33
Views
0
CrossRef citations to date
0
Altmetric
ORIGINAL RESEARCH

TNFSF13B rs9514828 C>T Polymorphism is Associated with Incidence of Atherosclerosis and Therapeutic Outcomes in Patients with Systemic Lupus Erythematosus

ORCID Icon, ORCID Icon, ORCID Icon, ORCID Icon, ORCID Icon & ORCID Icon
Pages 95-106 | Received 04 Dec 2023, Accepted 25 Apr 2024, Published online: 02 May 2024

Abstract

Background

Systemic lupus erythematosus (SLE) is a complex autoimmune disease with numerous clinical manifestations. Organ involvement can aggravate patients with SLE and cause comorbidities such as atherosclerosis. Recently, the TNFSF13B gene has been found to be linked with SLE events. This study aimed to analyze the association between single nucleotide polymorphisms of the TNFSF13B rs9514828 with incidence of atherosclerosis and therapeutic outcomes in patients with SLE.

Patients and Methods

This case-control study included 84 SLE patients, of whom 21 patients with SLE with atherosclerosis and 63 patients with SLE without atherosclerosis. Using enzyme-linked immunosorbent assay method, interleukin-6 and interferon gamma levels were quantified. The TNFSF13B gene polymorphism was evaluated using polymerase chain reaction followed by sequencing. The lupus low disease activity state (LLDAS) criteria were used to measure the therapeutic outcomes. Statistical analysis was conducted using binary logistic regression.

Results

The genetic variations of TNFSF13B rs9514828 were CC = 35, CT = 41, and TT = 8. There was an association between TNFSF13B rs9514828 C>T polymorphism in patients with SLE with and without atherosclerosis (p = 0.03; odds ratio (OR) 4.72, 95% confidence interval [CI] 1.22–18.37). Furthermore, the TNFSF13B rs9514828 C>T polymorphism had association with the therapeutic outcomes of patients with SLE who manifested with LLDAS (p = 0.00; OR 7.58, 95% CI 2.61–21.99).

Conclusion

The association of TNFSF13B rs9514828 C>T polymorphism and incidence of atherosclerosis as well as the therapeutic outcomes in patients with SLE indicate the potential utility of the gene variation as screening tool to employ personalized medicine to undertake preventive measures in order to prevent atherosclerosis and to predict a poor prognosis in SLE patient.

Introduction

Systemic lupus erythematosus (SLE) is an autoimmune disease that induces widespread tissue inflammation with complex clinical manifestations. This disease is caused by the interaction of three factors, including the environment, hormones, and genetics, that is characterized by organ and tissue injury.Citation1–4 SLE prevalence varies depending on ethnic/racial groups and regions. In the United States, the prevalence of SLE ranges from 15 to 50 per 100,000 population, while in African–American women, the incidence of SLE is threefold higher than Whites. SLE affects more women than men with a ratio of 9:1 and is also common during the reproductive age group (15–40 years).Citation5–7 In Hasan Sadikin Hospital in Bandung, Indonesia, 813 patients were diagnosed with SLE, revealed ratio of 22:1 for female: male.Citation8

SLE pathogenesis involves innate and adaptive immune systems, including cell and tissue components. Autoantibodies are generated from B-cell hyperactivity through T-cell stimulation and antigen exposure to the apoptotic cell surface.Citation9–12 Apoptosis (cell death) occurs in dying cells and dead cellular material that should be phagocytosed by phagocytic cells are recognized by cell surface antigens. In patients with SLE, the suboptimal disposal of apoptotic cells may trigger an immune response. Major histocompatibility complex in antigen-presenting cells (APC) binds to T-cell receptors. These receptors trigger B-cell hyperactivity and produce cytokines and antibodies, such as antinuclear antibodies, that are identified in patients with SLE.Citation13–15 B lymphocyte hyperactivity, such as proliferation and maturation, is influenced by cytokine B-cell-activating factor of the TNF-family (BAFF) or commonly known as the B lymphocyte stimulator (Blys), TALL-1, or THANK. This protein is encoded by the TNF superfamily member 13B gene (TNFSF13B) located in chromosome 13q.32–34. TNFSF13B rs9514828 polymorphisms (−871 C>T) are located at the promoter region. In patients with SLE, the TNFSF13B gene expression remains high.Citation16 Thus, BAFF protein expression is increased.Citation7,Citation14,Citation16–18 BAFF is expressed on the myeloid and epithelial cells stimulated by inflammatory cytokines such as interferon (IFN)-γ, IFN-α, interleukin (IL)-10, Toll-like receptor (TLR)-3, TLR-4, and TLR-7. BAFF is also known as a regulator of T-cell immunity on APCs including the production of inflammatory cytokines. In SLE, BAFF overproduction is associated with disease activity and increased autoantibody production.Citation16,Citation19,Citation20

Immune system dysregulation can trigger inflammation and injury to the vascular system, which are markers of atherosclerosis.Citation21–24 In patients with SLE, risk factors that could trigger atherosclerosis in immunological mechanisms and cardiovascular risk factors, immune complexes, and inflammatory cytokine production such as type I and type 2 IFN, IL-6, and IL-17. SLE disease activity and glucocorticoid therapy use are specific factors. Traditional factors that contribute to the acceleration of atherosclerosis in SLE include hypertension, hypercholesterolemia, diabetes, and smoking history. Previous studies have revealed that an increased intima-media thickness (IMT) is a marker of atherosclerosis in SLE.Citation25–29

In autoimmune diseases such as SLE, the existence of genetic polymorphisms may influence the efficacy of therapy in terms of the choice of treatment and dosage management. In recent years, the study of polymorphisms has become a concern among researchers due to the development of personalized medicine. Each individual has a genetic profile and response to drug therapy that is different, which in turn remarkably affects the appropriate use of drugs.Citation30–32 The main therapeutic options in the treatment of patients with SLE include immunosuppressants and glucocorticoids. Moreover, patients with SLE treated with high-dose prednisolone (>6 mg) accompanied by a long-term use have a significant risk of morbidity due to permanent tissue damage. The risk of cardiovascular events due to glucocorticoid use has also been reported.Citation33,Citation34

This study aimed to analyze the association between single nucleotide polymorphisms of the TNFSF13B rs9514828 gene and therapeutic outcomes and atherosclerosis incidence in patients with SLE.

