Towards osteogenic differentiation of human dental pulp stem cells on PCL-PEG-PCL/zeolite nanofibrous scaffolds

Abstract

Presently, tissue engineering has been developed as an effective option in the restoration and repair of tissue defects. One of the tissue engineering strategies is to use both biodegradable scaffolds and stimulating factors for enhancing cell responses. In this study, the effect of zeolite was assessed on cell viability, proliferation, osteo/odontogenic differentiation, and mineralization of human dental pulp stem cells (hDPSCs) cultured on poly (ε-coprolactone) – poly (ethylene glycol)-poly (ε-caprolactone) (PCL-PEG-PCL) nanofibers. For this purpose, PCL-PEG-PCL nanofibrous scaffolds incorporated with zeolite were prepared via electrospinning. Both PCL-PEG-PCL and PCL-PEG-PCL/Zeolite nanofibrous scaffolds revealed bead-less constructions with average diameters of 430 nm and 437 nm, respectively. HDPSCs were transferred to PCL-PEG-PCL nanofibrous scaffolds containing zeolite nanoparticles. Cell adhesion and proliferation of hDPSCs and their osteo/odontogenic differentiation on these scaffolds were evaluated using MTT assay, Alizarin red S staining, and qRT-PCR assay. The results revealed that PCL-PEG-PCL/Zeolite nanofibrous scaffolds could support better cell adhesion, proliferation and osteogenic differentiation of hDPSCs and as such is expected to be a promising scaffold for bone tissue engineering applications.

Keywords:

• Bone tissue engineering
• nanofibrous scaffolds
• zeolite
• human dental pulp stem cells

Introduction

Nowadays, nanobiomaterials have become popular in drug delivery systems and regenerative medicine [1,2]. These materials are widely applied in cancer therapy [3,4], photodynamic therapy [5] and tissue engineering including cartilage and bone regeneration [6,7].

Treatment of critical-sized bone defects due to trauma, tumor resection and congenital reasons is a major challenge for maxillofacial surgeons. The autografts are usually considered in these defects. However, the morbidity of the donor site and limited availability compromise the application of this method [8]. On the other hand, bone tissue engineering is a promising approach for bone reconstruction with fewer complications compared to autografts [9–11]. Tissue engineering is a combination of scaffolds, cells, and bioactive substance. The scaffold in bone tissue engineering should have biodegradability, biocompatibility and mechanical strength [12]. The nanoscale substrate in bone tissue engineering promotes cell migration, cell adhesion and proliferation [9]. The nanofibrous PCL-PEG-PCL scaffolds fabricated by electrospinning method have shown these properties which could replicate the natural extracellular matrix (ECM) [13,14]. These biodegradable scaffolds provide a suitable three-dimensional structure required for cell adhesion and cell delivery to specific sites [15]. Meanwhile, multipotent stem cells could differentiate into specific cell lineages [16]. Human dental pulp stem cells with a potential of odontogenic and osteogenic differentiation are one of the sufficient and available sources for tissue engineering [17,18]. These cells have proved to be more available and shown higher cell proliferation compared to bone marrow mesenchymal stem cells (MSC) [19].

The nanoparticles loaded on scaffolds as bioactive molecules could enhance the cell adhesion, cell function, cell interaction and biomineralization [1,6,9,15]. Zeolite has a microporous structure and is widely used in biomedical research and tissue engineering field [20,21].

Zeolite molecules have been used as an antibacterial agent, drug carrier and anti-cancer agent [22]. The surface of zeolite nanoparticles in contact with physiological fluid could be covered by a layer of biomaterials such as calcium and phosphate ions, which could enhance the cell adhesion, collagen formation and apatite crystallization. Therefore, zeolite nanoparticles could be considered as osteoinductive materials [23].

Zeolite framework contains aluminum, silicon and oxygen. Silicon has an important role in the formation of hard tissue, especially in the early stage of bone calcification [24,25].

The present study was conducted to evaluate the effect of adding zeolite nanoparticles to PCL-PEG-PCL scaffolds on cell adhesion, proliferation and osteo/odontogenic differentiation of hDPSCs. The PCL-PEG-PCL scaffolds were fabricated by electrospinning method as with our previous study [13].

Materials and methods

Synthesis and characterization of PCL-PEG-PCL polymer

The synthesis and characterization of PCL-PEG-PCL polymer were described in our previous study in detail [9]. Briefly, ring-opening polymerization of ε-caprolactone (20.0 g, 175 mmol) (Sigma-Aldrich Co., Steinem, Germany) and PEG (2.0 g, 0.5 mmol) (Sigma-Aldrich Co., Steinem, Germany) was catalyzed by Sn (Oct)2 (0.5 wt%) (Sigma-Aldrich Co., Steinem, Germany). The polymerization was performed at 130 °C under stirring in a nitrogen atmosphere for 12 h. The unreacted species were removed by dissolving the product in methylene chloride (Merck Chemical Co, Darmstadt, Germany) and precipitated in an excess of cold hexane (Sigma-Aldrich Co., Steinem, Germany). The molecular weight of the product was 45454 g/mol as described in our previous study [9].

