The serum from dialysis patients with acute coronary syndrome up-regulates the expression of TLR2 and its downstream effectors in human renal glomerular endothelial cells

Abstract

Background: This study was to investigate the expression of toll-like receptor 2 and its downstream effectors in endothelial cells in response to the serum from maintenance hemodialysis (MHD) patients with acute coronary syndrome (ACS). Methods: Human renal glomerular endothelial cells (HRGEC) were treated in vitro with serum from the healthy subjects (control group), the MHD patients with stable angina pectoris (SAP group), or the MHD patients with ACS (ACS group). The cells in ACS group were cultured in the presence or absence of TLR2 signaling blockers for 18 h. The mRNA level for TLR2, nuclear factor-κB (NF-κB), interleukin-6 (IL-6) and vascular cell adhesion molecule-1 (VCAM-1) were examined by real-time qPCR, the localization of TLR2 was detected by immunocytochemistry, and the secretion of IL-6 and VCAM-1 were measured by enzyme-linked immunosorbent assay. Results: The mRNA level of TLR2, NF-κB and IL-6 were statistically higher in the ACS group when compared with those in SAP group and healthy controls (p < 0.05), but not significantly different between SAP and healthy controls. The secretion of IL-6 in ACS group was increased when compared with SAP group and control subjects (p < 0.05). When the HRGEC were cultured with the anti-TLR2 antibodies, the expression of NF-κB, IL-6 and VCAM-1 mRNA as well as the secretion of IL-6 and VCAM-1 were significantly inhibited (p < 0.05). Conclusion: This study revealed that the TLR2 signaling may mediate pro-inflammatory response in the MHD patients occurring with ACS.

• Acute coronary syndrome
• end-stage renal disease
• hemodialysis
• inflammation
• toll-like receptor 2

Introduction

Acute coronary syndrome (ACS) is one of the major cause of mortality in dialysis patients.1 ACS results from plaque rupture and erosion associated thrombosis, leading to myocardial ischemia, injury and necrosis. Increasing evidence revealed that inflammation is the pathological hallmark of atherosclerosis.2–5 The interaction of inflammatory cytokines can degrade fibrous cap and matrix, resulting in thinning fibrous cap, vascular remodeling and plaque rupture.

Toll-like receptors are pattern-recognized receptors, selectively expressed on macrophage, monocyte, and endothelial cells.6,7 Among toll-like receptors, TLR2 and TLR4 are involved in the initiation and amplification of atherosclerosis.8–11 Several studies substantiated that TLR2 and TLR4 were closely associated with vessel spots and artery stenosis degree in ACS patients.12,13 Moreover, unlike TLR4 blockade, neutralizing TLR2 can inhibit the expression of NF-кB and the release of interleukin-6 (IL-6), IL-8, and matrix metalloproteinases.14 Compared to TLR4, up-regulation of TLR2 had much more significant influence on plaque varying from vulnerability to rupture,14 which was consistent with study by Mullick’s et al.,15 that higher expression of TLR2 was detected in artery lesion-prone area of mouse. TLR2 modulates inflammatory cascade.16 Studies have shown that TLR2 plays a pivotal role in directing the course of plaque destabilization by cytokines release.17,18 Therefore, TLR2 may exacerbate endothelium turbulence to trigger atherogenic events.

Renal dysfunction could be as new cardiovascular risk factors or markers that may improve risk prediction and help to identify the highest-risk patients. A decreased estimated glomerular filtration rate was thought to be an important risk factor for cardiovascular disease, partly due to many factors including toxin, micro-inflammatory state and advanced glycation end products can damage endothelium cells and induce turbulent disturbance in homeostasis. To our knowledge, studies regarding the expression of TLR2 in maintenance hemodialysis (MHD) patients with ACS are extremely limited.

Methods

Study population

Thirty in patients receiving hemodialysis regularly with ACS or stable angina pectoris (SAP) from December 2010 to June 2012 were enrolled in the study, and another 15 healthy individuals were recruited as the controls (Table 1). The dialysis patients with ACS included those with acute myocardial infarction and those with unstable angina pectoris. The inclusion criteria of myocardial infarction patients was higher cardiac biochemical markers (cTn) accompanied by at least one of the following symptoms at the same time: (1) ischemia symptoms; (2) ECG showing new ST-T changing or new left bundle branch block; (3) ECG showing pathologic Q wave; (4) imaging evidence suggesting new abnormalities of regional ventricular wall motion or normal myocardium injured. In contrast, patients with discomfort ischemic presence and negative troponin-I or -T were defined as unstable angina pectoris. Diagnostic criteria for stable angina were as the following: (1) clinical presentation of angina pectoris is more than 1 month; (2) angina is basically stable; and (3) ECG is normal when resting and ST segment shifts. Exclusion criteria were as the following: (1) dialysis periods less than 3 months; (2) multiple organ failure; (3) infection; (4) cancer; (5) a history of surgery within 6 months; (6) autoimmune disease; and (7) severe malnutrition. The ethics committee of Qianfoshan Hospital has approved the study. Written informed consents were obtained from all participants prior to data collection.