Materials and Methods

Study Populations

In this study, we were using biological archive (DNA) from patients diagnosed with SLE at the Rheumatology outpatient clinic at Dr. Hasan Sadikin General Hospital, Bandung, West Java, Indonesia. The Research Ethics Committee of Universitas Padjadjaran, Bandung, has approved all the procedures in this study, No. 128/UN6.KEP/EC/2020 including to review medical records. This study covers patient data confidentiality and compliance with the Declaration of Helsinki. This was a case-control study and all patients were receiving standard SLE therapy according to Recommendation form Indonesian Rheumatology AssociationCitation35 and also Systemic Lupus International Collaborating Clinics (SLICC).Citation36 A total of 84 patients with were enrolled with inclusion criteria namely diagnosis was established according to the criteria from Systemic Lupus International Collaborating Clinics (SLICC) in 2012,Citation36 complete lupus low disease activity state (LLDAS) and medical records data including age, gender, IMT, duration of disease, glucocorticoid therapy, blood pressure, glucose, cholesterol and Body Mass Index (BMI). The total samples were divided into two groups: patients with SLE with atherosclerosis (21 patients) and without atherosclerosis (63 patients) measured by carotids Doppler ultrasound using GE Vivid S6 (Boston, USA). The SLE with atherosclerosis group are patients who manifested with an IMT ≥ 0.9 mm.Citation14 The demographic characteristics and clinical data were obtained from the medical records. Patients who were receiving treatment for certain diseases were excluded in this study.

Serum IL-6 and IFN-γ Levels

The IL-6 and IFN-γ levels were quantified from the serum of patients with SLE using human IL-6 enzyme-linked immunosorbent assay (ELISA) KIT and human IFN-γ ELISA KIT (Sigma-AldrichTM) with product numbers RAB0306 and RAB0223. The samples were read at 450 nm via the MultiskanTM Go Microplate Spectrophotometer (Thermo Fisher Scientific, Waltham, MA).

Genotyping

Genomic DNA was isolated from the whole blood using GeneJET Genomic DNA Purification Kit (Thermo Scientific) and isolated according to manufacturer’s instruction. TNFSF13B rs9514828C>T (bp 138) amplification was conducted using polymerase chain reaction (PCR) (BIO-RAD T100TM Thermal Cycler). The specific primer sequences were forward: 5′ TTGTACACCGACCTGTTAGG 3′; reverse 5′ TGGAAGTAAGTCCACTGGGAAT 3′. DNA fragments were amplified under PCR conditions with an initial denaturation cycle at 94°C for 3 min; 35 denaturation cycles for 30s at 94°C; annealing for 20s at 60 °C; extension for 30s at 72 °C; and final extension for 1 min at 72 °C.

Evaluation of Therapeutic Outcomes

Outcome or efficacy therapy of SLE was measured using the LLDAS tools which were assessed by clinician to monitor the progress of the patient’s condition according to the therapy administered. LLDAS was developed and validated by the Asia-Pacific Lupus Collaboration and has been widely used in daily practice as the basis for the treat-to-target.Citation37–39 The LLDAS definition suggests a better predictor of patient outcomes including assessment of disease activity and treatment safety.Citation40 LLDAS is attained if all of the following is exhibited by the patient: 1) SLE disease activity index 2000 (SLEDAI-2K) score of ≤4, with no activity in organ systems such as the renal, central nervous, and cardiopulmonary system and absence of vasculitis, fever, hemolytic anemia, or gastrointestinal derangements; 2) there are no new features of lupus disease activity compared to previous assessments; 3) physician assessment of global activity score (0–3) ≤1; 4) current prednisolone equivalent dose ≤ 7.5 mg/day; and 5) standard maintenance doses of approved immunosuppressive drugs and biologics are permitted.Citation41

Statistical Analysis

Descriptive and statistical analyses of data were performed with GraphPad Prism version 9 (GraphPad Software, San Diego, CA). The descriptive data indicate the percentage or as means ± standard deviation of cases. For comparisons of two groups one-tailed Chi-square tests were carried out. The Mann–Whitney U-tests was used to analyze the difference between the IL-6 and IFN-γ value in patients with SLE with and without atherosclerosis. The binary logistic regression test was used to analyze the relationship between the TNFSF13B rs9514828C>T genotypes and the incidence of atherosclerosis and therapeutic outcomes. The level of statistical significance was set ap p < 0.05. The deviation of allele frequencies was analyzed using the Hardy–Weinberg equilibrium (HWE).

Results

Patient Characteristics

A total of 84 participants diagnosed with SLE in the study were female (100%). In terms of age, most of the participants (60 patients) were in the 15–40-year age group (71.4%), while 24 participants (28.6%) were in the 40–65 years age group. SLE affects more women of childbearing age (15–44 years), and the incidence of SLE was greater in women than men. According to chronicity, most patients belonged in the 6–10-year category (47.6%), followed by 0–5 years (23.8%), 11–15 years (17.9%), 16–20 years (7.1%), and 21–25 years (3.6%). The presence of age group and disease duration between SLE patients with atherosclerosis and without atherosclerosis was not associated (p = 0.37 and p = 0.98), see . Atherosclerosis status is indicated by the presence of intima thickening (>0.9 mm).Citation14 In this study, the response variable was included together with the therapeutic outcomes as observed in the LLDAS assessment results. Moreover, all patients were undergoing glucocorticoid therapy (methylprednisolone as a standard therapy for SLE. There were 21 participants (25%) who had an IMT ≥ 0.9 mm, while 63 participants (75%) had an IMT < 0.9 mm. The participants who demonstrated improvement in LLDAS were 46 (54.8%), while those who did not were 38 (45.2%). The presence of LLDAS between SLE patient with atherosclerosis and without atherosclerosis was not associated (p = 0.80), see .