Electrospinning of PCL-PEG-PCL/zeolite nanofibers

To prepare the 15 wt% PCL-PEG-PCL solution, PCL-PEG-PCL was dissolved in chloroform/methanol (Merck Chemical Co.) (3:1 v/v) solvent mixture. The solution was magnetically kept stirring at room temperature for 24 h. A polymeric solution containing synthesized zeolite nanoparticles was prepared by mixing PCL-PEG-PCL solution and a certain amount of zeolite nanoparticles (15 wt% of the initial polymer weight). This solution was sonicated for 20 min to completely disperse the zeolite nanoparticles in the PCL-PEG-PCL solution.

For electrospinning, PCL-PEG-PCL and PCL-PEG-PCL/Zeolite solutions were separately transferred into a 5 ml plastic syringe with a 16 G needle. The flow rate of spinning solutions was adjusted at 1–1.2 ml/h, a high voltage of 15–17 KV and a 10–12 cm syringe-collector distance set through electrospinning process. All nanofibers were produced at room temperature and then stored in vacuum until usage.

Isolation and characterization of hDPSCs

We used hDPSCs which were isolated in our previous study [26]. All experimental protocols were approved by the Ethics Committee of Tabriz University of Medical Sciences (TUOMS) which was in compliance with Helsinki declaration and all participants signed the informed consent (Approval No. IRTBZMED.REC.1395.1203).

Before seeding hDPSCs on scaffolds, 70% ethanol and ultraviolet light were used to sterilize the scaffolds for 60 min and 20 min, respectively. Then, the scaffolds were washed with sterile PBS (Gibco, Singapore) three times. The sterile scaffolds were incubated at 37 °C for 24 h. HDPSCs were trypsinized and seeded on scaffolds with 100,000 cells in each well of 24-well and 96-well plates. The control group contained hDPSCs cultured without scaffolds on tissue culture plates (TCPs). The medium of the plates contained DMEM (Gibco, Singapore) amplified with 0.01 fetal bovine serum (Gibco, Singapore), 100 UmL⁻¹ penicillin, 100 μg mL⁻¹ streptomycin, and 1× amphotericin B. The plates were kept in an incubator at 37 °C with 5% CO₂. The cell culture medium was refreshed every 3 days during this period.

Proliferation, viability, and differentiation of hDPSCs cultured on nanofibers

Cell proliferation analysis by the MTT test

The cell survival rate and proliferation of hDPSCs on nanofibrous scaffolds were assessed by MTT assay. The cells were harvested by 0.05% trypsin containing 1 mM EDTA (Gibco, Singapore), after which 500 μL (3–(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) (Carlsbad, CA, USA) was added to the wells after 3, 7 and 12 days to perform the MTT assay. After 4 h of incubation, DMSO (Merck Chemical Co.) was added. The color change and amount of dissolved blue furazan crystals were examined by spectrophotometry at 570 nm. The process of MTT assay was repeated three times and the data were reported as mean ± SD.

Cell morphology

After 14 days, the morphologies of the hDPSCs on mentioned scaffolds were assessed by FE-SEM. Briefly, PCL-PEG-PCL and PCL-PEG-PCL/Zeolite scaffolds were washed with PBS three times and then fixed with3.5% glutaraldehyde for 1 h at 25 °C. Then, the scaffolds were rinsed with PBS and dehydrated with ethanol at different concentrations (50, 70, 90 and 100%). Finally, the samples were air-dried overnight and were then analyzed by FE-SEM.

Alizarin red S activity

After 21 days, mineral deposition produced by hDPSCs on scaffolds was assessed by Alizarin Red S staining protocols [27]. For this purpose, after washing the cells by water, ice-cold 70% ethanol was used to fix them. After 1 h, the ethanol was washed by water after which 40 mm Alizarin red S solution (pH 4.2) was added and left for 15 min. Excess Alizarin red S solution was washed several times with water. Afterward, 10% (W/V) cetylpyridinium chloride in 10 mm sodium phosphate was applied for 15 min. Alizarin red S levels were assessed at 570 nm by absorbance measurement.

qRT–PCR

Twenty-one days after seeding of hDPSCs on scaffolds, total RNA of the cells was isolated using Trizol (YektaTajhizAzma, Tehran, Iran) reagent according to the manufacturer’s instructions. The extracted RNA yield and value were assessed by Gel-electrophoresis and Nanodrop (Thermo Scientific, Waltham, MA, USA). cDNA synthesis kit (YektaTajhizAzma, Iran) used 1 μg extracted total RNA for cDNA synthesis. The synthesized CDNA, Syber green Master Mix, and Primers of BMP2, RUNX2, DSPP and BGLAP genes were mixed and the PCR data were analyzed by ΔΔCT method. The primer sequences are offered in Table 1.

