Naringin ameliorates sodium arsenite-induced renal and hepatic toxicity in rats: decisive role of KIM-1, Caspase-3, TGF-β, and TNF-α

Abstract

Chronic exposure of a naturally occurring metal arsenic leads to renal and hepatic diseases. Naringin, a flavanone glycoside, possesses anti-inflammatory and anti-oxidant potential. The aim of this investigation was to evaluate the protective effect of naringin against arsenic-induced renal and hepatic toxicity in rats. Renal and hepatic toxicity was induced in rats by sodium arsenite (5 mg/kg, p.o.). Rats were treated orally with either vehicle or naringin (20, 40, and 80 mg/kg) or Coenzyme Q10 (10 mg/kg) for 28 days. Various biochemical, histological, and molecular biomarkers were assessed in kidney and liver. Treatment with naringin (40 and 80 mg/kg) significantly and dose-dependently restored (p < 0.01 and p < 0.001) altered levels of kidney (serum creatinine, urine creatinine, BUN, uric acid, and creatinine clearance) and liver function test (AST and ALT) induced by sodium arsenite. Elevated levels of oxido-nitrosative stress in renal and hepatic tissue was significantly and dose-dependently decreased (p < 0.01 and p < 0.001) by naringin (40 and 80 mg/kg) treatment. It significantly and dose-dependently down-regulated (p < 0.01 and p < 0.001) renal KIM-1, Caspase-3, TGF-β, and TNF-α mRNA expression. Histopathological alteration induced in kidney and liver by sodium arsenite was reduced by naringin (40 and 80 mg/kg) treatment. In conclusion, naringin treatment ameliorates arsenic-induced renal and hepatic damage in rats due its antioxidant and anti-inflammatory properties via down-regulation of elevated oxido-nitrosative stress, KIM-1, Caspase-3, TGF-β, and TNF-α levels.

• Caspase-3
• KIM-1
• Naringin
• renal toxicity
• sodium arsenite
• TGF-β
• TNF-α

Introduction

Inorganic arsenic as trivalent arsenite (As³⁺) or pentavalent arsenite (As⁵⁺) is a potent naturally occurring toxic agent possesses multiple toxic effects on the animal as well as on human health standpoints. Drinking water is the main source through which arsenic exposure occurs in most of the developing country like India, China, Mexico, and Bangladesh.1 Arsenic compounds have high value in an agricultural application such as fungicides, insecticides, herbicides, algaecides, and wood preservatives.1 Arsenic indulge in various enzymatic reactions, affects probably whole organ system in human and other animals.2 Due to inorganic arsenic toxicity concerns with various other form of internal cancers international agency for research on cancer classify arsenic as a group 1 human carcinogen.3 In addition, arsenic exposure possesses non-cancerous effects like kidney diseases, liver diseases, lung disease, hypertension, diabetes, anaemia, cardiovascular diseases, and neurological disorder.4^,5 Investigation at the cellular and molecular levels reveals that arsenic exposure begets ROS via cellular oxidation–reduction reaction that ultimately causes oxidative stress.6 ROS in associated with cellular biomolecule responsible for lipid peroxidation, damage protein, enzyme as well as DNA in cells, hinder mitosis, and aggravate apoptosis.7

It has been reported that liver and kidney are ascribed as highly prone organs to deleterious manifestation by toxins.8–11 Arsenic accumulation and excretion occur in kidney, long term exposure of arsenic havoc the pathology of kidney which cause acute renal failure characterized by nephritis, nephritic syndrome, and nephrosis.8^,12 A study reveals that metabolic conversion of arsenic into methylated products occurs in the liver.13 Previously, it has been claimed that arsenic causes oxidative stress responsible for the apoptosis, increased cell proliferation, genomic flexibility, and deviant estrogen signaling in association with liver toxicity.14 Oral arsenic exposure leads changes in hepatocyte mitochondria, i.e., condensation of mitochondrial matrix and distortion of mitochondrial transmembrane potential.15 It is also well acknowledged that prolong arsenic exposure cause lung cancer.16 Evidence from the several study show that arsenic-exposed subjects also undergoes nervous system impairment such as depression, mood swing, impaired facial recognition, convulsion, seizure, headache, and decreased locomotor activity.16 Arsenic exposure plays a pivotal role in the pathogenesis of cardiac tissue that contributes cardiac arrhythmias, myocardial injury, and cardiomyopathy.17 The molecular mechanism through which arsenic intoxication on male reproductive organs still not illuminated. Although some evidence reveals that oxidative stress responsible for the inflammation with the production of pro-inflammatory cytokines involve in arsenic-induced organ damage.18