Table 1. Comparison of demographic and clinical characteristics of these three groups.

Characteristics	Healthy group	SAP group	ACS group
Number	15	15	15
Age (years)	34.4 ± 5.9	59.8 ± 10.7	62.6 ± 11.8
Male (n, %)	6 (40.0)	7 (46.7)	8 (53.3)
Causes of CKD (n, %)
Chronic glomerulonephritis	–	6 (40.0)	4 (26.7)
Hypertension	–	3 (20.0)	3 (20.0)
Diabetic nephropathy	–	3 (20.0)	5 (33.3)
Other	–	3 (20.0)	3 (20.0)
Duration of dialysis (months)	/	33.6 ± 40.7	47.8 ± 41.2
Hemoglobin (g/L)	145.7 ± 13.2	108.5 ± 16.7	103.1 ± 13.6
Blood urea nitrogen (mmol/L)	4.91 ± 0.97	25.92 ± 6.15	25.3 ± 6.10
Serum creatinine (μmol/L)	60.6 ± 11.9	705.1 ± 216.8	653.2 ± 220.9
Total cholesterol (mmol/L)	4.21 ± 1.50	3.91 ± 1.13	4.39 ± 0.67
Triglyceride (mmol/L)	1.01 ± 0.43	0.99 ± 0.30	1.44 ± 0.80
Low density lipoprotein (mmol/L)	2.10 ± 0.94	2.42 ± 1.16	2.58 ± 0.46
Uric acid (μmol/L)	292.53 ± 73.83	381.18 ± 98.33	373.17 ± 118.3
Albumin (g/L)	44.63 ± 4.06	40.16 ± 7.52	38.77 ± 3.58
Calcium (mmol/L)	2.30 ± 0.13	2.18 ± 0.14	2.07 ± 0.29
Phosphorus (mmol/L)	1.25 ± 0.14	1.87 ± 0.54	1.96 ± 0.54
iPTH (ng/L)	34.90 (32.35–36.85)	222.30 (156.75–417.65)	240.6 (109.73–312.85)
Troponin I (ng/mL)	–	0.066 ± 0.031	0.809 ± 0.463
CRP (mg/L)	2.45 ± 0.30	3.06 ± 2.18	4.07 ± 2.63

Notes: ACS, acute coronary syndrome; SAP, stable angina pectoris; CKD, chronic kidney disease.

Blood sample collection

Blood samples were obtained at an overnight fasting of at least 8 h before dialysis or at the onset of ACS for ACS group, respectively. The blood samples were centrifuged at 3000 rpm for 10 min to separate the serum, and stored at −80 °C. Plasma hemoglobin, urea nitrogen, creatinine, lipid and lipoprotein profile, β2-microglobulin, uric acid, albumin, calcium, phosphorus, and troponin I were measured by chemo-enzymatic assay. Intact parathyroid hormone concentration was measured using immunoradiometric assay and C-reactive protein was measured by immune transmission turbidimetry assay.

Cell culture

Human renal glomerular endothelial cells (HRGEC) were provided by Institute of Physiology, Shandong University. HRGEC were cultured in six-well plates (5 × 10⁵/well) in DMEM/F12 (Hyclone, Biosera, Sussex, UK) medium containing 10% fetal bovine serum (Hyclone), 100 U/mL penicillin and 100 μg/mL streptomycin, and maintained in 5% CO₂ humidified atmosphere at 37 °C. After 32 h, cells were incubated by medium containing 10% serum of healthy volunteers (control group), dialysis patients with SAP (SAP group), or dialysis patients with ACS (ACS group). The cells were cultured with 20 μg TLR2 blocking antibodies [TL2.3 (eBioscience, San Diego, CA)] for 30 min and then maintained with medium containing 10% serum of MHD patients with ACS and 90% DMEM/F12. After 18 h, HRGEC under each condition were collected, and supernatants were saved at −80 °C.

