Response to treatment of murine schistosomiasis with recombinant IL-22 under different circadian timing

ABSTRACT

Response to treatment usually depends on the time of drug administration. Interleukin-22 (IL-22) is known for its protective effect against liver injury. Therefore, the aim was to study the effectiveness of the IL-22 treatment at different circadian timing on S. mansoni-infected mice. Mice grouping included; control group, mice infected with cercariae, and IL-22-treated groups. Treatment with IL-22 (0.36 µg/kg) was performed on infected mice either at 7 am, or 7 pm. Hepatic granuloma index (GI), levels of tumor necrosis factor-α (TNF-α), interleukin-17 (IL-17), IL-22, and immunoglobulin E (IgE) were measured. In addition, hepatic expressions of signal transducer and activator of transcription 3 (STAT3) and β-catenin genes were estimated. Infection with S. mansoni increased pro-inflammatory parameters, STAT3, and β-catenin mRNA significantly (P < 0.05) compared to the control group. IL-22 groups showed a significant reduction (P < 0.05) in liver GI, TNF-α, and β-catenin mRNA compared to infected mice. Moreover, it enhanced STAT3 gene expression (P < 0.05). IL-22 administration at 7 am reduced GI, IL-17, and IgE levels significantly (P < 0.05) compared to 7 pm values. The conclusion, IL-22 might have an immunotherapeutic effect. Its administration at 7 am was more effective in reducing hepatic granuloma and IgE, but further studies are needed to support these findings.

KEYWORDS:

• IL-22
• schistosomiasis
• chronotherapy
• IL-17
• TNF-α
• STAT3

Introduction

Human schistosomiasis is a parasitic disease caused by trematodes of the genus Schistosoma. Nearly 240 million individuals worldwide are infected with schistosomiasis, and more than 700 million people living in endemic regions are at risk of infection [1]. Acute and chronic stages of schistosomiasis can be distinguished from one another [2]; the acute stage might be linked with a Th1 response [3]. When many Schistosoma eggs laid, a quick change from a Th1 response to a Th2-dominated response will then occur [4].

Parasite treatment depends on the use of a single drug which poses serious concerns regarding the onset of resistance [5–7]. Praziquantel (PZQ), a common drug in treating Schistosoma infection since 1970, due to its broader spectrum [8,9]. Although, it was reported to induce hemorrhage in the lungs, abdominal pain, headache, nausea, and diarrhea, and it is secreted in breast milk [10]. The potential resistance problems of Schistosoma to PZQ necessitate searching for alternative drugs to be helpful in the treatment of schistosomiasis. Additionally, the search for bioactive products against Schistosoma has great importance for establishing future strategies to control schistosomiasis [5–7].

IL-22 preserve hepatocytes against liver damage in various mouse models including adenovirus-induced or T cell-mediated hepatitis [11,12]. Additionally, IL-22 protects the host from drug-induced hepatocellular injury [13] and plays a hepatoprotective role during liver inflammation/fibrosis of chronic hepatitis B [14].

STAT3 is a member of the STAT protein family. In response to cytokines and growth factors, it is phosphorylated by receptor-associated Janus kinases it acts as a transcription activator in the cell nucleus. STAT3 becomes activated in response to ligands such as, interferons, epidermal growth factor (EGF), interleukin-5, IL-6, and IL-22 [15,16]. STAT3 mediates the expression of a variety of genes and plays a key role in many cellular processes such as, cell growth and apoptosis [17]. Studies using animal models of hepatic damage suggests that STAT3 prevents fibrosis, mainly because of its hepatoprotective and proliferative properties [18–20].

The β-catenin is a protein acting as an adhesion molecule and a transcription factor [21]. Its function is mainly regulated by Wnt proteins [22]. The β-catenin is responsible for interactions and adhesions between stellate cells [23,24]. The stimulation of stellate cells is related to fibrosis of liver fibrosis in several diseases, including alcoholic steatohepatitis, nonalcoholic steatohepatitis, and viral hepatitis [25].