Naringin (4′,5,7-trihydroxyflavone 7-rhamnoglucoside) is a bioflavonoid predominantly present in grapefruits and related citrus species.19 After oral ingestion of naringin, enzymes like α-rhamnosidase, and β-glucosidase hydrolyzed it into the absorbable form of naringenin.20 Naringin plays a significant role as metal-chelating, antioxidant, anti-apoptotic, and free radical scavenging properties.21 Various evidence support that naringin possess numerous pharmacological and therapeutic action, antimutagenic, anti-inflammatory, anticancer, antihypertensive, neuroprotective, wound healing, antihyperlipidemic, and anticancer potential.22–29 Metabolized product of naringin, i.e., naringenine has a promising nephroprotective and hepatoprotective actions.30^,31 Naringin crosses the blood–brain barrier thus it imparts ameliorative effect on central nervous system diseases.32–34 A previous study revealed that naringin exhibited potential cardioprotective effect via modulation of membrane stabilizing and antioxidant properties.35 A previous study carried in out our laboratory showed that naringin possesses protective action against sodium arsenite-induced testicular toxicity via inhibition of TNF-α and IL-1β.36 Hence, the aim of this study was to investigate the protective effect of naringin against arsenic-induced renal and hepatic toxicity via assessment of biochemical, histological, and molecular biomarkers.

Materials and methods

Animals

Adult male Sprague–Dawley rats (200–250 g) were purchased from the National Institute of Biosciences, Pune (India). They were maintained at 24 ± 1 °C, with a relative humidity of 45–55% and 12:12 h dark/Light cycle. The animals had free access to standard pellet chow (Pranav Agro-industries Ltd., Sangli, India) and water throughout the experimental protocol. All experiments were carried out between 09:00 and 17:00 h. The experimental protocol was approved by the Institutional Animal Ethics Committee (IAEC) of Poona College of Pharmacy, Pune and performed in accordance with the guidelines of Committee for Control and Supervision of Experimentation on Animals (CPCSEA), Government of India on animal experimentation.

Drugs and chemicals

Naringin was purchased from Sigma Chemical Co. (St. Louis, MO). Coenzyme Q10 was supplied by Medicines Pvt. Ltd. (Mumbai, India) whereas sodium arsenite was purchase from Otto Chemicals, India. 1,1′,3,3′-Tetraethoxypropane, crystalline beef liver catalase, and 5,5′-dithiobis (2-nitrobenzoic acid) were purchased from S.D. Fine Chemicals, Mumbai, India. Sulphanilamides, naphthylamine diamine HCl, and phosphoric acid were obtained from Loba Chemie Pvt. Ltd., Mumbai, India. Total RNA Extraction kit and One-step RT-PCR kit was purchased from MP Biomedicals India Private Limited, India.

Experimental design

Rats were randomly divided into following groups (n = 6) as follows:

• Group I: Normal [N]: Received double distilled water (5 mL/kg, p.o.) for 28 days.

• Group II: Arsenic + Coenzyme Q10 (10 mg/kg) [As + CoQ10 (10)]: Received sodium arsenite (10 mg/kg, p.o.) and treated with Coenzyme Q10 (10 mg/kg, p.o.) for 28 days.

• Group III: Arsenic Control [As]: Received sodium arsenite (5 mg/kg, p.o.) and treated with distilled water (5 g/kg, p.o for 28 days) for 28 days.

• Group IV: Arsenic + Naringin (20 mg/kg) [As + N (20)]: Received sodium arsenite (5 mg/ kg, p.o.) and treated with naringin (20 mg/kg, p.o.) for 28 days.

• Group V: Arsenic + Naringin (40 mg/kg) [As + N (40)]: Received sodium arsenite (5 mg/ kg, p.o.) and treated with naringin (40 mg/kg, p.o.) for 28 days.

• Group VI: Arsenic + Naringin (80 mg/kg) [As + N (80)]: Received sodium arsenite (5 mg/ kg, p.o.) and treated with naringin (80 mg/kg, p.o.) for 28 days.