Table 1. Sequences of primers used for qPCR.

Name	Forward	Reverse
BMP2	GAGAAGGAGGAGGCAAAGAAAAG	GAAGCAGCAACGCTAGAAGAC
BGLAP	ATTGTGGCTCACCCTCCATCA	AGGGCTATTTGGGGGTCATC
DSPP	CTGGTGCATGAAGGTGATAGAG	TCCTACTTCTGCCCACTTAGA
RUNX2	ACCTTGACCATAACCGTCTTC	GGCGGTCAGAGAACAAACTA
GAPDH	CAAGATCATCAGCAATGCCTCC	GCCATCACGCCACAGTTTCC

Statistical analysis

ANOVA and T-test were used for statistical comparison of groups and p values <.05 was considered significant. All the experiments were carried out in triplicate.

Results and discussion

Fabrication of PCL-PEG-PCL/zeolite nanofibers

PCL-PEG-PCL nanofibers are extensively studied in bone regeneration applications. Both PCL and PEG are acknowledged as biocompatible and biodegradable polymers allowing for successful culturing of cell types. Also, PCL and PEG have shown good results in forming cell scaffold complex [28,29]. Zeolite nanoparticles were added to the PCL-PEG-PCL polymer solution before electrospinning to improve the characteristic of osteogenic induction. Several electrospinning parameters including electric voltage, concentration, feed injection rate, and distance of source electrode were modified to achieve bead-less nanofibrous scaffolds with relatively similar surface morphology. Figure 1 demonstrates the FE-SEM images of PCL-PEG-PCL nanofibers with or without zeolite nanoparticles along with their diameter distribution. Both PCL-PEG-PCL and PCL-PEG-PCL/Zeolite nanofibrous scaffolds revealed bead-less constructions with smooth surface morphologies and high interconnected pores. Upon the incorporation of zeolite nanoparticles to PCL-PEG-PCL nanofibers, the average diameter of fibers increased. Specifically, the average diameter of the PCL-PEG-PCL fibers was 430.31 ± 180.8 nm, while that of PCL-PEG-PCL/Zeolite fibers was 437.9 ± 176.1 nm. Highly porous and interconnected pore constructions are of the requirements for tissue engineering applications since they can provide an appropriate 3 D space for cell growth and proliferation and would be helpful for water, nutrient and growth factor transportations as well [11].

Figure 1. FE-SEM images of (A) PCL-PEG-PCL and (B) PCL-PEG-PCL/Zeolite nanofibers and the corresponding diameter distributions.

Proliferation, viability, and differentiation of hDPSCs cultured on nanofibers

MTT assay

The cell viability and proliferation of hDPSCs over the PCL-PEG-PCL/Zeolite nanofibrous scaffolds as well as on PCL-PEG-PCL scaffolds without zeolite incorporation were investigated using MTT assay on days 3, 7 and 12 (Figure 2). hDPSCs cultured on TCPs containing DMEM without nanofibers was taken as a control. The proliferation of hDPSCs was not suppressed as being seeded on PCL-PEG-PCL and zeolite coated PCL-PEG-PCL nanofibrous scaffolds. These results indicated that zeolite nanoparticles on PCL-PEG-PCL scaffolds did not have toxic effects on hDPSCs. According to MTT results, the viability and proliferation of stem cells increased over time. The PCL-PEG-PCL/Zeolite scaffolds revealed significantly higher cell viability compared to the PCL-PEG-PCL group at the same time periods. Zeolite membranes also improved cell viability in the study of Tavolaro et al. [30]. The proliferation of viable hDPSCs over the PCL-PEG-PCL/Zeolite scaffolds was particularly considerable on the 12th day. These results indicate the positive effects of the combination of zeolite with PCL-PEG-PCL scaffolds on the cell viability and proliferation revealing their biocompatibility.

Figure 2. MTT assay results for hDPSCs grown on TCPs (control), PCL-PEG-PCL, and PCL-PEG-PCL/Zeolite scaffolds after 3, 7 and 12 days of cell culture. *p < .05, **p < .01, and **p < .001.