Various features, components, and functions of the immune system exhibit daily variations. Immunocompetent cell counts and cytokine levels show variations according to the time of the day and the sleep-wake cycle. Moreover, different immune cell types, such as macrophages, natural killer cells, and lymphocytes, contain circadian molecular clockwork. These clocks regulate the function of the immune system, including their response to signals and their effector functions [26]. In addition, the parasites causing diseases have circadian rhythmicity. They slightly alter their composition and function according to the different hours of the day. One of the consequences of such alterations is that parasites become more sensitive to a certain drug at a specific time of the day [27].

Chronotherapy is a new therapeutic dosing strategy that aims to synchronize the timing of drug administration with circadian rhythms [28]. In chronotherapy, the drug availability in vivo is timed to match illness cycles to enhance therapeutic outcomes and minimize negative effects. Many medications have an interdependent relationship between their peak-to-trough rhythmic activity in illness symptoms and risk factors, as well as their pharmacologic sensitivity and pharmacokinetics [29].

Our previous study, showed a protective role of IL-22 against S. mansoni soluble egg antigen-induced granuloma in vitro [30]. In this work, we aimed to investigate the potential chronotherapeutics effect of IL-22.

Materials and methods

Experimental animals

Thirty-two male albino mice (8 weeks old, weighing 21.5 ± 2.5 g) were purchased from TBRI, Giza, Egypt. Animals were kept under 12 h light/12 h dark cycles with light intensity 600 lux, and at a temperature of 25 ± 3°C. The study was approved by the Animal Ethics Committee of the Zoology Department, Faculty of Science, Helwan University (approval no. HUIACUC/Z/AS2903–28).

Mice were divided into four groups. In the control group, mice were injected intraperitoneally with PBS. In the infected group, mice were injected subcutaneously with approximately 40 cercariae of S. mansoni for 45 days. IL-22 groups; infected mice were treated with IL-22 either at 7 am or 7 pm for 14 days. Recombinant mouse interleukin-22 protein was purchased from R&D systems (Catalog no. 582-ML-010/CF, USA) as a lyophilized endotoxin-free product. It was dissolved in a phosphate buffer solution, and the dosage for each mouse was 0.36 µg/kg [30]. Table 1 shows the animal grouping and treatment protocol.

Table 1. The animal grouping and treatment protocol.

Animal groups	Treatment protocol	Sacrifice day
Control (n = 8)	Healthy mice were injected intraperitoneally (i.p) with PBS daily at 7 am.	At the 14^th day after 6 hours from the last dose.
Infected mice (n = 8)	Infected mice were injected i.p with PBS daily at 7 am.
IL-22 treated mice (7 am) (n = 8)	Infected mice were treated daily with IL-22 (0.36 µg/kg of IL-22, by i.p injection at 7 am).
IL-22 treated mice (7 pm) (n = 8)	Infected mice were treated daily with IL-22 (0.36 µg/kg, by i.p injection at 7 pm).

The experiment lasted for 14 days then the animals were sacrificed by decapitation, after six h from the last treatment. Mice from the control group, infected group, and 7 am treated group were sacrificed, during artificial light (600lux). IL-22 treated group at 7 pm was sacrificed at low light intensity (3 lux). Blood samples were collected and left for half an hour and then centrifuged at 500 g for 15 min at four °C to separate serum. The liver was removed and weighed. Relative weights of the liver in the infected and treated groups were calculated relating to the control group. The liver in each mouse was divided into two parts: one part was used for the histopathological examination and the second part was kept frozen in −80 for the molecular techniques. Sera were frozen at −80 for measuring cytokines and IgE.

Histopathological examination

Samples from liver tissues (n = 5/group) were fixed in neutral formalin (10%), dehydrated, cleared, embedded in paraffin, sectioned (5 µm thick), hydrated and stained with hematoxylin and eosin (H& E) for histopathological examination [31].