Table 1 Baseline Characteristics of the Patients with Systemic Lupus Erythematosus

In addition to specific factors for atherosclerosis progression in patients with SLE, traditional risk factors also influence its occurrence such as hypertension, hypercholesterolemia, diabetes mellitus, smoking history, and obesity.Citation21 shows data that several participants suffered from SLE accompanied by comorbidities such as hypertension, hyperglycemia, hypercholesterolemia, and obesity. Twenty-five (32.5%) of 77 of total patients had a history of hypertension. Nineteen 23.5%) of 81 of total patients had a history of hyperglycemia. Among 80 of total patients, hypercholesterolemia was documented in 29 patients (36.3%), while in the 78 of total patients, 23 had a history of obesity (29.5%). The presence of hypertension and hyperglycemia between SLE patient with atherosclerosis and without atherosclerosis was associated (p = 0.05 and p = 0.00). The presence of hypercholesterolemia and obesity between SLE patient with atherosclerosis and without atherosclerosis was not associated (p = 0.46 and p = 0.81), see . Several study patients did not have complete clinical data, which was a limitation in this study.

Figure 1 Data of SLE patient with comorbidity.

Figure 1 Data of SLE patient with comorbidity.

The ELISA results for the IFN-γ and IL-6 levels are presented in . The mean of the IFN-γ level in patients with SLE with atherosclerosis was 647.9 ± 440.4 pg/mL and patients with SLE without atherosclerosis was 582.2 ± 308.7 pg/mL. The results revealed absence of a significant relationship (p = 0.73). The IL-6 level in patients with SLE with atherosclerosis was 148 ± 109.3 pg/mL, and patients with SLE without atherosclerosis was 197.19 ± 145.5 pg/mL (p = 0.12) using the Mann–Whitney U-test ().

Table 2 IFN-γ and IL-6 Cytokines in Patient with SLE with Atherosclerosis and SLE Without Atherosclerosis

Figure 2 Frequency distribution of IFN-γ and IL-6 cytokines in SLE patients.

Notes: A: SLE patients without atherosclerosis; B: SLE patients with atherosclerosis.
Figure 2 Frequency distribution of IFN-γ and IL-6 cytokines in SLE patients.

Frequency Distribution of TNFSF13B rs9514828 C>T Polymorphisms on Incidence of Atherosclerosis and Therapeutic Outcomes in Patients with SLE

The genotype distribution and deviation of TNFSF13B rs9514828 in patients with SLE is analyzed using the HWE with p = 0.29 (). The distribution of TNFSF13B rs9514828 C>T polymorphisms on incidence of atherosclerosis and therapeutic outcomes in patients with SLE is presented in . Patients with T alleles (CT and TT) showed a higher incidence of atherosclerosis (85.7%) than those without (49.2%). This finding was verified by statistical analysis showing that the TNFSF13B rs9514828 has a significant correlation with the incidence of comorbid atherosclerosis in patients with SLE (p = 0.01) ().

Table 3 The Genotype Distribution of TNFSF13B rs9514828 in SLE Patient Was Analyzed Using the Hardy-Weinberg Equilibrium Test

Table 4 Comparison of TNFSF13B rs9514828 with Incidence of Atherosclerosis and Therapeutic Outcomes in Patients with SLE

The incidence of the TNFSF13B rs9514828 has a significant correlation with the therapeutic outcomes according to the LLDAS criteria in patients with SLE (p = 0.00) (). The CT and TT genotype showed a greater incidence of LLDAS (80.4%) than in the not-LLDAS (31.6%) group. Moreover, the wildtype (CC) variant was higher (68.4%) in the not-LLDAS group.

The Association Between TNFSF13B rs9514828 C>T Polymorphisms with Incidence of Atherosclerosis and Therapeutic Outcomes in Patients with SLE

This study revealed that the TNFSF13B rs9514828 gene polymorphism was associated with the occurrence of SLE with atherosclerosis using a case-control analysis (). The TNFSF13B rs9514828 C>T has a significant effect on atherosclerotic comorbidities in patients with SLE (p = 0.03). The TNFSF13B rs9514828 gene polymorphism in patients with SLE was indicated by the presence of heterozygous CT and homozygote TT variants compared to wild-type CC as a reference variable. Using the OR, the tendency of the TNFSF13B rs9514828 gene polymorphism to influence the incidence of atherosclerosis in patients with SLE was determined. The results showed that the risk of atherosclerotic events in patients with SLE with the TNFSF13B rs9514828 gene polymorphism (CT and TT genotype) was 4.72-fold higher than the wild-type group (CC genotype) ().

Table 5 The Association of TNFSF13B rs9514828 with Incidence of Atherosclerosis and Therapeutic Outcomes in Patients with SLE

Furthermore, we examined the association between the TNFSF13B rs9514828 C>T has a significant effect on therapeutic outcomes (LLDAS) in patients with SLE (p = 0.00). Disease improvement, demonstrated by the LLDAS score, was smaller in patients with the TNFSF13B rs9514828 gene polymorphism (CT and TT genotypes). Additionally, patients with SLE with polymorphisms have a 7.58-fold risk no improvement after therapy than those without the TNFSF13B rs9514828 gene polymorphism (reference group) (CC genotype) (). The TNFSF13B rs9514828 gene polymorphism in patients with SLE was demonstrated by the presence of a heterozygous CT genotype variant and a homozygous TT genotype variant compared to the liar type CC as a reference variable.