Real time-qPCR

Total RNA was extracted from HRGEC according to the manufacturer’s protocol (Takara, Osaka, Japan). The integrity of RNA was detected by agarose gel electrophoresis. The purity and concentration of RNA was determined by spectrophotometer. RNA samples with the purity between 1.8 and 2.0 were stored at −20 °C. Real time-qPCR was performed in a total volume of 25 μL according to the SYBR-Green reagent (Takara). Cycling conditions of TLR2, NF-кB, and IL-6 were carried out as follows: 50 °C for 2 min, 95 °C for 10 min, 45 cycles of 95 °C for 15 s, 55–61 °C for 1 min, and 72 °C for 1 min, followed by 95 °C for 15 s, and 60 °C for 1 min. The cycling conditions of vascular cell adhesion molecule (VCAM-1) including: 50 °C for 2 min, 95 °C for 10 min, 45 cycles of 94 °C for 20 s, 61 °C for 40 s, followed by 95 °C for 15 s, and 60 °C for 1 min. Data were analyzed by using 2^−Δct method (Table 2).

Table 2. Primer sequence.

Gene	Sequence	Size (bp)	Tm (°C)
GAPDH
Sense	TGGGGAAGGTGAAGGTCG	108	55–61
Anti-sense	GGGGTCATTGATGGCAACAATA
TLR2
Sense	ATCCAGCACACGAATACAC	171	61
Anti-sense	ATGGGTAAGAGGGAGGCA
NF-κB
Sense	ATGTGGAGATCATTGAGCAGC	151	55
Anti-sense	CCTGGTCCTGTGAGCCATT
IL-6
Sense	TGAGAGTAGTGAGGAACAAGCCAG	121	55
Anti-sense	GGCATTTGTGGTTGGGTCAGG
VCAM-1
Sense	TGGAAGAAGCAGAAAGGAAGTGG	87	61
Anti-sense	TGACACTCTCAGAAGGAAAAGCTG

Note: All sequences are in the 5′ to 3′ orientation.

Immunocytochemistry

Cells were fixed with 4% paraformaldehyde for 20 min, 0.3% TritonX-100 for 20 min, and then incubated in 3% H₂O₂ for 10 min. After washing extensively, the cells were incubated with the rat anti-human TLR2 antibody (1:100) (Abcam) 4 °C overnight, then followed the operation according to Powervision Two-step Histostaining reagent and DAB kit instructions (Zhongshan, Beijing, China).

ELISA

IL-6 and VCAM-1 were determined by indirect sandwich ELISA methods with commercially available kit following the manufacturer’s protocol. All supernatants were detected twice at a time. IL-6 concentration ranged from 2 to 600 ng/L, whereas VCAM-1 concentration ranged from 0.2 to 60 ng/mL.

Statistical analysis

All analyses and calculation were performed by SPSS statistical package version 16.0 (SPSS Inc., Chicago, IL). Data were presented as proportions for categorical variables and mean ± standard deviations or medians (inter-quartile ranges) for continuous variables. Comparisons were evaluated using t-test or Wilcoxon rank-sum test for continuous variables, and chi-square test for categorical variables. p Value of less than 0.05 is considered statistically significant.

Results

The serum from dialysis patients with ACS stimulates the expression of TLR2 mRNA on HRGEC

The expression of TLR2 mRNA of HRGEC treated with serum from the patients of the ACS group was statistically higher than those from in SAP group and the healthy controls (p < 0.05). No statistically significant difference was found between the TLR2 mRNA levels from the samples of SAP group and the healthy controls (p > 0.05) (Table 3). Immunohistochemical results showed that the TLR2 was mainly located on glomerular endothelial cell surface (Figure 1).

Figure 1. Immunohistochemical analysis of TLR2 protein. (A) ACS group; (B) SAP group; (C) control group; (D) anti-TLR2 group. Original magnification, ×400. Abbreviations: ACS, acute coronary syndrome; SAP, stable angina pectoris; → refer to the location of TLR2.

Table 3. The expression of TLR2 and its downstream effectors.

ACS group	SAP group	Control group	Anti-TLR2 group
TLR2 mRNA	2.45 ± 0.92*	1.55 ± 0.79	1.30 ± 0.59**	0.61 ± 0.54***
NF-κB mRNA	0.22 ± 0.07*	0.13 ± 0.05	0.11 ± 0.04**	0.06 ± 0.05***
IL-6 mRNA	0.13 ± 0.03*	0.08 ± 0.04	0.06 ± 0.02**	0.02 ± 0.01***
VCAM-1 mRNA	0.09 ± 0.04	0.09 ± 0.03	0.08 ± 0.03**	0.03 ± 0.005***
IL-6 (ng/L, 0 h)	136.14 ± 16.61*	117.92 ± 12.14	107.63 ± 10.81**	136.14 ± 16.61
IL-6 (ng/L, 18 h)	177.98 ± 26.43*	134.68 ± 17.09	110.59 ± 9.17**	76.08 ± 7.36***
VCAM-1 (ng/mL, 0 h)	6.51 ± 0.73	6.43 ± 0.62	6.42 ± 0.67**	6.51 ± 0.73
VCAM-1 (ng/mL, 18 h)	6.63 ± 0.81	6.54 ± 0.58	6.36 ± 0.64**	5.25 ± 0.62***

Notes: ACS, acute coronary syndrome; SAP, stable angina pectoris.