Measurement of granuloma area

The distance between liver sections should be at least 250 µm to avoid measuring the same granuloma. In each liver section, 10 granulomas with visible central eggs were randomly selected; their diameters were measured at 10× magnification using the Image J program (version 1. x; Image J Software, U.S). Two perpendicular maximal diameters were measured, getting the mean diameter for each granuloma and then calculating the mean granuloma area for each mouse in a group.

Measurement of cytokines and immunoglobulin E (IgE) by ELISA

TNF-α, IL-17, IL-22 and IgE were measured using Sandwich-ELISA method according to the manufacturer’s instructions. (Mouse ELISA kit, Sun Long Biotech, China, Catalog no. SL0547Mo, SL0314Mo, SL0865Mo, and SL0597Mo, respectively).

Real-time polymerase chain reaction (RT-PCR)

The extraction of mRNA was performed by the TRIzol reagent method (ThermoFisher Scientific, USA). The quality and integrity of mRNAs were determined using the Agilent RNA 6000 Nano Kit on the Agilent 2100 Bioanalyzer (Agilent Technologies). mRNA was quantified by measuring A260 nm on the ND-1000 Spectrophotometer (NanoDrop Technologies). Extracted mRNA was reversed transcribed to cDNA using the Thermo scientific reverted first stander cDNA synthesis kit (ThermoFisher Scientific, Lithuania). All PCR runs were performed on the Applied Bio-systems 7500 instrument.

Real-time PCR reactions of mRNA were performed with Applied Bio-systems 7500 system using the QuantiTeh SYBR Green PCR Master Mix Kit (QIAGEN). The relative gene expression of STAT3 and β-catenin was normalized to the level of GAPDH. The sequences of primers were showed in Table 2. Fold changes of STAT3 and β-catenin studied in the present samples were calculated using the comparative CT method, and the 2^−ΔΔCt was calculated according to the formula of Pfaffl [32]. All reactions were performed in triplicates for each sample. At least three independent experiments were carried out for each experimental condition. GAPDH was an internal reference for the STAT3 and β-catenin primers.

Table 2. Primers sequences of genes analyzed by real time PCR.

Gene	Sequences (5’-3’)
STAT3	Forward: GCCGCCGTAGTGACAGAGAA Reverse: GGCAGCAACATCCCCAGAGT
β-catenin	Forward: CTGCTCATCCCACTAATGTC Reverse: CTTTATTAACTACCACCTGGTCCT
GAPDH	Forward: TGTGTCCGTCGTGGATCTGA Reverse: TTGCTGTTGAAGTCGCAGGAG

Signal Transducer and Activator of Transcription 3 (STAT3) and Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH).

Statistical analysis

Statistical analysis was performed using Graph Pad Prism (version 3.0; Graph Pad Software). One-way analysis of variance (ANOVA) was used for comparison between different treatments. T-test analysis was used for comparison between IL-22 at 7 am and 7 pm groups. P-values <0.05 were considered significant.

Results

Relative weight of liver

The relative weight of the liver showed a significant increase (P < 0.05) in the infected mice. IL-22 treatment either at 7 am or 7 pm also increased the liver relative weight significantly (P < 0.05) compared to the control group. In contrast, the relative weight of the liver was decreased (non-significant change) in both treated groups compared to the infected one (Figure 1)

Figure 1. The relative weight of the liver among different groups.

Data is represented as mean ±SD.

*Significant at P < 0.05 as compared to control.