Discussion

This study comprised entirely of female patients. As previously established, females have a higher prevalence of SLE than males. In line with previous studies indicating a significantly higher incidence of SLE in females compared to males, with prevalence ratios ranging from 7 to 9 to 1 for SLE.Citation42 The increased incidence of SLE in women is attributed to hormones that are important in disease manifestations.Citation43,Citation44 Also, the disparities in the clinical manifestations of SLE between males and females are not significantly fundamental.Citation45 This study predominantly involved individuals within the reproductive or childbearing age (15–40 years old; 60% of the sample); linear studies elucidated that SLE occurred predominantly between the ages 25 and 39 years.Citation46 This is attributed to the recognized influence of sex hormones on the immune system function. Sex hormones have been acknowledged for their potential role as triggers or protectors of SLE development.Citation47 The acceleration of atherosclerosis in patients with SLE is caused by specific risk factors such as activity and illness duration and use of glucocorticoids.Citation26,Citation29 The utilization of immunosuppressive and systemic steroid agents may potentially influence the comorbidities in patients with SLE.Citation48–50 Incidence of cardiovascular was significantly higher in patient with SLE. This study identified atherosclerosis as the primary comorbidity, followed by hypertension, hypercholesterolemia, obesity, and hyperglycemia. Hypertension and hyperglycemia show significant differences in plaque development in SLE patients. The incidence of obesity is associated with an increase IMT. Thus, when SLE is not effectively managed, it may lead to comorbid conditions such as cardiovascular disease, a sequela of atherosclerosis. This is related to traditional cardiovascular risks. SLE patients who receive steroid therapy have the potential to be 4 times more likely to develop diabetes mellitus and hypertension. Use of a 7.5 mg dose of prednisone was associated with a 2.5-fold increase in cardiovascular risk. The effects of cardiovascular drugs depend on disease activity and traditional risk factors in SLE patients.Citation25

Cytokine markers, such as IFN-γ and IL-6, are known to play a crucial role in accelerating atherosclerosis in patients with SLE. IFN-γ is a pro-inflammatory cytokine that may stimulate foam cell formation, a specific immune response from T helper 1 (Th1) cells, and atherosclerotic plaque development.Citation25,Citation51 IFN-γ secreted by macrophages may induce gene expression. In atherosclerotic lesions, Th1 cells, macrophages, and APC express IFN-γ. In normal cells, during sterol homeostasis, balance in cholesterol absorption exists; however, if an imbalance occurs due to pathology, thereby increasing IFN-γ, it may affect the formation of foam cells and cause a decline in cholesterol absorption and an increase in oxidized LDL (OxLDL) absorption.Citation52 IL-6 involvement in the production of inflammatory cytokines and lipid homeostasis is associated with cardiovascular disease mortality.Citation25,Citation53,Citation54 Serum IFN-γ levels in patients with SLE have not been reported; however, IFN-γ overexpression may play a role in the immunopathogenesis of SLE via the induction of sBLyS/BAFF by monocytes and macrophages causing B-cell activation and maturation.Citation55–58 In this study, a statistically significant association was not found between IFN-γ and IL-6 levels and atherosclerosis incidence in patients with SLE. However, in this study, it can be observed from the data obtained that IFN-γ levels were slightly higher in those with comorbid atherosclerosis compared to those without (647.9 ± 440.4 pg/mL vs 582.2 ± 308.7 pg/mL and 148 ± 109.3 pg/mL vs 197.19 ± 145.5 pg/mL, respectively). The values obtained are in concordance with those found in previous study showed that IL-6 levels approximately ranged from 4.272 ± 0.4222 to 123.71 ± 81.783 pg/mL in patients with SLE and 0.93 ± 0.95 to 10.46 ± 4.33 pg/mL in healthy controls.Citation59 The IL-6 levels were found to be high in patients in this study. As previously elucidated, both IL-6 and IFN-γ are associated with atherosclerosis in SLE. However, atherosclerosis itself is a complex and multifactorial condition with numerous contributory pathways and factors. While the immune response and inflammation play a critical role, other important aspects of atherosclerosis pathogenesis include endothelial dysfunction caused by factors such as high blood pressure, smoking, and high LDL cholesterol levels.Citation60 The dysregulation of lipid metabolism, hemodynamic factors, and elevated levels of homocysteine (an amino acid) are also associated with an increased atherosclerosis risk. Numerous markers are directly associated with atherosclerosis pathogenesis, such as hs-CRP, lipid levels, and homocysteine levels, whereas IL-6 and IFN-γ are indirectly associated with atherosclerosis.Citation61 Additionally, the genetic marker could also predispose an individual to the risk of atherosclerosis especially genes that are related to the immune response such as TNFSF13B.Citation62,Citation63 The TNFSF13B gene encodes the BAFF protein, which plays a critical role in B-cell modulation. The increase in serum BAFF levels is higher in individuals at risk of atherosclerosis compared to those who are not at risk.Citation64 This increase is associated with BAFF protein upregulation encoded by the TNFSF13B gene on SLE with atherosclerosis as a comorbidity.Citation63

This study showed that variations in the TNFSF13B rs9514828 genotype were found in the SLE patient population at Hasan Sadikin Hospital Bandung, Indonesia. The genotype distribution of patients with SLE was analyzed using the HWE test which states that the genetic variation in a population will remain constant from one generation to the next (p = 0.29). However, genetic variation changes will occur when there are disturbing factors such as mutations, environmental changes, random mating, and migration.Citation50,Citation65 This study found that TNFSF13B rs9514828 gene polymorphisms were present in both patients with SLE with and without comorbid atherosclerosis. The frequency of the TNFSF13B rs9514828C>T polymorphism was noted to be higher in patients with SLE with atherosclerosis (66.67%) compared to those without atherosclerosis (42.86%). Although the number of patients who experienced atherosclerotic events was smaller, a significant correlation (p = 0.01) was identified, indicating that the TNFSF13B rs9514828C>T polymorphism may potentially contribute to the development of atherosclerosis in patients with SLE (OR = 4.72). However, it is noteworthy that the number of participants was higher in the group of patients with SLE without comorbid atherosclerosis. This difference in group sizes may be related to the therapies administered to patients, particularly the use of corticosteroid-class drugs, which are commonly used as the primary treatment in patients with SLE.Citation64 The prevalence of atherosclerotic plaques is reported to be approximately twofold higher in patients with SLE compared to the general population. Owing to their pro-atherogenic properties, corticosteroids are known to contribute to early atherosclerosis, which have adverse effects on metabolic factors such as body fat distribution, blood pressure, and glucose metabolism. This clinical condition has been shown to result in an increase in LDL cholesterol and triglyceride levels while decreasing HDL cholesterol.Citation66 In this study, the entire population received methylprednisolone as a therapy to reduce inflammation. The long-term use of methylprednisolone has associated side effects, including cardiovascular issues such as an increased risk of atherosclerosis.Citation64,Citation66

