Inhibition effect of small interfering RNA of connective tissue growth factor on the expression of extracellular matrix molecules in cultured human renal proximal tubular cells

Abstract

Objective: In this study, we investigated the effect of small interfering RNA (siRNA) of connective tissue growth factor (CTGF) by pRetro-Super (PRS) retrovirus vector on the expression of CTGF and related extracellular matrix molecules in human renal proximal tubular cells (HKCs) induced by high glucose, to provide help for renal tubulointerstitial fibrosis therapy. Methods: HKCs were exposed to d-glucose to observe their dose and time effect, while the mannitol as osmotic control. Retrovirus producing CTGF siRNA were constructed from the inverted oligonucleotides and transferred into packaging cell line PT67 with lipofectamine, and the virus supernatant was used to infect HKC. The expression of CTGF, fibronectin (FN) and collagen-type I (col1) were measured by semi-quantitative RT-PCR and Western blot. Results: In response to high glucose, CTGF expression in HKCs was increased in a dose- and time-dependent manner, whereas the increase did not occur in the osmotic control. Introduction of PRS-CTGF-siRNA resulted in the significant reduction of CTGF, FN, col1 mRNA (p < 0.01, respectively) and CTGF, col1 protein (p < 0.05, respectively) expression, while PRS void vector group did not have these effects (p > 0.05). Conclusions: CTGF siRNA therapy can effectively reduce the levels of CTGF, FN and col1 induced by high glucose in cultured HKCs, which suggested that it may be a potential therapeutic strategy to prevent the renal interstitial fibrosis in the future.

• Collagen type-I
• connective tissue growth factor
• fibronectin
• renal tubulointerstitial fibrosis
• small interfering RNA

Introduction

Tubulointerstitial fibrosis plays key role in the process of progressive renal injury and is a common feature of chronic kidney disease (CKD).1 It is of great significance to inhibit tubulointerstitial fibrosis in CKD therapy. The excessive deposition of extracellular matrix (ECM) is predominant pathological changes in renal tubulointerstitial fibrosis. It is widely considered that transforming growth factor β1 (TGF-β1) can promote the excessive accumulation of ECM, and is an important initiate factor that contributing to renal interstitial fibrosis. Connective tissue growth factor (CTGF) is thought to be determinant of progressive fibrosis and a downstream mediator of TGF-β1 signaling in the fibrosis process.2–5 Because of its diverse biological activities6 such as immunosuppression, proliferation and suppression for malignant neoplasms,7 long-term inhibition of TGF-β1 might induce unexpected side effects. With more restricted biologic actions, CTGF may be a more attractive target for antifibrotic therapy in renal disease.8,9 The RNA interfering (RNAi) technique has become a powerful and widely used tool in the analysis of gene function and gene therapy. A great of studies showed that RNAi therapy can effectively inhibit fibrosis of kinds of disease,10–12 but there are rare studies of RNAi therapy in human renal proximal tubular cells (HKCs) as our best to know. In our research, we constructed a retrovirus expressing CTGF-small interfering RNA (siRNA) mediated by PRS retrovirus vector and investigated the effect of these vectors on the expression of CTGF, fibronectin (FN) and collagen type-I (col1) in cultured HKCs, to provide help for renal tubulointerstitial fibrosis therapy.

Methods

Cell culture

PT67 packaging cell lines (gifted from the Shanghai Ninth People’s Hospital, China) and NIH 3T3 cell lines (gifted from the National Key Laboratory of Genetics, China) were maintained in DMEM (Gibco, Billings, MT) supplemented with 10% heat inactivated fetal bovine serum (Gibco, Billings, MT) and antibiotics (100 U/mL penicillin G and 100 μg/mL streptomycin). HKCs (gifted from the Shanghai First People’s Hospital, China) were maintained in DMEM medium supplemented with 10% fetal bovine.