Kidney and liver toxicity were induced in rats (except normal) by sodium arsenite at a dose of 5 mg/kg, orally for 28 days.37 Coenzyme Q10 was prepared in 1% aqueous solution of Tween 80, while sodium arsenite was dissolved in normal saline. The three different dosage of naringin 20, 40, and 80 mg/kg were selected based on the previous studies carried out in our laboratory27^,28 whereas dose of Q10 (10 mg/kg) was selected based on the previous studies.36^,38^,39 Everyday naringin was freshly prepared as 1% aqueous solution in distilled water. Food intake, water intake, and urine output were recorded after placing individual animals in metabolic cages (Techniplast, Italy). At the end of treatment period, rats were anesthetized by ethereal anaesthesia and blood was withdrawn by a retro-orbital puncture. Each blood sample was collected into separate vials for determination of serum parameters. After blood collection the animals were sacrificed by cervical dislocation, kidney and liver were rapidly removed and stored at −80 °C for biochemical and RT-PCR analysis. A kidney and liver of rat from each group was isolated and fixed for histopathological evaluation.

Serum and urinary biochemistry

The serum was separated by centrifugation using Eppendorf Cryocentrifuge (model No. 5810, Germany), maintained at 4 °C and run at a speed of 7000 rpm for 15 min. Serum creatinine, urine creatinine, BUN, Uric acid, ALT, and AST were measured by spectrophotometer (UV–Visible spectrophotometer, Jasco V-530, Japan) using reagent kits according to procedure provided by manufacturer (Accurex Biomedical Pvt. Ltd., Mumbai, India).

Biochemical estimation

Tissue homogenate preparation

All animals were sacrificed at the end of the study, i.e., on the 29th day, kidney and liver were immediately isolated. Tissue homogenates were prepared with 0.1 M Tris-HCl buffer (pH 7.4) and supernatant of homogenates was employed to estimate superoxide dismutase (SOD), reduced glutathione (GSH), lipid peroxidation (MDA content), nitric oxide (NO content), and Na–K–ATPase as described previously.38–43

Determination of KIM-1, Caspase-3, TGF-β, and TNF-α by reverse transcriptase PCR in kidney

RNA isolation

The levels of mRNA were analyzed in kidney tissue using a reverse transcription (RT)-PCR as described previously.44–47 Single-stranded cDNA was synthesized from 5 µg of total cellular RNA using reverse transcriptase kit (MP Biomedicals India Private Limited, India) as described previously.44 The primer sequence for kidney injury molecule-1 (KIM-1), Caspase-3, transforming growth factor-beta (TGF-β), tumor necrosis factor-alpha (TNF-α), and β-actin are presented in Table 1. Amplification of β-actin served as a control for sample loading and integrity. PCR products were detected by electrophoresis on a 1.5% agarose gel containing ethidium bromide. The size of amplicons was confirmed using a 100-bp ladder as a standard size marker. The amplicons were visualized, and images were captured using a gel documentation system (Alpha Innotech Inc., San Leandro, CA). Expression of all the genes was assessed by generating densitometry data for band intensities in different sets of experiments and was generated by analyzing the gel images on the Image J software, Version 1.33 (Wayne Rasband, NIH, Bethesda, MD) semi-quantitatively. The band intensities were compared with constitutively expressed β-actin. The intensity of mRNAs was standardized against that of the β-actin mRNA from each sample, and the results were expressed as PCR-product/β-actin mRNA ratio.

Table 1. Primer sequences for KIM-1, Caspase-3, TGF-β, TNF-α and β-actin.

	Sequence
Gene	Forward primer	Reverse primer	Size (bp)
KIM-1	ACTCCTGCAGACTGGAATGG	CAAAGCTCAGAGAGCCCATC	212
Caspase-3	CTCGGTCTGGTACAGATGTCGATG	GGTTAACCCGGGTAAGAATGTGCA	238
TGF-β	GTTCTTCAATACGTCAGACATTCG	CATTATCTTTGCTGTCACAAGAGC	309
TNF-α	AAGCCTGTAGCCCATGTTGT	CAGATAGATGGGCTCATACC	295
β-actin	GTCACCCACACTGTGCCCATCT	ACAGAGTACTTGCGCTCAGGAG	764

Histological evaluation of kidney and liver

At the end of experiment, kidney and liver were isolated and fixed for histopathological evaluation with 4% buffered paraformaldehyde solution and embedded in paraffin. Three to four-micrometer thick paraffin sections were dewaxed and brought to the water through graded ethanol. Sections of kidney and liver were stained with hematoxylin–eosin stain (H & E), then dehydrated through graded ethanol, cleared in xylene and mounted with Distyrene Plasticizer Xylene. H & E stained sections were graded to verify the morphological assessment of tissue damage. For staining of renal fibers, the Yuccafine Masson’s trichrome staining kit (Yucca Diagnostics, India) was used. The sections stained with Masson’s trichrome stain were assessed for the presence of interstitial fibrosis, and hematoxylin and eosin-stained sections were graded for the presence of medullary congestion, tubular cell necrosis and dilation, cytoplasmic vacuolization, nuclear pyknosis, and cytoplasmic eosinophilia. Photomicrographs were captured at 40× and 100× magnification.