The standard therapy is administered in severe cases or during relapses. The prescribed dosage is ≤7.5 mg/day of prednisone. Pulse glucocorticoid therapy involves an intravenous administration of 0.5–1 gram of methylprednisolone for three days. If the patient’s condition flares, the prednisolone dose is increased according to guideline therapy. Additionally, the use of sparing agents aids in facilitating the adjustment of corticosteroid doses and mitigates their side effects. In this study, patients utilized sparing agents (immunosuppressive) such as azathioprine, mycophenolate mofetil (MMF), cyclophosphamide, and methotrexate. It is noteworthy that participants in this research had not been exposed to biologic agents as part of their therapy. We did not analyze the effect of other immunosuppressive agents as the confounding factors of outcome therapy (LLDAS). Some studies showed that steroids, MMF, azathioprine, cyclophosphamide, and hydroxychloroquine have no effect on atherosclerosis progression in animal model or SLE patientsCitation67–70 although in a small study showed that MMF effect on plaque progression still need to be explored.Citation26,Citation71 This also one of limitation in our study, although previous studies showed that immunosuppressive agents do not affect the progression of atherosclerosis in SLE patients.

In this study, the therapeutic outcomes in patients with SLE are categorized into two groups: the LLDAS group and the non-LLDAS group. LLDAS is used as a target goal in the treatment of patients with SLE. The therapeutic response of each individual is different depending on disease severity with organ involvement. Several studies have demonstrated that the achievement of LLDAS is associated with reduced flares and organ damage so it can be a target in treatment strategies.Citation38,Citation40,Citation72 In this study, the frequency and distribution analysis revealed a significant correlation (p = 0.00) between the genotype and the LLDAS. The CT and TT genotype demonstrated a greater incidence of LLDAS (80.43%) than in the non-LLDAS (31.58%) group. Moreover, the wildtype (CC) variant was higher (68.42%) in the non-LLDAS group. The OR (7.581), calculated based on the genotype for LLDAS, indicates that disease improvement, as indicated by a tendency toward achieving LLDAS, was less noticeable in patients with the TNFSF13B rs9514828 gene polymorphism (CT and TT genotypes). As previously noted in a Mexican study, the rs9514828 C>T polymorphism appears to elevate TNFSF13B gene expression. An elevated BAFF expression is linked to active disease, particularly renal and hematological involvement in patients with SLE.Citation19 Another study showcased consistent results, showing that this specific SNP is associated with increased gene expression in autoimmune patients.Citation73 Findings from both studies suggested that TNFSF13B is indirectly linked to disease activity through BAFF expression. In a separate pharmacogenetics study, a combined analysis of various SNPs, including IFN regulatory factor 5, and TNFSF13B, displayed a strong, direct association with favorable response to rituximab in SLE therapy.Citation16

This study suggests the potential necessity for considering multiple genetic markers in predicting clinical outcomes. However, the conflicting results found in this study and previous research might be explained by the factors that influence the LLDAS score. LLDAS is a combination of both low SLE disease activity and the use of a low prednisone dose (≤7.5 mg daily). In the multivariable model, factors such as an African–American ethnicity, the presence of anti-RNP and anti-dsDNA antibodies, low complement levels, history of serositis, history of vasculitis, decreased renal activity, arthritis, malar rash, discoid rash, thrombocytopenia, and duration of immunosuppressant drug use remained as negative LLDAS.Citation74,Citation75 Other studies elucidated that certain marker related to nephritis (nephritis-associated markers, including urinary protein and serum creatinine) and lower C3 levels (complement component 3) at the beginning of the study had a negative impact on achieving LLDAS.Citation76 This implies that higher levels of urinary protein and serum creatinine and lower C3 levels were associated with a reduced likelihood of achieving LLDAS. Thus, despite the LLDAS score being influenced by various factors other than BAFF levels, this study shows that the TNFSF13B rs9514828 C>T polymorphism is correlated with atherosclerosis risk. Therefore, we suggest that when combined with effective therapy, it will be significantly associated with improved disease activity in SLE.

Conclusion

TNFSF13B rs9514828 C>T polymorphism has a significant association with incidence atherosclerosis and therapeutic outcomes in patients with SLE (p < 0.05). Health workers need to underscore the TNFSF13B rs9514828 gene to undertake preventive measures in order to prevent atherosclerosis and poor prognosis in patients with SLE.

Disclosure

The authors report no competing interest exists in this work.

Acknowledgments

The researcher expresses gratitude to the members of SLE study group at Universitas Padjadjaran, Bandung, the laboratory assistants at the Molecular Genetics Laboratory Eyckman, Bandung and the laboratory assistants of Cell and Molecular Biology Laboratory, Faculty of Pharmacy, Universitas Padjadjaran, Jatinangor, Bandung. Thanks to dr. Syarif Hidayat, SpPD-SpJP (Department of Cardiology, Hasan Sadikin Hospital), in Doppler ultrasound examination. Furthermore, thanks also to all patients involved in this study.

Additional information

Funding

This research was supported by Ministry of Research, Technology, and Higher Education of Republic of Indonesia under The Basic Research scheme grant for MIB and Ministry of Education, Culture, Research and Technology of Republic of Indonesia in the form Doctoral Program Scholarship (BPPDN) for DRF.