Histopathological changes and granuloma index (GI)

The control group showed a normal structure of the liver with hepatic lobules, and hepatic strands surrounding a central vein. In the infected and treated mice, several granulomas appear in the histological sections, but their diameters were diminished in the treated groups (Figure 2) Hepatic granuloma of infected mice appeared with central eggs and was surrounded by fibro-collagen bundles entangling fibroblasts and inflammatory cells (Figure 3). A significant decrease (P < 0.05) in the hepatic GI was detected in S. mansoni-infected mice treated with IL-22 at 7 am, while a non-significant decrease was observed in the 7 pm treated group compared to S. mansoni- infected mice (Figure 4)

Figure 2. Photomicrographs of sections of liver showing a normal liver structure with hepatic strands (H) surround central veins (v) in the control mice. Sections of S. mansoni-infected mice showing a number of granuloma (G) with eggs (E). Sizes of the granuloma in IL-22 (0.36 µg/kg) treated groups appear smaller than the infected group (H&E, scale bar = 100 μm).

Figure 3. A photomicrograph of sections of infected liver showing a high magnification (400X) of granuloma (G) with central eggs (E), surrounded by fibro-collagen bundles entangling fibroblasts (arrows) and inflammatory cells (IC) (H&E, scale bar = 100 µm).

Figure 4. Granuloma index (GI) in the liver of S. mansoni-infected mice treated with IL-22 at 7 am or 7pm.

Data is represented as mean ±SD.

@ Significant at P < 0.05 as compared S. mansoni infected mice.

b Significant at P < 0.05 as compared to IL-22 at 7 am.

Mice were treated with IL-22 (0.36 µg/kg, i.p, daily) at 7 am or 7 pm.

Sera cytokines’ level

A significant increase (P < 0.05) in the serum level of TNF-α was recorded in the infected mice and IL-22 at 7 pm treated group compared to the control mice. In contrast, a significant reduction in its level was observed after IL-22 treatment (P < 0.05) compared to the infected mice. Non-significant changes were detected between the two treated groups (Figure 5(a)). On the other hand, the serum level of IL-17 showed a significant increase (P < 0.05) in S. mansoni-infected mice and mice treated with IL-22 compared to the control group. In comparison with the infected group, IL-17 levels significantly (P < 0.05) increased after the treatment with IL-22 either at 7 am or 7 pm. In addition, IL-17 was significantly elevated in the 7 pm treated group compared with the 7 am one (Figure 5(b)). Moreover, the serum IL-22 levels increased significantly (P < 0.05) in the infected mice compared to the control. On the contrary, a significant decrease (P < 0.05) in its level was recorded, in both treated groups, compared to the control and infected groups. Levels of IL-22 were more reduced (P < 0.05) in the 7 am treated group than the 7 pm treated one (Figure 5(c)).

Figure 5. Serum cytokine level in S. mansoni-infected mice treated with IL-22 at 7 am or at 7pm. a: TNF-α (Tumor necrosis factor alpha), b: IL-17(Interleukin 17), c: IL-22 (Interleukin 22).

Data is represented as mean ±SD.

*Significant at P < 0.05 as compared to control.

@ Significant at P < 0.05 as compared to S. mansoni-infected mice.

b Significant at P < 0.05 comparing IL-22 at 7 am with that at 7 pm.

Mice were treated with IL-22 (0.36 µg/kg, i.p, daily) at 7 am or 7 pm.

Serum level of immunoglobulin E (IgE)

A significant increase (P < 0.05) in the serum IgE level was recorded in S. mansoni–infected mice compared to the control group. On the contrary, its levels were decreased in mice treated with IL-22 at 7 am or 7 pm compared to the infected mice. On the other hand, serum IgE levels showed a significant increase (P < 0.05) in mice treated with IL-22 at 7 pm as compared to mice treated at 7 am (Figure 6)

Figure 6. Serum IgE level in S. mansoni-infected mice treated with IL-22 at 7 am or at 7pm.

Data is represented as mean ±SD.

*Significant at P < 0.05 as compared to control.

@ Significant at P < 0.0 as compared S. mansoni-infected mice.

b Significant at P < 0.05 as a comparison between IL-22 at 7 am and 7 pm.

Mice were treated with IL-22 (0.36 µg/kg, i.p, daily) at 7 am or 7 pm.