Statistical analysis

Data was expressed as mean ± standard error mean (SEM). Data analysis was performed using Graph Pad Prism version 5.0 software (Graph Pad, San Diego, CA). Data of biochemical parameters was analyzed by one-way analysis of variance (ANOVA), and Dunnett’s tests were applied for post hoc analysis. A value of p < 0.05 was considered to be statistically significant.

Results

Effect of naringin on sodium arsenite-induced alteration in body weight and relative organs weight in rats

There was significant decreased (p < 0.001) in body weight, relative weights of kidney and liver of arsenic control rats as compared to normal rats. However, there was significant and dose-dependent increase (p < 0.05 and p < 0.01) in body weight, relative weights of kidney and liver in naringin (40 and 80 mg/kg, resp.) treated rats as compared to arsenic control rats. Whereas, treatment with Coenzyme Q10 (10 mg/kg) also showed a significant increase (p < 0.001) in the body weight, the relative weight of kidney and liver as compared to arsenic-treated rats (Table 2).

Table 2. Effect of naringin on sodium arsenite-induced alteration in body weight, kidney weight and liver weight.

Parameters	N	As	As + CoQ10 (10)	As + N (20)	As + N (40)	As + N (80)
Body weight (gm)	248.5 ± 8.14	179.7 ± 5.81###	228.6 ± 6.67***	181.1 ± 3.85	210.6 ± 9.99*	220.7 ± 9.74**
Relative kidney weight	0.50 ± 0.03	0.70 ± 0.02###	0.52 ± 0.02***	0.67 ± 0.02	0.59 ± 0.03*	0.55 ± 0.02**
Relative liver weight	3.16 ± 0.25	4.87 ± 0.43###	3.04 ± 0.16***	4.61 ± 0.26	4.15 ± 0.23*	3.62 ± 0.19**

Data are expressed as mean ± SEM (n = 5) and analyzed by one-way ANOVA followed by Dunnett’s test multiple range test. *p < 0.05, **p < 0.01 and ***p < 0.001 as compared with the Arsenic Control group. ###p < 0.001 as compared to normal group. N: Normal group; As: Arsenic Control group; CoQ10 (10): Coenzyme Q10 (10 mg/kg, p.o.) treated group; N (20): naringin (20 mg/kg, p.o.) treated group; N (40): naringin (40 mg/kg, p.o.) treated group and N (80): naringin (80 mg/kg, p.o.) treated group.

Effect of naringin on sodium arsenite-induced alteration in renal biomarkers in rats

Oral administration of sodium arsenite resulted in significant increased (p < 0.001) in serum creatinine, BUN, uric acid as compared to normal rats, whereas sodium arsenite treated rats showed a significant decrease (p < 0.001) in urine creatinine and creatinine clearance as compared to normal rats. However, treatment with naringin (40 and 80 mg/kg) showed significantly and dose-dependently decreased (p < 0.01 and p < 0.001, respectively) serum creatinine, BUN, uric acid as well as significant and dose-dependent increased (p < 0.01 and p < 0.001, respectively) in urine creatinine and creatinine clearance as compared to arsenic-treated group. Furthermore, treatment with Coenzyme Q10 (10 mg/kg) showed significant increased (p < 0.001) in serum creatinine, BUN, uric acid as well as significant decreased (p < 0.001) in urine creatinine and creatinine clearance as compared to normal rats (Table 3).

Table 3. Effect of naringin on sodium arsenite-induced alteration in kidney and liver function test.

