeding in fibrin gel, TCP on days 2, 4, 6 and 8 of culture. Absorbance corresponds to the number of viable cells. Data are expressed as mean 6 ± SEM of fore independent experiments performed in duplicate. **p < .001, *p < .05.

The increased activity of MTT in cells in all four conditions was significant from days 2–8 (**p < .001). However, the MTT absorbance values of cells in fibrin gel (thus oxidative metabolism by mitochondria) were much higher than the values of cells in 2 D plating and control conditions. It is remarkable that these differences were significant on each of the 4 days of observation. These data obviously showed a notable enhancement of cellular viability in the fibrin gel compared with TCP.

Morphological observation of cell immobilization in fibrin gel and cell plating

Figure 5 shows cells, the phase-contrast images for each sample which were obtained using an inverted microscope at 7 days after seeding (Figure 5A). It was observed that cell morphology of photoreceptor in the matrices obviously differed when CJMSCs-derived photoreceptor cells immobilized for 14 days (Figure 5B). Cells having only a few short processes can be seen in the control group in fibrin gel (Figure 5C). The percent of cells acquired the photoreceptor-like phenotype during incubation in fibrin 3 D matrix considerably surpassed the percent of photoreceptor cells after incubation with the same condition on the plate (Figure 5D). Moreover, cells could develop a dense network of processes in 3 D condition.

Figure 5. Phase-contrast images of CJMSCs cultured for 7 days in control group (A), and in fibrin gel (C). Phase-contrast images of CJMSCs-derived photoreceptor-like cells cultured for 14 days in control group (B), and in fibrin gel (D). Magnification * = 40, scale bar * 100 μm).

Gene expression study of CJMSCs-derived photoreceptor cells in 2 D and 3 D cultures

Cells in the 2 D and 3 D hydrogel were analyzed by means of quantitative real-time PCR (qRT-PCR) on the 14th day after treatment to investigate Photoreceptor cell gene expressions were higher in treated CJMSCs compared to untreated cells. Analysis of Messenger RNA (mRNA) expression indicated that these markers were expressed in treated cells in both 2 D and 3 D (for comparison, see Figure 6(B)). The expression of Photoreceptor cell makers significantly increased in treated cells as 3 D culture in comparison with 2 D culture. The results show that suitable conditions are prepared by the fibrin gel for Photoreceptor cell differentiation of CJMSCs. Photoreceptor cultured in basal condition served as a control. HPRT1 is used as a housekeeping gene control. As shown in Figure 6(B), rhodopsin, PKC, CRX, recoverin, and peripherin gene expressions were higher in 3 D CJMSCs compared to 2 D cells.

Figure 6. Immunocytochemical analysis for expression of as b-tubulin III, Rhodopsin, RPE65 and Nestin as markers of mature neurons in CJMSCs 14 days PT by Photoreceptor inducing signaling molecules compared to noninduced CJMSCs controls. Nuclei were co-stained with 4,6-diamidino-2-phenylindole to visualize nuclei (blue). Scale bar 100 (μM) (A). Gene expression profile of CJMSCs differentiated on scaffolds on day 14. The cells were maintained in induction medium for 14 days and analyzed for expression of photoreceptor genes. The column ratio of mRNA expression levels are the expression rate of genes compared with untreated cells. TBP and HPRT-1 are shown as a control for RNA sample quality. Rest software was used for gene expression analysis using real-time PCR data from the rotor-gene Q. Asterisks show significance expression rate *p ≤ .05 (B).

The expression levels of 5 genes on different surfaces are indicated in Figure 6(B). As shown in Figure 6(B), rhodopsin gene expressions were higher in 3 D CJMSCs compared to 2 D cells. However, peripherin, PKC, CRX, recoverin were expressed in both 3 D and 2 D cells and we did not find any significant difference in its expression between 2 D cells compared with 3 D ones.

As shown in Figure 6(B), qPCR analysis demonstrated that Rhodopsin gene expression was higher in CJMSCs differentiated on hydrogel relative to TCPS1 dishes whereas the gene expression level rhodopsin (1.954; p ≤ .012) was higher in cells on 3 D scaffolds than 2 D scaffolds. In fact, we found a lower level of peripherin gene expression in differentiated cells on TCPS1 dishes. But, the gene expression levels of rhodopsin, CRX and recoverin were higher in cells differentiated on 3 D scaffolds. As shown in Figure 6(B), PKC (1.796-fold; p ≤ .001) and rhodopsin (1.954; p ≤ .012) gene expressions were remarkably higher in cells.