FE-SEM analysis

Figure 3 reveals the adhesion and proliferation of hDPSCs on the PCL-PEG-PCL nanofibers with or without zeolite after 14 days of culture. As shown in the FESEM images, the hDPSCs could adhere and uniformly disperse on the surface of PCL-PEG-PCL and PCL-PEG-PCL/Zeolite nanofibrous scaffolds and exhibited cortical cell morphologies. The production of long cytoplasmic prolongations on nanofibers evidenced good cytocompatibility and close interaction between stem cells and nanofibrous scaffolds. The hDPSCs penetrated into interconnected pores, secreted a large amount of extracellular matrix, covered almost the entire area of nanofibers and finally produced multilayer cell sheets such that the underlying nanofibrous samples would not be detectable. The cell density was high on all nanofibers. However, on the PCL-PEG-PCL/Zeolite nanofibers, hDPSCs grew far better. These observations seem to be evidence of the capacity of these improved nanofibrous scaffolds for adhesion and proliferation of hDPSCs and established the remarkable potential of these samples for bone regeneration applications.

Figure 3. FE-SEM images of hDPSCs morphology on the (A,B) PCL-PEG-PCL, (C,D) PCL-PEG-PCL/Zeolite scaffolds.

Alizarin red S staining

Osteoblasts release a large amount of extracellular deposits on the surface of substrates. This process is known as mineralization which represents successful in vitro bone formation. The mineralization can be identified as reddish-black spots via Alizarin red S staining [31]. In order to assess the effect of zeolite on osteogenic differentiation of hDPSCs, Alizarin red S staining was performed on PCL-PEG-PCL nanofibers. Figure 4 displays the Alizarin red S staining activity of cells seeded on PCL-PEG-PCL, PCL-PEG-PCL/Zeolite nanofibers, with TCPs containing DMEM without nanofibers being used as a control. According to the results, compared to TCPs (control) and PCL-PEG-PCL nanofibers, hDPSCs seeded in PCL-PEG-PCL/Zeolite nanofibers presented a significantly higher degree of mineral deposition (p < .01), which was mainly associated with the establishment of an osteo-like phenotype. Our results presented that the addition of zeolite in PCL-PEG-PCL nanofibrous scaffolds had an important positive effect in simulating mineralization, making them appropriate candidates for bone tissue engineering.

Figure 4. (A) hDPSCs osteogenic differentiation on TCPs (control), PCL-PEG-PCL, and PCL-PEG-PCL/Zeolite scaffolds after 21 days of cell seeding. **p < .01; (B) hDPSCs were stained with Alizarin red S staining at 21th day to envisage mineralized bone matrix.

qRT-PCR analysis

The qRT-PCR analysis was performed to evaluate the effect of zeolite on the expression of key genes in bone and dentin formation such as osteocalcin, BMP2, RUNX2, and DSPP after seeding on nanofibrous scaffolds (Figure 5). According to the results, the expression of BMP2 and BGLAP genes in the PCL-PEG-PCL/Zeolite nanofibers was significantly higher than that in other groups (p < .05 and p < .01). BGLAP gene-encoded osteocalcin protein which is an important component of non-collagenic part of bone extracellular matrix [32]. BMP2 plays an important role in the formation of calcified tissues and osteoblastic differentiation [33]. Also, RUNX2 is known as an early osteoblastic differentiation factor [34] which was significantly higher in PCL-PEG-PCL/Zeolite nanofibers group (p < .05). On the other hand, DSPP gene as a classic odontogenic differentiation marker [16] did not show significant up-regulation compared with nanofibrous scaffolds. In summary, the results imply that incorporation of zeolite in PCL-PEG-PCL nanofibers up-regulated the expression of genes responsible for osteogenic differentiation of hDPSCs, but in odontogenic differentiation, it did not show significant differences.

Figure 5. The expression of osteogenic differentiation marker genes, (A) BMP2, (B) RUNX2, (C) BGLAP, and (D) DSPP genes calculated by qRT-PCR in hDPSCs seeded on TCPs (control), PCL-PEG-PCL, and PCL-PEG-PCL/Zeolite scaffolds after 21 days of cell seeding. *p < .05, and **p < .01.

Conclusion

The cell viability, cell adhesion and proliferation of hDPSCs on PCL-PEG-PCL/Zeolite nanofibrous scaffolds were significantly higher than in other groups. Alizarin red S staining and qRT-PCR analysis confirmed the osteogenic differentiation of hDPSCs on PCL-PEG-PCL incorporated with zeolite nanoparticles. These results suggest that zeolite nanoparticles on PCL-PEG-PCL scaffolds could have a key role in osteoblastic physiology and could be a promising means in bone tissue engineering.

Ethical approval

All experimental protocols were approved by the Ethics Committee of Tabriz University of Medical Sciences (TUOMS) which was in compliance with Helsinki declaration (Approval No. IRTBZMED.REC.1395.1203). All participants signed the informed consent and no animal experiments were carried out for this article.

Disclosure statement

The authors report no conflict of interest.

Correction Statement

This article has been republished with minor changes. These changes do not impact the academic content of the article.

Additional information

Funding

The authors highly appreciate financial support for this project by the Stem Cell Research Center of Tabriz University of Medical Sciences.