Parameters	N	As	As + CoQ10 (10)	As + N (20)	As + N (40)	As + N (80)
Serum creatinine (mg/dL)	0.99 ± 0.12	4.25 ± 0.28###	2.46 ± 0.18***	3.91 ± 0.29	2.83 ± 0.29**	2.51 ± 0.30***
Urine creatinine (mg/dL)	64.26 ± 5.98	28.89 ± 3.67###	62.37 ± 2.37***	33.60 ± 3.05	47.89 ± 2.53**	51.98 ± 2.19***
Creatinine clearance (mL/min)	18.75 ± 2.89	7.98 ± 1.22###	16.84 ± 1.05***	8.78 ± 2.04	12.41 ± 2.41**	15.85 ± 1.78***
BUN (mg/dL)	18.19 ± 1.89	61.27 ± 4.81###	25.42 ± 2.45***	54.96 ± 3.43	45.63 ± 2.64**	32.13 ± 2.55***
Uric acid (mg/dL)	1.49 ± 0.24	4.32 ± 0.42###	2.08 ± 0.15***	4.00 ± 0.33	3.18 ± 0.31*	2.53 ± 0.24**
ALT (IU/I)	56.60 ± 6.00	219.7 ± 12.81###	88.46 ± 8.67***	200.5 ± 9.76	171.6 ± 12.55**	122.2 ± 8.16***
AST (IU/I)	97.35 ± 7.75	212.1 ± 8.22###	100.7 ± 7.51***	196.5 ± 10.56	160.6 ± 10.61**	120.2 ± 7.29***

Data are expressed as mean ± SEM (n = 5) and analyzed by one-way ANOVA followed by Dunnett’s test multiple range test. *p < 0.05, **p < 0.01 and ***p < 0.001 as compared with the Arsenic Control group. ###p < 0.001 as compared to normal group. N: Normal group; As: Arsenic Control group; CoQ10 (10): Coenzyme Q10 (10 mg/kg, p.o.) treated group; N (20): naringin (20 mg/kg, p.o.) treated group; N (40): naringin (40 mg/kg, p.o.) treated group and N (80): naringin (80 mg/kg, p.o.) treated group. BUN: Blood urea nitrogen; ALT: Alanine transaminase; AST: Aspartate Aminotransferase.

Effect of naringin on sodium arsenite-induced alteration in hepatic biomarkers in rats

The level of serum ALT and AST were increased significantly (p < 0.001) in sodium arsenite control rats as compared to normal rats. Treatment with naringin (40 and 80 mg/kg) showed significant and dose-dependent (p < 0.01 and p < 0.001, respectively) decreased in serum ALT and AST as compared to sodium arsenite control rats, whereas Coenzyme Q10 (10 mg/kg) treated rats also showed significantly decreased (p < 0.001) serum ALT and AST as compared to sodium arsenite control rats (Table 3).

Effect of naringin on sodium arsenite-induced alteration in renal oxidative stress biomarkers in rats

There was significantly decreased (p < 0.001) in renal SOD and GSH in sodium arsenite control rats as compared to normal rats. However, treatment with naringin (40 and 80 mg/kg) showed significantly and dose-dependently increased (p < 0.01 and p < 0.001, respectively) renal SOD and GSH level as compared to sodium arsenite control rats. In addition, renal MDA level was significantly increased (p < 0.001) in sodium arsenite treated rats as compared to normal rats, whereas treatment with naringin (40 and 80 mg/kg) showed significantly and dose-dependently decreased (p < 0.01 and p < 0.001, respectively) in renal MDA level as compared with sodium arsenite treated rats. Furthermore, Coenzyme Q10 (10 mg/kg) treated rats show significant increased (p < 0.001) in renal SOD and GSH as well as significant decreased (p < 0.001) in renal MDA contents as compared with sodium arsenite control rats (Table 4).

Table 4. Effect of naringin on sodium arsenite-induced alteration in oxido-nitrosative stress and membrane-bound enzyme.

Parameters	N	As	As + CoQ10 (10)	As + N (20)	As + N (40)	As + N (80)
Renal SOD (U/mg of protein)	11.07 ± 0.86	4.68 ± 0.42###	9.61 ± 0.74***	6.51 ± 0.80	8.20 ± 0.44**	9.17 ± 0.58***
Renal GSH (µg/mg protein)	46.88 ± 2.84	21.88 ± 1.55###	43.22 ± 2.61***	28.87 ± 2.22	33.88 ± 2.63**	38.92 ± 1.92***
Renal MDA (nM/mg of protein)	2.89 ± 0.29	6.53 ± 0.66###	3.13 ± 0.33***	5.87 ± 0.42	4.57 ± 0.40**	3.57 ± 0.32***
Renal NO (µg/mL)	108.2 ± 6.043	286.2 ± 12.30###	177.0 ± 9.56***	264.2 ± 11.60	230.1 ± 11.02**	188.4 ± 11.38***
Renal Na-K-ATPase (µmol/mg of protein)	13.53 ± 0.91	3.63 ± 0.57	10.44 ± 0.96***	4.90 ± 0.72	7.02 ± 0.55*	8.66 ± 1.21**
Hepatic SOD (U/mg of protein)	12.17 ± 1.11	4.60 ± 0.89###	10.62 ± 0.90***	5.39 ± 0.56	8.25 ± 0.92*	10.04 ± 0.98**
Hepatic GSH (µg/mg protein)	13.58 ± 0.65	3.57 ± 0.59###	11.04 ± 0.64***	5.21 ± 0.48	6.60 ± 0.75**	8.69 ± 0.52***
Hepatic MDA (nM/mg of protein)	0.45 ± 0.13	3.13 ± 0.22###	1.89 ± 0.19***	2.58 ± 0.17	2.11 ± 0.07**	1.89 ± 0.19***
Hepatic NO (µg/mL)	111.7 ± 9.05	282.4 ± 13.92###	141.5 ± 9.92***	259.6 ± 13.59	216.5 ± 12.10**	164.3 ± 9.87***