References

  • Kuhn A, Bonsmann G, Anders HJ, Herzer P, Tenbrock K, Schneider M. The diagnosis and treatment of systemic lupus erythematosus. Dtsch Arztebl Int. 2015;112(25):423–432. doi:10.3238/arztebl.2015.0423
  • Thong B, Olsen NJ. Systemic lupus erythematosus diagnosis and management. Rheumatol. 2017;56:i3–i13. doi:10.1093/rheumatology/kew401
  • Shin J, Lee KH, Park S, et al. Systemic lupus erythematosus and lung involvement: a comprehensive review. J Clin Med. 2022;11(22):1–23. doi:10.3390/jcm11226714
  • Tsuchida T. Systemic Lupus Erythematosus. Brain Nerve. 2019;71(4):317–321. doi:10.11477/mf.1416201268
  • Li S, Gong T, Peng Y. Prevalence and incidence of systemic lupus erythematosus and associated outcomes in the 2009 – 2016 US Medicare population. Lupus. 2019;1–12. doi:10.1177/0961203319888691
  • Barber MRW, Drenkard C, Falasinnu T, et al. Global epidemiology of systemic lupus erythematosus. Nat Rev Rheumatol. 2021;17(9):515–532. doi:10.1038/s41584-021-00668-1
  • Lee WS, Amengual O. B cells targeting therapy in the management of systemic lupus erythematosus. Immunol Med. 2020;43(1):16–35. doi:10.1080/25785826.2019.1698929
  • Hamijoyo L, Candrianita S, Rahmadi AR, et al. The clinical characteristics of systemic lupus erythematosus patients in Indonesia: a cohort registry from an Indonesia-based tertiary referral hospital. Lupus. 2019;28(13):1604–1609. doi:10.1177/0961203319878499
  • Abdullah K, Afrizal A, Diah M, Gani A. The association of platelet-lymphocyte ratio and carotid intima-media thickness in systemic lupus erythematosus patients. Int J Res Publ. 2022;102(1):136–141. doi:10.47119/ijrp1001021620223246
  • Pan L, Lu MP, Wang JH, Xu M, Yang SR. Immunological pathogenesis and treatment of systemic lupus erythematosus. World J Pediatr. 2020;16(1):19–30. doi:10.1007/s12519-019-00229-3
  • Ameer MA, Chaudhry H, Mushtaq J, et al. An Overview of Systemic Lupus Erythematosus (SLE) Pathogenesis, Classification, and Management. Cureus. 2022;14(10). doi:10.7759/cureus.30330
  • Sutanto H, Yuliasih Y. Disentangling the Pathogenesis of Systemic Lupus Erythematosus: close Ties between Immunological, Genetic and Environmental Factors. Medicine. 2023;59(6):1033. doi:10.3390/medicina59061033
  • Maidhof W, Hilas O. Lupus: an overview of the disease and management options. Pharm Ther. 2012;37(4):240–249.
  • Theodorou E, Nezos A, Antypa E, et al. B-cell activating factor and related genetic variants in lupus related atherosclerosis. J Autoimmun. 2018;92:87–92. doi:10.1016/j.jaut.2018.05.002
  • Robinson GA, Wilkinson MGL, Wincup C. The Role of Immunometabolism in the Pathogenesis of Systemic Lupus Erythematosus. Front Immunol. 2022;12:1–9. doi:10.3389/fimmu.2021.806560
  • Santillán-López E, Muñoz-Valle JF, Oregon-Romero E, et al. Analysis of TNFSF13B polymorphisms and BAFF expression in rheumatoid arthritis and primary Sjögren’s syndrome patients. Mol Genet Genomic Med. 2022;10(6):1–16. doi:10.1002/mgg3.1950
  • Ortiz-Aljaro P, Montes-Cano MA, García-Lozano JR, et al. Protein and functional isoform levels and genetic variants of the BAFF and April pathway components in systemic lupus erythematosus. Sci Rep. 2022;12(1):1–10. doi:10.1038/s41598-022-15549-0
  • González-serna D, Ortiz-fernández L, Vargas S, et al. Association of a rare variant of the TNFSF13B gene with susceptibility to Rheumatoid Arthritis and Systemic Lupus Erythematosus. Sci Rep. 2018:1–5. doi:10.1038/s41598-018-26573-4
  • Marín-Rosales M, Cruz A, Salazar-Camarena DC, et al. High BAFF expression associated with active disease in systemic lupus erythematosus and relationship with rs9514828C>T polymorphism in TNFSF13B gene. Clin Exp Med. 2019;19(2):183–190. doi:10.1007/s10238-019-00549-8
  • Vincent FB, Morand EF, Schneider P, MacKay F. The BAFF/April system in SLE pathogenesis. Nat Rev Rheumatol. 2014;10(6):365–373. doi:10.1038/nrrheum.2014.33
  • Croca S, Rahman A. Atherosclerosis in systemic lupus erythematosus. Best Pract Res Clin Rheumatol. 2017;31(3):364–372. doi:10.1016/j.berh.2017.09.012
  • Khairy N, Ezzat Y, Naeem N, Taha R, Wesam R. Atherosclerosis biomarkers in female systemic lupus erythematosus patients with and without cardiovascular diseases. Egypt Rheumatol. 2017;39(1):7–12. doi:10.1016/j.ejr.2016.03.003
  • Koulouri V, Koutsilieris M, Mavragani CP. B cells and atherosclerosis in systemic lupus erythematosus. Expert Rev Clin Immunol. 2019;15(4):417–429. doi:10.1080/1744666X.2019.1571411
  • Reiss AB, Jacob B, Ahmed S, Carsons SE, DeLeon J. Understanding accelerated atherosclerosis in systemic lupus erythematosus: toward better treatment and prevention. Inflammation. 2021;44(5):1663–1682. doi:10.1007/s10753-021-01455-6
  • Stojan G, Petri M. Atherosclerosis in systemic lupus erythematosus. J Cardiovasc Pharmacol. 2013;62(3):255–262. doi:10.1097/FJC.0b013e31829dd857
  • Wilhelm AJ, Major AS. Accelerated atherosclerosis in SLE: mechanisms and prevention approaches. Int J Clin Rheumatol. 2014;7(5):527–539. doi:10.2217/ijr.12.46