Immunofluorescent analysis of CJMSCs-derived photoreceptor cells

To determine the differentiation state of CJMSCs-derived Photoreceptor cells 14 days post treatment, the Photoreceptor cells were studied by immunocytochemistry staining for b-tubulin III, Rhodopsin, RPE65 and Nestin markers. Figure 6(A) shows the expression of these mature markers in Photoreceptor cells differentiated from CJMSCs 14 days after induction by signalling molecules, whereas they were not expressed in the non-induced CJMSCs control group. It shows that the CJMSCs can respond to the signalling molecules, differentiate into Photoreceptor cells, and express mature Photoreceptor markers. To dissect the morphological changes during neuronal differentiation, the expression of Photoreceptor-specific markers in generated Photoreceptor-like cells using immunocytochemistry. Photoreceptor cells were classically characterized by expression of cytoskeletal proteins such as nestin, Rhodopsin, RPE65 and b-tubulin III, which are expressed in mature Photoreceptors. Figure 6(A) shows the expression of these mature markers in Photoreceptor like cells differentiated from CJMSCs 14 days after induction by signalling molecules whereas they were not expressed in non-induced CJMSCs controls. So the CJMSCs can response to the signalling molecules, differentiate to photoreceptor and express the mature photoreceptor markers. Our achievements indicated that mature photoreceptor, bipolar cell type, glial cell, and neuronal cell proteins such as Rhodopsin, RPE65, b-tubulin III and Nestin proteins were detected in the CJMSCs cultured on TCP dishes (Figure 6A), after treatment with induction medium for 14 days. No positive cells were identified for these markers amongst our untreated CJMSCs.

Discussion

In recent years, MSCs replacement by cell transplantation and tissue engineering provides a promising therapeutic strategy for incurable retinal degenerative diseases [7,10,35]. Stem cells have important role in regenerative medicine but the viability of these cells after transplantation into injured tissue are very low, so for solving this problem, we can use materials as a vehicle for enhancement of cell viability, promotion of the nutrient diffusion, soluble factors and metabolites. Understanding of the scaffold properties is very important for production of a new functional matrix in cells can regenerate the desired tissue structures [11,36]. In the present study, we examined the influence of fibrin gel on differentiation of CJMSCs to photoreceptor like cell lineages. Fibrin gel is one of the most well-known polymers in nature. As an interface for cells grown on matrices, fibrin gel has special features that are not matched by other biomaterials. It is used as a biodegradable and biocompatible injection scaffold for tissue engineering. Furthermore, it has no toxic effects and its physical properties are easily adjusted to prepare a suitable environment for photoreceptor cells [11,23,25,36]. Fibrin gel was used as a scaffold, which is biodegradable, has no cytotoxicity, and is biocompatible. Rheological properties of fibrin gel were measured by rheometer and biodegradation rate of fibrin were assayed for two weeks. The result of these tests showed elastic modulus and constant degradation of the hydrogel contributes to the growth and proliferation of cells. The results of SEM analysis showed fibrin scaffold were well porosity structure and CJMSCs were well attached in all the gels and there were good integrity between cells and fibrin gel. Its physical properties are easily adjusted to prepare a suitable environment for photoreceptor cells [6,15,19,37]. It was recently shown that mesenchymal stem cells that derived from bone marrow and adipose tissue can undergo differentiation into a wide array of cell types such as retinal progenitors and photoreceptors. Conjunctiva stem cells were also used as a new source of cells to get induced to photoreceptor cells. It may be concluded that the CJMSCs for treatment of retinal disorders are more convenient than other sources of stem cells because of the higher rate of proliferation and less immunogenic responses after cell transplantation [33]. Moreover, CJMSCs can be obtained by a simple, safe procedure such as conjunctiva biopsy [31–33].

Conjunctiva stem cells were isolated from tissue and passaged for three times before induction into photoreceptor cells. Morphological observation of isolated cells and the results of flow cytometry were according to previous works [31], and conjunctiva stem cells were positive for the expression of mesenchymal stem cell markers such as CD105, CD90 and negative for the expression of markers such as CD31, CD34. In the majority of the cells, morphological changes were Conjunctiva that combined with an elongating spindle phenotype [31,33]. It is widely known that biomaterials aim to provide an appropriate substrate and suitable microenvironment to increase cellular viability [20,38]. In line with previous studies, our MTT assay results illustrated that viability of CJMSCs cultured on fibrin gel significantly enhanced relative to cells cultured on TCP surface. This might be due to the polymerization processes of the fibrin gel that can facilitate oxygen and nutrients diffusion for the transplanted cells [12,34,39,40]. In this study, we found that culture of CJMSCs in fibrin gel leads to promotion of CJMSCs differentiation into photoreceptor-like cells. Immunocytochemical analysis showed that photoreceptor cell markers such as rhodopsin, Tuj-1, nestin and RPE65 were expressed. Also, the qRT-PCR results showed expression rhodopsin, CRX and recoverin but at higher rates in the 3 D group. The results of immunocytochemistry and real-time PCR represented the higher level of differentiation to photoreceptor-like cells in cultured cells on Fibrin gel scaffold relative to those on a TPC surface (2 D control group) [33,39,40].

Taken together, we have indicated that CJMSCs were cultured on fibrin gel and induced to differentiate into photoreceptor neuronal like cells. Expression of photoreceptors markers such as b-tubulin III, rhodopsin, CRX, recoverin, PKC and RPE65 RNA and protein levels by real-time PCR and immunocytochemistry demonstrated that fibrin gel as a small molecule can promote differentiation of CJMSCs into photoreceptor-like cells. Therefore, our achievements lead to a novel method for photoreceptor derivation form CJMSCs in fibrin gel and hence would provide an efficient strategy for stem cell-based therapy of retinal degenerative diseases in the future [12,31,34,40].

Disclosure statement

No potential conflict of interest was reported by the authors.