Hepatic STAT3 and β-catenin gene expression

The present data showed a significant upregulation (p < 0.05) of hepatic STAT3 mRNA in the infected mice (fold, 4.3) and those treated with IL-22 either at 7 am (fold, 10.4) or at 7 pm (fold, 11.0) compared to control mice. Significant upregulation of STAT3 mRNA was also recorded in both treated groups compared to the infected mice (Figure 7(a)). Additionally, the expression level of β-catenin mRNA was upregulated significantly in the infected mice, compared to the control, by fold change 4.3. Significant downregulation in β-catenin mRNA was observed after IL-22 treatment either at 7 am or 7 pm compared to the infected group (Figure 7(b)).

Figure 7. The expression level of mRNA STAT3 (a) and β-catenin (b) in S. mansoni-infected mice treated with IL-22 at 7 am or at 7 pm.

Data is represented as mean± SD.

*Significant at P < 0.05 as compared control.

@ Significant at P < 0.05 as compared infected mice.

Mice were treated with IL-22 (0.36 µg/kg, i.p, daily) at 7 am or 7 pm.

Discussion

Chrono-therapeutic drug delivery offers a novel strategy in the planning of pharmacologic interventions for the efficient treatment of numerous diseases. Drug efficiency increased when delivered to the target organ at the optimum timing [33,34]. Several studies indicated the protective function of IL-22 through the inflammation of the liver [11,35,36]. Therefore, the present work studied the efficiency of IL-22 administration at different times of the day for treating schistosomiasis. First, the study surveyed the inflammatory status in the infected mice after IL-22 treatment. A reduction in the pro-inflammatory cytokine levels, TNF-α, was found which is in agreement with Prado et al. [37] who found an elevation in TNF-α and IL-1 β levels in IL-22−/− mice which was associated with an increase in lung inflammation. Further, the treatment with IL-22 in this study induced an elevation in the IL-17 while reducing IL-22 levels in the serum compared to infected mice. IL-17 and IL-22 act in concert as they provide a barrier against extracellular pathogens. IL-17A and IL-17F are common pro-inflammatory mediators. While, IL-22 seems to be a new type of immune mediator that enhances the immune defenses of tissue cells, inhibits tissue damage, and promotes their regeneration [38]. The reduction in IL-22 level after its external administration may be due to a negative feedback mechanism. Additionally, the half-life of recombinant human IL-22is less than 2 h in animals [39].

Further, IL-17 and IL-22 were more elevated after the administration of IL-22 at night onset than during the day in this study. Similarly, Wang et al. [40] found a circadian rhythm in IL-17 and IL-22 secretion in type 3 innate lymphoid cells (ILC3) with a peak at the onset of the dark phase. In addition, Yu et al. [41] reported that Th17 frequency which is characterized by expressing many regulatory cytokines, including IL-17 was increased in mice with colitis in the active cycle (at night). Circadian clock modulates Th 17 function. The retinoic acid receptor-related orphan nuclear receptor (RORγt) regulates the differentiation of the pro-inflammatory Th17 cells and induces the expression of IL-17 and IL17F, whereas Rev-erbα antagonizes the function of RORγt by binding the same DNA motif [42,43] Accordingly, Th17 lineage specification varies diurnally and is altered in Rev-erbα−/− mice [41]. Moreover, IL-22 production is impaired in Rev-erbα−/− mice [40].

IgE antibody is mainly involved in allergic reactions to environmental allergens, though it is an important component of host-protective immune responses against helminthic parasites [44]. In the present study, infection with S. mansoni increased IgE level. Lynch et al. [44] suggested that parasitic infections enhance the generation of anti-parasite IgE antibodies and the nonspecific polyclonal IgE that causes an elevation in total serum IgE levels. Herein, IL-22 treatment diminished serum IgE levels to reach normal levels, which may be valuable for defense against parasites. Consistent with this result, Amiri et al. [45] found that the anti-IgE treatment of S. mansoni-infected mice decreased worm burden and egg production.