Construction of PRS-CTGF-siRNA retrovirus vector

Target sequence was selected according to the encoding sequence of the human CTGF gene: AAGAGAACATTAAGAAGGGCA (located in codons 740–761). Sequence begin with AA, located 100 bp posterior to ATG and 100 bp anterior to TGA, with a length of 21 bp and a GC content of 30–50%, without four or more Ts. A BLAST analysis was performed to ensure that no homology existed with other genes. We designed a pair of oligonucleotides including 64 bp DNA according to target sequence and PRS retrovirus. The pair of oligonucleotides formed double strands with the HindIII site at the 5′ end and the BglII site at the 3′ end. The oligonucleotides were as the following: Forward: GATCCCCGAGAACATTAAG AAGGGCATTCAAGAGATGCCCTTCTTAATGTTCTC TTTTTGGAAA and Reverse: AGCTTTTCCAAAAAGAGAA CATTAAGAAGGGCA

TCTCTTGAATGCCCTTCTTAATGTTCTCGGG. The primer sequences were 5′-GGAAGCCTTGGCTTTTG-3′ (forward) and 5′-CGAACGCTGACGTCATC-3′ (reverse). After sequencing analysis to confirm no plasmids mutations, we extracted a large number of plasmids with Tip100 (Qiagen, Germantown, MD) for cell transfection experiments.

Transfection of the siRNA into PT67 packaging cells

PT67 cells were seeded into a six-well plate at 60–80% confluence (1 × 10⁶ cells/well) 12–24 h before transfection, 4 μg DNA and 10 μL lipofectamine 2000 were used for transfection. Retropack PT67 cells were diluted at a ratio of 1:20 and plated at 24 h post-transfection. The transfected PT67 cells were cultured for 10 days with 2 μg/mL puromycin (Clontech, Mountain View, CA), and the large, healthy colonies were then isolated and transferred into individual wells and plates. The viral titre was determined by NIH3T3 cells and the medium containing high virus titre was used to infection target cells.

Retroviral transduction

Filtered medium containing viral particles of PRS-CTGF-siRNA or PRS (20 μl) was added to HKCs in 2.5 µg/mL puromycin DMEM for infection. The infected HKCs were diluted at a ratio of 1:10 24 h later, then puromycin was added to a final concentration of 0.5 μg/mL (according to the kill curves to determine the concentration of puromycin). Two weeks later, the large, healthy colonies were isolated and transferred into individual wells and plates.

Experimental design and grouping

To study the effect of different glucose concentrations, the HKCs were cultured in a medium containing 5.5, 30, 60 mm d-glucose and 60 mm d-mannitol for 48 h. To study the effect of time, HKCs were exposed to high glucose levels (30 mm) for 0, 6, 24, 48, and 72 h. To study the effect of PRS-CTGF-siRNA on HKCs induced by high glucose, the experiment was divided into five groups: controls (1), high glucose group (2), high glucose + siRNA group (3), high glucose + PRS group (4) and osmotic mannitol group (5).

RT-PCR

Total RNA was extracted from freshly isolated or cultured cells using Trizol reagent (Invitrogen, Carlsbad, CA), and was reverse-transcribed into cDNAs with SuperScriptTM II Reverse Transcriptase (Invitrogen). PCR amplification was performed using the primers as following: β-actin, 5′-CCTCGCCTTTGCCGATCC-3′ (forward) and 5′-GGATCTTCATGAGGTAGTCAGTC-3′ (reverse, 626 bp); CTGF, 5′-CATCTTCGGTGGTACGGTGT-3′ (forward) and 5′-AGGAGGCGTTGTCATTGGTA-3′ (reverse, 374 bp); Col1, 5′-AGG CTGGTGTGATGGGATT-3′ (forward) and 5′-GGAGAGCCATCAGCA CCTTT-3′ (reverse, 544 bp); FN, 5′-AGCCGCCACGTGCCAGGATTA C-3′ (forward) and 5′-CTTATGGGGGTGGCCGTTGTG G-3′ (reverse, 439 bp).

Western blotting

Total protein in different groups was extracted and 30 μg protein from each sample was resolved in 12% sodium dodecyl sulfate polyacrylamide gradient gels and electrophoretically transferred over 1 h and 30 min at 120 V to nitrocellulose. The blots were blocked with 5% non-fat milk at room temperature for 1 h, and incubated with mouse anti-CTGF antibody, anti-ColI or anti-FN antibody (R&D, Minneapolis, MN) and mouse anti-β-actin antibody at room temperature for another 1 h. Anti-mouse IgG-HRP conjugate was added to the membrane at room temperature for 1 h. After intensive wash for three times with PBS and Triton X-100, the films were exposed for variable times to optimize detection and differences.

Statistical analysis

SPSS version 13.0 for Windows was used for data analysis. The experimental results were expressed as mean ± standard deviation (SD). One-way analysis of variance and t test were used to compare the difference among groups and p < 0.05 was considered statistically significant.