*p < 0.05, ACS group compared with SAP group and control group;

**p > 0.05, SAP group compared with control group;

***p < 0.05, ACS group compared with Anti-TLR2 group.

NF-кB and IL-6 mRNA is up-regulated

The mRNA level of nuclear factor-κB (NF-κB) and IL-6 was statistically higher in the ACS group when compared with those in SAP group and healthy controls (p < 0.05), but not significantly different between SAP and healthy controls.

IL-6 secretion was increased in ACS group

We examined the secretion of IL-6 and VCAM-1 at 0 and 18 h. Interestingly, after 18 h, the secretion of IL-6 in ACS group was significantly higher than the SAP group (p < 0.05), whereas the secretion of VCAM-1 showed no difference between these two groups (p > 0.05) (Table 3).

Blocking TLR2 down-regulated the expression of the inflammatory cascade

To evaluate the role of TLR2 in hemodialysis patients with ACS, we used TLR2 antibody to neutralize the TLR2–NF-кB signaling pathway. After inhibiting TLR2, the mRNA levels of NF-кB, IL-6, and VCAM-1 were significantly decreased compared with other three groups (p < 0.05) (Table 3).

Discussion

In this study, we changed the environment of endothelial cells in vitro to explore the expression of TLR2 in MHD patients with ACS. Our results revealed that the expression of TLR2, NF-κB, and IL-6 mRNA was statistically higher in the ACS group than those in SAP group and healthy controls. When the HRGEC were cultured with the anti-TLR2 antibodies, the expression of NF-κB, IL-6, and VCAM-1 mRNA as well as the secretion of IL-6 and VCAM-1 was inhibited significantly. These findings suggested that enhanced TLR2-mediated signaling pathway contributed to the incidence of ACS in hemodialysis.

Endothelial dysfunction was the earliest step in the pathogenesis of atherosclerosis. Leukocyte recruitment, monocyte conversion, and macrophage internalize modified lipid can result in plaque erosion,19 which may be aggravated by enhanced TLR2 signaling.14 Versteeg et al. revealed that the expression of TLR2 was elevated in patients with stable ischemic coronary artery disease and had a positive correlation with both the vascular stenosis degree and the number of diseased vessels.20 Plaque rapture was the pathophysiological basis of ACS; this study revealed that ACS in dialysis patients might be related to TLR2 up-regulation.

Furthermore, the expression of TLR2 was paralleled by the increased expression of NF-кB as well as the production of IL-6. NF-кB is intracellular transcription factors, which regulates the expression of downstream inflammation cytokines and adhesion molecule, such as IL-6 and MCP-1.21 In the course of atherogenesis, numerous of neutrophils adhered to subendothelium, turned to macrophages, and subsequently stimulated IL-6 secretion. In addition, VCAM-1 could accelerate neutrophile migration,21 whereas blocking VCAM-1 could protect ischemia reperfusion injury.22 Arslan et al. proved that antagonizing TLR2 5 min before reperfusion could reduce infarct size and preserve cardiac in mice by reducing the number of neutrophils, cytokines secretion and proapoptotic signaling.23 Similarly, Ldlr−/− Tlr2−/− mice fed with high-fat diet demonstrated a decrease of 50% lesion volume in aortic atherosclerosis.9 To validate the role of TLR2 signaling pathway in the pathogenesis of ACS in hemodialysis patients, we used the anti-TLR2 antibodies to block the signal pathway. After blocking the pathway, the expression of NF-кB, IL-6, and VCAM-1 was reduced, suggesting that inhibition of TLR2 could decrease the pro-inflammatory response.

In conclusion, TLR2 might mediate pro-inflammatory through NF-кB signaling pathway in hemodialysis patients with ACS, and blocking TLR2 signal pathway may be a novel approach in treating plaque destabilization.

Author’s contributions

K.L. and S.J. participated in the study, analyzed the data, interpreted the results, and drafted the manuscript. C.M. participated in the survey and study design and collected the data. X.D. formed the study concept, interpreted the results, and revised the manuscript. All authors read and approved the final manuscript.

Declaration of interest

None declared.

Acknowledgments

This work was funded by the Natural Science Foundation from Shandong Science and Technology Committee (ZR2010HL002). We would like to acknowledge prof. Ju Liu for his generous sponsorship for revising the manuscript for important intellectual content.