  • Sacre K, Escoubet B, Zennaro MC, Chauveheid MP, Gayat E, Papo T. Overweight is a major contributor to atherosclerosis in systemic lupus erythematosus patients at apparent low risk for cardiovascular disease. Medicine. 2015;94(48):1–6. doi:10.1097/MD.0000000000002177
  • Mak A, Kow NY, Schwarz H, Gong L, Tay SH, Ling LH. Endothelial dysfunction in systemic lupus erythematosus - A case-control study and an updated meta-analysis and meta-regression. Sci Rep. 2017;7(1):1–10. doi:10.1038/s41598-017-07574-1
  • Lertratanakul A, Sun J, Wu PW, et al. Risk factors for changes in carotid intima media thickness and plaque over 5 years in women with systemic lupus erythematosus. Lupus Sci Med. 2021;8(1):1–10. doi:10.1136/lupus-2021-000548
  • Gummadi AC, Guddati AK. Genetic Polymorphisms in Pharmaceuticals and Chemotherapy. World J Oncol. 2021;12(5):149–154. doi:10.14740/wjon1405
  • Barliana MI, Afifah NN, Amalia R, Hamijoyo L, Abdulah R. Genetic polymorphisms and the clinical response to systemic lupus erythematosus treatment towards personalized medicine. Front Pharmacol. 2022;13:1–14. doi:10.3389/fphar.2022.820927
  • Porta S, Danza A, Saavedra MA, et al. Glucocorticoids in systemic lupus erythematosus. Ten questions and some issues. J Clin Med. 2020;9(9):1–13. doi:10.3390/jcm9092709
  • Bae SC, Gordon C, Urowitz MB, Gladman D, Iban D. Atherosclerotic vascular events in a multinational inception cohort of systemic lupus erythematosus. Arthri Care Res. 2010;62(6):881–887. doi:10.1002/acr.20122
  • Mok CC, Tse SM, Chan KL, Ho LY. Effect of immunosuppressive therapies on survival of systemic lupus erythematosus: a propensity score analysis of a longitudinal cohort. Lupus. 2017;2:1–6.
  • Indonesian Rheumatology Association. Recommendations from the Indonesian Rheumatology Association: Diagnosis and Treatment of Systemic Lupus Erythematosus. Indonesian Rheumatology Association; 2019.
  • Dahlström Sjöwall C. The diagnostic accuracies of the 2012 SLICC criteria and the proposed EULAR/ACR criteria for systemic lupus erythematosus classification are comparable. Lupus. 2019;28(6):778–782. doi:10.1177/0961203319846388
  • Golder V, Kandane-Rathnayake R, Huq M, et al. Lupus low disease activity state as a treatment endpoint for systemic lupus erythematosus: a prospective validation study. Lancet Rheumatol. 2019;1(2):e95–e102. doi:10.1016/S2665-9913(19)30037-2
  • Golder V, Kandane-Rathnayake R, Hoi AYB, et al. Frequency and predictors of the lupus low disease activity state in a multi-national and multi-ethnic cohort. Arthritis Res Ther. 2016;18(1):1–10. doi:10.1186/s13075-016-1163-2
  • Parodis I, Nikpour M. How to use the Lupus Low Disease Activity State (LLDAS) in clinical trials. Ann Rheum Dis. 2021;80(7):5–6. doi:10.1136/annrheumdis-2019-215650
  • Franklyn K, Lau CS, Navarra SV, et al. Definition and initial validation of a Lupus Low Disease Activity State (LLDAS). Ann Rheum Dis. 2016;75(9):1615–1621. doi:10.1136/annrheumdis-2015-207726
  • Oon S, Huq M, Golder V, Ong PX, Morand EF, Nikpour M. Lupus Low Disease Activity State (LLDAS) discriminates responders in the BLISS-52 and BLISS-76 Phase III trials of belimumab in systemic lupus erythematosus. Ann Rheum Dis. 2019;78(5):629–633. doi:10.1136/annrheumdis-2018-214427
  • Harigai M, Kawamoto M, Hara M, Kubota T, Kamatani N, Miyasaka N. Excessive Production of IFN-γ in Patients with Systemic Lupus Erythematosus and Its Contribution to Induction of B Lymphocyte Stimulator/B Cell-Activating Factor/TNF Ligand Superfamily-13B. J Immunol. 2008;181(3):2211–2219. doi:10.4049/jimmunol.181.3.2211
  • Fava A, Petri M. Systemic lupus erythematosus: diagnosis and clinical management. J Autoimmun. 2019;96:1–13. doi:10.1016/j.jaut.2018.11.001
  • Kim JW, Kim HA, Suh CH, Jung JY. Sex hormones affect the pathogenesis and clinical characteristics of systemic lupus erythematosus. Front Med. 2022;9:1–15. doi:10.3389/fmed.2022.906475
  • Hoffman RW, Merrill JT, Alarcón-Riquelme MME, et al. Gene expression and pharmacodynamic changes in 1760 systemic lupus erythematosus patients from two phase III trials of BAFF blockade with tabalumab. Arthritis Rheumatol. 2017;69(3):643–654. doi:10.1002/art.39950
  • Ding J, Su S, You T, et al. Serum interleukin-6 level is correlated with the disease activity of systemic lupus erythematosus: a meta-analysis. Clinics. 2020;75:1–10. doi:10.6061/clinics/2020/e1801
  • Smulski CR, Eibel H. BAFF and BAFF-receptor in B cell selection and survival. Front Immunol. 2018;9:1–10. doi:10.3389/fimmu.2018.02285
  • González-Serna D, Carmona EG, Ortego-Centeno N, et al. A TNFSF13B functional variant is not involved in systemic sclerosis and giant cell arteritis susceptibility. PLoS One. 2018;13(12):1–9. doi:10.1371/journal.pone.0209343
  • Friebus-Kardash J, Trendelenburg M, Eisenberger U, et al. Susceptibility of BAFF-var allele carriers to severe SLE with occurrence of lupus nephritis. BMC Nephrol. 2019;20(1):1–10. doi:10.1186/s12882-019-1623-4
  • Indriani F, Oktarianti R, Wathon S. Genetic Study of Phenylthiocarbamide (PTC) taste sensitivity in population of the osing in kemiren village-banyuwangi. Berk SAINSTEK. 2021;9(1):1. doi:10.19184/bst.v9i1.19844