Results

Dose-dependent effect of d-glucose on CTGF expression in HKCs

The expression levels of CTGF mRNA and protein were showed in Table 1 and Figure 1. The expression levels of CTGF mRNA and protein in 30 mm d-glucose was increased than that in controls group (p < 0.01, respectively), and were significantly elevated in 60 mm d-glucose than that in controls group (p < 0.01, p < 0.05 respectively). HKCs exposed to 60 mm d-mannitol which was used as the osmotic control showed no difference in the expression of CTGF mRNA and protein compared with the normal glucose group. The results showed that the mRNA and protein expression of CTGF induced by d-glucose is dose-dependent.

Figure 1. The dose-dependent effect of high glucose on CTGF expression in HKCs. (A) The expression levels of CTGF mRNA in HKCs induced by different concentrations of glucose and mannitol (5.5 mm, 30 mm, 60 mm d-glucose and 60 mm d-mannitol); (B) The expression levels of CTGF protein in HKCs induced by different concentrations of glucose and mannitol (5.5 mm, 30 mm, 60 mm d-glucose and 60 mm d-mannitol); Gene and protein expression were detected by RT-PCR and Western blotting, respectively; β-actin was used as an internal control; *p < 0.05 versus group 5.5; **p < 0.01 versus group 5.5.

Table 1. The expression levels of CTGF mRNA and protein in HKCs induced by different concentrations d-glucose.

Groups	N	CTGFmRNA	CTGF protein
5.5 mm	3	0.6622 ± 0.025	0.6125 ± 0.028
30 mm	3	1.2796 ± 0.069**	0.9068 ± 0.167*
60 mm	3	1.4644 ± 0.064**	1.1771 ± 0.096**
M60	3	0.6702 ± 0.010	0.5936 ± 0.139

*p < 0.05 versus group 5.5 mm; **p < 0.01 versus group 5.5 mm; M60 = 60 mM d-mannitol.

Time-dependent effect of d-glucose on CTGF expression in HKCs

The expression levels of CTGF mRNA and protein in HKCs induced by d-glucose for different time period were shown in Table 2. In response to high glucose levels (30 mm) for 12, 24, 48 or 72 h, CTGF mRNA and protein expression in HKCs were significantly increased in a time-dependent manner (Figure 2). The CTGF mRNA began to increase at 12 h, reached a peak at 48 h and elevated significantly at 24, 48 and 72 h than that at 0 h (p < 0.01, respectively). Meanwhile, the CTGF protein increased significantly at 48 and 72 h than that at 0 h (p < 0.01, respectively).

Figure 2. The time-dependent effect of high glucose on CTGF expression in HKCs. (A) The expression levels of CTGF mRNA in HKCs induced by 30 mm glucose for different periods of time (0, 12, 24, 48 and 72 h); (B) The expression levels of CTGF protein in HKCs induced by 30 mm glucose for different periods of time (0, 12, 24, 48 and 72 h); Gene and protein expression were detected by RT-PCR and Western blotting, respectively; β-actin was used as an internal control; **p < 0.01 versus 0 h.

Table 2. The expression levels of CTGF mRNA and protein in HKCs induced by d-glucose for different time period.

Groups	N	CTGF mRNA	CTGF protein
0 h	3	0.5526 ± 0.021	0.5437 ± 0.086
12 h	3	0.6666 ± 0.041	0.6256 ± 0.090
24 h	3	0.8634 ± 0.053**	0.6888 ± 0.100
48 h	3	1.0689 ± 0.021**	0.8024 ± 0.091**
72 h	3	1.0304 ± 0.061**	0.8351 ± 0.078**

**p < 0.01 versus 0 h.

Construction map of PRS-CTGF-siRNA retrovirus vector

The construction map of PRS-CTGF-siRNA retrovirus vector was presented in Figure 3.

Figure 3. PRS retroviral vector map (about 6.5 kb).

Sequencing results

The sequencing results were shown in Figure 4. It suggested that no mutation was formed in the PRS-CTGF-siRNA retrovirus vectors.

Figure 4. Sequencing analysis of recombinant PRS-CTGF-siRNA retrovirus plasmid.

Effect of PRS-CTGF-siRNA on mRNA expression of CTGF, FN and col1 in HKCs induced by high glucose

The expression levels of CTGF, FN and col1 mRNA in different groups were showed in Table 3 and comparison of expression level between different groups in Figure 5. The mRNA expression of CTGF, FN and col1 were significantly up-regulated in high glucose group compared with that in the control group (p < 0.01, respectively), and down-regulated in the siRNA group, with the inhibitory by 80%, 64% and 76%, respectively (p < 0.01). However, PRS void vector group did not have this effect (p > 0.05), and isotonic group had no difference compared with control group (p > 0.05).