IL-22 administration at the light onset reduced IgE levels more than when it administered at night. This result agreed with Zheng et al. [46] who found that IgE-mediated acute-type allergy response in the skin was elevated in the active phase (at night) with immune response increase. Moreover, IgE/mast cell-mediated allergic reactions in vivo are temporally controlled by the circadian clock [47].

In the present study, STAT3 gene expression was higher in IL-22-treated groups than in infected ones. Several studies revealed a protective role of STAT3 in the intestine during experimental colitis [48–50]. The mechanism involves the secretion of IL-22 by innate immune cells which evokes STAT3 signaling. Herein, the elevation of STAT3 gene expression was linked with the reduction of TNF-α and the elevation of IL-17. Previous studies revealed the anti-inflammatory role of STAT3 [51,52]. Its deficiency caused excessive production of pro-inflammatory cytokines, including TNF-α, IL-6, IL-12, and IFN-γ in macrophages, neutrophils, and DCs [53]. At the molecular level, STAT3 stimulates the expression of the Th17 lineage-specifying factors RORᵧ and RORα, which are required for Th17 development and IL-17 expression [54–59].

β-catenin is a protein with dual functions, acting as both an adhesion molecule and a transcription factor [21]. In this study, a significant downregulation in β-catenin expression was observed after IL-22 treatment. Similarly, Li et al. [60] revealed a reduction of β-catenin protein levels in the cytosol by IL-22 administration. Matsu-Ura et al. [61] stated that the WNT/β-catenin pathway regulates β-catenin expression under circadian control. On the other hand, the present result detected an inverse correlation between the expression levels of β-catenin and STAT3 upon IL-22 treatment. Similarly, Hu et al. [62] recorded an increase in p-STAT3 and a decline in β-catenin gene expressions in hepatic stellate cells after IL-22 treatment. Thus the decline in β-catenin gene expression during the dark phase may be via the corresponding increase in IL-22 directly after its administration.

The current result revealed a decline in GI after IL-22 treatment. Consistent with this result Dkhil [63] found a reduction in granuloma size after berberine treatment which reflects antifibrotic effects. Furthermore, a significant reduction in the liver GI was detected when it was administered at 7 am rather than at 7 pm. This result may be explained firstly by the worms’ active phase (night time), which is a period of stress, increased egg-laying, and physical activity. The worm’s increased egg-laying rates may coincide with the periods of higher host insulin levels [64,65]. This means the number of eggs increased at night during the active phase of the worm. Secondly, the circulating numbers of some immune cells (such as monocytes, neutrophils, and lymphocytes) exhibit a 24-hour daily rhythm, which is translated into variations in the body’s acute response to infection [26,66,67]. Immune response activity peaks at the beginning of the active phase [68–70].

According to Scheiermann et al. [68], the central suprachiasmatic nucleus clock regulates circadian rhythms in the adhesion molecules expression like ICAM-1 and VCAM-1, chemokines, and chemokine receptors on leukocytes like CCL2 and CXCR4, which helps to regulate leukocyte recruitment depending on the time of the day. Thus, the controlled leukocyte migrations increases during the active phase of the host with increasing immune response. Taken together, IL-22 administration at night triggers more immune responses leading to an elevation in liver GI during the active phase (at night) of the host.

In conclusion

Herein it’s the first time to study the chrono-therapeutic effect of IL-22 treatment on schistosomiasis. IL-22 treatment of S.mansoni-infected mice, at the light onset, reduced GI and IgE levels, which may be due to synchrony with the host circadian rhythm. These results reflect a potential chrono-therapeutic effect of IL-22. Further studies were needed to investigate the mechanism of IL-22 action on both the host and the parasite and its relation to the host circadian rhythm.

Disclosure statement

No potential conflict of interest was reported by the author(s).

Additional information

Funding

This paper is based upon work supported by Science Technology & Innovation Funding Authority (STDF) under the grant [BARG 38146].