  • Herrero-Fernandez B, Gomez-Bris R, Somovilla-Crespo B, Gonzalez-Granado JM. Immunobiology of atherosclerosis: a complex net of interactions. Int J Mol Sci. 2019;20(21). doi:10.3390/ijms20215293
  • Varma MA, Mundkur L, Kakkar VV. Autoimmune Diseases and Atherosclerosis: the Inflammatory Connection. Curr Immunol Rev. 2013;8(4):297–306. doi:10.2174/157339512804806206
  • Moss JW. Interferon-γ: promising therapeutic target in atherosclerosis. World J Exp Med. 2015;5(3):154. doi:10.5493/wjem.v5.i3.154
  • Crayne CB, Albeituni S, Nichols KE, Cron RQ. The immunology of macrophage activation syndrome. Front Immunol. 2019;10:1–11. doi:10.3389/fimmu.2019.00119
  • Nezos A, Evangelopoulos ME, Mavragani CP. Genetic contributors and soluble mediators in prediction of autoimmune comorbidity. J Autoimmun. 2019;104:102317. doi:10.1016/j.jaut.2019.102317
  • Liu J, Liao MQ, Cao DF, et al. The association between interleukin-6 gene polymorphisms and risk of systemic lupus erythematosus: a meta-analysis with trial sequential analysis. Immunol Invest. 2021;50(2–3):259–272. doi:10.1080/08820139.2020.1769646
  • Mejía-Vilet JM, Ayoub I. The use of glucocorticoids in lupus nephritis: new pathways for an old drug. Front Med. 2021;8:1–11. doi:10.3389/fmed.2021.622225
  • Sestan M, Kifer N, Arsov T, et al. The role of genetic risk factors in pathogenesis of childhood-onset systemic lupus erythematosus. Curr Issues Mol Biol. 2023;45(7):5981–6002. doi:10.3390/cimb45070378
  • Fanouriakis A, Tziolos N, Bertsias G, Boumpas DT. Update in the diagnosis and management of systemic lupus erythematosus. Ann Rheum Dis. 2021;80(1):14–25. doi:10.1136/annrheumdis-2020-218272
  • Tanaka Y. State-of-the-art treatment of systemic lupus erythematosus. Int J Rheum Dis. 2020;23(4):465–471. doi:10.1111/1756-185X.13817
  • Amissah Arthur MB, Gordon C. Contemporary treatment of systemic lupus erythematosus: an update for clinicians. Ther Adv Chronic Dis. 2010;1(4):163–175. doi:10.1177/2040622310380100
  • Kelley C, Vander Molen J, Choi J, et al. Impact of glucocorticoids on cardiovascular system—the yin yang effect. J Pers Med. 2022;12(11). doi:10.3390/jpm12111829
  • Babaoglu H, Li J, Goldman D, Magder LS, Petri M. Predictors of predominant lupus low disease activity state (LLDAS-50). Lupus. 2017;176(12):139–148. doi:10.1177/0961203319886028.Predictors
  • Macleod C, Hadoke PWF, Nixon M. Glucocorticoids: fuelling the fire of atherosclerosis or therapeutic extinguishers? Int J Mol Sci. 2021;22(14). doi:10.3390/ijms22147622
  • Moaaz M, Mohannad N. Association of the polymorphisms of TRAF1 (rs10818488) and TNFAIP3 (rs2230926) with rheumatoid arthritis and systemic lupus erythematosus and their relationship to disease activity among Egyptian patients. Cent Eur J Immunol. 2016;41(2):165–175. doi:10.5114/ceji.2016.60991
  • McMahon M, Seto R, Skaggs BJ. Cardiovascular disease in systemic lupus erythematosus. Rheumatol Immunol Res. 2021;2(3):157–172. doi:10.2478/rir-2021-0022
  • Shimizu H, Takahashi M, Takeda SI, et al. Mycophenolate mofetil prevents transplant arteriosclerosis by direct inhibition of vascular smooth muscle cell proliferation. Transplantation. 2004;77(11):1661–1667. doi:10.1097/01.TP.0000127592.13707.B6
  • Eisen HJ, Kobashigawa J, Keogh A, et al. Three-year results of a randomized, double-blind, controlled trial of mycophenolate mofetil versus azathioprine in cardiac transplant recipients. J Heart Lung Transplant. 2005;24(5):517–525. doi:10.1016/j.healun.2005.02.002
  • Sazliyana S, Mohd Shahrir MS, Kong CN, Tan HJ, Hamidon BB, Azmi MT. Implications of immunosuppressive agents in cardiovascular risks and carotid intima media thickness among lupus nephritis patients. Lupus. 2011;20(12):1260–1266. doi:10.1177/0961203311411347
  • Sato-Okabayashi Y, Isoda K, Heissig B, et al. Low-dose oral cyclophosphamide therapy reduces atherosclerosis progression by decreasing inflammatory cells in a murine model of atherosclerosis. IJC Hear Vasc. 2020;28:1–10. doi:10.1016/j.ijcha.2020.100529
  • Kiani AN, Magder LS, Petri M. Mycophenolate mofetil (MMF) does not slow the progression of subclinical atherosclerosis in SLE over 2 years. Rheumatol Int. 2012;23(1):1–7. doi:10.1007/s00296-011-2048-y
  • Wahadat MJ, Van Den Berg L, Timmermans D, et al. LLDAS is an attainable treat-to-target goal in childhood-onset SLE. Lupus Sci Med. 2021;8(1):1–5. doi:10.1136/lupus-2021-000571
  • Waldron D. RNA: differential regulation of APA isoforms. Nat Rev Genet. 2016;17(2):66. doi:10.1038/nrg.2015.33
  • Piga M, Arnaud L. The main challenges in systemic lupus erythematosus: where do we stand? J Clin Med. 2021;10(2):1–12. doi:10.3390/jcm10020243
  • Ji L, Xie W, Fasano S, Zhang Z. Risk factors of flare in patients with systemic lupus erythematosus after glucocorticoids withdrawal. A systematic review and meta-analysis. Lupus Sci Med. 2022;9(1):1–8. doi:10.1136/lupus-2021-000603
  • Hao Y, Oon S, Ji L, et al. Determinants and protective associations of the lupus low disease activity state in a prospective Chinese cohort. Clin Rheumatol. 2022;41(2):357–366. doi:10.1007/s10067-021-05940-z