Figure 5. The effect of PRS-CTGF-siRNA on high glucose-induced CTGF, FN and CoI1 mRNA expression in HKCs. The CTGF (A), FN (B) and CoI1 (C) mRNA expression in HKCs cultured under 5.5 mm glucose (controls), 30 mm glucose (high glucose), high glucose + siRNA, high glucose + PRS and isotonic mannitol for 48 h. The mRNA expression determined by RT-PCR; **p < 0.01 versus controls, ##p < 0.01 versus high glucose group.

Table 3. The expression levels of CTGF, FN and col1 mRNA in HKCs induced by different conditions.

Groups	N	CTGF mRNA	FN mRNA	colI mRNA
1	3	0.5685 ± 0.012	0.3685 ± 0.014	0.5824 ± 0.018
2	3	1.0984 ± 0.018**	0.7118 ± 0.033**	1.2168 ± 0.028**
3	3	0.6670 ± 0.015##	0.4501 ± 0.025##	0.8135 ± 0.065##
4	3	1.0929 ± 0.019**	0.7221 ± 0.039**	1.1289 ± 0.057**
5	3	0.5721 ± 0.012	0.3734 ± 0.017	0.5917 ± 0.020

**p < 0.01 versus controls, ##p < 0.01 versus high glucose group (1 = controls, 2 = high glucose group, 3 = high glucose + siRNA group, 4 = high glucose + PRS group, 5 = osmotic mannitol group).

Effect of PRS-CTGF-siRNA on protein expression of CTGF and col1 in HKCs induced by high glucose

The expression levels of CTGF and col1 protein in different groups showed in Table 4, and comparison of expression level between different groups in Figure 6. The protein expression of CTGF and col1 were significantly up-regulated in high glucose group compared with that in the control group (p < 0.01, respectively), and down-regulated in the siRNA group, with the inhibitory by 2% and 75%, respectively (p < 0.01). However, PRS void vector group did not have this effect (p > 0.05), and isotonic group had no difference compared with control group (p > 0.05).

Figure 6. The effect of PRS-CTGF-siRNA on high glucose-induced CTGF and CoI1 protein expression in HKCs. The CTGF (A) and CoI1 (B) protein expression in HKCs cultured under 5.5 mm glucose (controls), 30 mm glucose (high glucose), high glucose + siRNA, high glucose + PRS and isotonic mannitol for 48 h. The protein expression determined by Western blotting; **p < 0.01 versus controls, #p < 0.05 versus high glucose group.

Table 4. The expression levels of CTGF and col1 protein in HKCs induced by different conditions.

class	N	CTGF protein	coli protein
1	3	0.4695 ± 0.116	0.3790 ± 0.101
2	3	0.7082 ± 0.071**	0.6969 ± 0.124**
3	3	0.5308 ± 0.112#	0.4572 ± 0.081#
4	3	0.7292 ± 0.061**	0.7073 ± 0.123**
5	3	0.4637 ± 0.083	0.3820 ± 0.094

**p < 0.01 versus controls, #p < 0.05 versus high glucose group (1 = controls, 2 = high glucose group, 3 = high glucose + siRNA group, 4 = high glucose + PRS group, 5 = osmotic mannitol group).

Discussion

In recent years, the researchers gradually realized that renal interstitial fibrosis plays an important role in the progression of chronic nephropathy. It is considered that renal interstitial fibrosis has relationship with the occurrence and progression of renal disfunction, and is an important marker in predicting clinical prognosis. The specific pathogenesis of renal interstitial fibrosis is not very clear, but the fibrogenic factors play key role during its development.13 Among them, TGF-β1 is widely regarded as the most important mediator of fibrogenesis.14,15 CTGF is considered to be a downstream mediator of TGF-β1 signaling in the fibrogenic process.11,16,17 However, the widely crucial functions of TFG-β1 make it undesirable as a direct target for antifibrotic therapy.18 CTGF is a secreted matricellular protein which plays important role in cell adhesion and migration, angiogenesis, myofibroblast activation, and ECM deposition and remodeling that finally lead to tissue remodeling and fibrosis.19 Researches demonstrated that under certain conditions CTGF can be indirectly produced by up-regulate TGF-β1 expression in HKCs under certain conditions.20,21 Meanwhile CTGF can induce itself secretion by autocrine in a TGF-β1-independent secretion manner. Ito22 reported that at sites of chronic tubulointerstitial lesion there existed increased expression of CTGF mRNA, which correlated with the degree of damage. Furthermore, studies revealed that inhibition of CTGF expression by siRNA prevents CCl4-induced liver fibrosis and can reverse fibrosis when administered after significant collagen deposition is observed.23 A monoclonal antibody to CTGF (FG-3019) has exhibited the ability to inhibit renal and lung fibrosis in a UUO-induced kidney fibrosis model and a bleomycin-induced pulmonary fibrosis model, respectively.24 Therefore, we speculated that anti-CTGF therapy may provide therapeutic benefit in renal tubular interstitial fibrosis.

Previous study demonstrated that exposed to high glucose CTGF expression in podocytes were increased in a dose- and time-dependent manner and podocytes displayed a cobblestone morphology, accompanied by decreased nephrin expression and increased desmin expression, suggesting podocytes underwent epithelial-mesenchymal transition (EMT).25 In addition, someone also found that exposed to high glucose for 6 h expression of CTGF mRNA was up-regulated in cultured human vascular smooth muscle cells (VSMCs), followed by ECM components accumulation.26 In our study, we observed that high glucose can up-regulate the expression of CTGF in a dose and time-dependent manner, which is consistent with previous studies. Exposed to different dose of glucose and 60 mm mannitol for 48 h, the CTGF expression in HKCs of 30 mm and 60 mm glucose group were significantly increased than controls, while the mannitol group had no effect. This indicated that the effect of high glucose on HKCs had no relationship with hypertonic condition. After HKC stimulated by high glucose, the mRNA and protein expression of CTGF began to increase at 12 h, reached a peak at 48 h, the CTGF mRNA began to slightly decline at 72 h, but protein expression still not tended to decrease. High levels of CTGF protein have more permanent impact on renal interstitial fibrosis. So, inhibiting CTGF expression in transcription level may have a better result.

Recently, siRNA therapy has become a hot point. Researchers reported that siRNA therapy had evident effect on decreasing expression of profibrogenic cytokines, and speculated that siRNA therapy may prevent or possibly arrest the progression of fibrosis in diabetic retinopathy, lung and peritoneum.10,11,27 In our experiment, we constructed plasmids PRS-CTGF-siRNA that could mediate the synthesis of CTGF siRNA, and then infected HKCs. Results revealed that the levels of CTGF mRNA and protein expression were significantly decreased in HKCs of high glucose + siRNA group compared with that of high glucose and high glucose + PRS group (p < 0.01, respectively). These results suggested that PRS retrovirus vector can express siRNA at the perfect target of HKCs. The possible mechanism might be that siRNA formed after the cells were infected with the PRS-CTGF-siRNA retrovirus vectors and siRNA was then processed into siRNA, which specifically bound to CTGF mRNA and degraded it, thus resulting in gene silencing or suppression of expression. FN and col1 are the main component of the ECM, as the support structure providing ECM components to others are frequently secreted in the early stage of tubulointerstitial fibrosis.28 Therefore, we determined the FN and col1expression in HKCs of different groups and found that high glucose can significantly up-regulate FN and col1 expression while PRS-CTGF-siRNA therapy can decrease their expression. All these suggested that the PRS-CTGF-siRNA can significantly and specifically inhibit the expression of CTGF in HKCs induced by high glucose, thereby down-regulate the expression of col1 and FN, finally reduced the ECM production and postpone the progress of renal interstitial fibrosis. Specific inhibition of CTGF expression in HKCs would be of great significance for tubulointerstitial fibrosis therapy.

As a therapeutic approach, RNAi had many advantages over other drug therapy. siRNAs are easy to produce without immunogenicity compared to recombinant proteins and monoclonal antibodies. Furthermore, siRNAs are potentially more efficient than antisense oligonucleotides. In addition, the drug discovery and development phases of RNAi-based therapy are much shorter than traditional small molecule drugs.29 What we should not ignore is that RNAi-based therapy still has barriers to overcome, such as efficient systemic delivery in humans and avoiding off-target effect, so further investigations are greatly needed.

Conclusion

The expression of CTGF siRNA mediated by PRS retrovirus vector can effectively reduce the levels of CTGF, FN and col1 induced by high glucose in cultured HKCs. This study may provide potential therapeutic strategies to prevent the renal interstitial fibrosis.

Declaration of interest

The authors declare no conflicts of interests. The authors alone are responsible for the content and writing of this article.