Data are expressed as mean ± SEM (n = 5) and analyzed by one-way ANOVA followed by Dunnett’s test multiple range test. *p < 0.05, **p < 0.01 and ***p < 0.001 as compared with the Arsenic Control group. ###p < 0.001 as compared to normal group. N: Normal group; As: Arsenic Control group; CoQ10 (10): Coenzyme Q10 (10 mg/kg, p.o.) treated group; N (20): naringin (20 mg/kg, p.o.) treated group; N (40): naringin (40 mg/kg, p.o.) treated group and N (80): naringin (80 mg/kg, p.o.) treated group.

Effect of naringin on sodium arsenite-induced alteration in hepatic oxidative stress biomarkers in rats

The level of hepatic SOD and GSH were significantly decreased (p < 0.001) in sodium arsenite control rats as compared to normal rats, whereas treatment with naringin (40 and 80 mg/kg) show significant and dose-dependent increased (p < 0.01 and p < 0.001, respectively) in hepatic SOD and GSH level as compared to sodium arsenite treated rats. However, hepatic MDA level was significantly decreased (p < 0.001) in sodium arsenite treated rats as compared to normal rats. Treatment with Coenzyme Q10 (10 mg/kg) showed significant increased (p < 0.001) in hepatic SOD and GSH as well as significantly decreased (p < 0.001) the hepatic MDA level as compared with sodium arsenite treated rats (Table 4).

Affect of naringin on sodium arsenite-induced alteration in renal and hepatic NO levels in rats

There was significant increased (p < 0.001) in renal and hepatic NO level in sodium arsenite control rats as compared to normal rats. However, treatment with naringin (40 and 80 mg/kg) showed significant and dose-dependent decreased (p < 0.01 and p < 0.001, respectively) in renal and hepatic NO level as compared to sodium arsenite control rats. Furthermore, Coenzyme Q10 (10 mg/kg) treated rats showed significant decreased (p < 0.001) in renal and hepatic NO level as compared with sodium arsenite control rats (Table 4).

Effect of naringin on sodium arsenite-induced alteration in renal Na–K-ATPase levels in rats

Membrane bound Na–K-ATPase level was significantly decreased (p < 0.001) in sodium arsenite control rats as compared to normal rats. However, naringin (40 and 80 mg/kg) treated rats showed noteworthy and dose-dependent increase (p < 0.05 and p < 0.01, respectively) in Na–K-ATPase levels as compared to sodium arsenite treated rats, whereas treatment with Coenzyme Q10 (10 mg/kg) showed significant increased (p < 0.001) in Na–K-ATPase levels as compared to sodium arsenite treated rats (Table 4).

Effect of naringin on sodium arsenite-induced alteration in renal mRNA expression of KIM-1, Caspase-3, TGF-β, and TNF-α in rats

There was significant up-regulation (p < 0.001) in renal KIM-1 mRNA expression in sodium arsenite control rats as compared to normal rats. Treatment with naringin (40 and 80 mg/kg) significant and dose-dependently down-regulated (p < 0.05 and p < 0.01, respectively) renal KIM-1 mRNA expression as compared to sodium arsenite control rats. When compared with sodium arsenite control rats, the up-regulated mRNA expression of Caspase-3, TGF-β, and TNF-α was significantly and dose-dependently down-regulated (p < 0.01 and p < 0.001, respectively) by naringin (40 and 80 mg/kg) treatment, whereas treatment with Coenzyme Q10 (10 mg/kg) show significant down-regulated (p < 0.001) renal KIM-1, Caspase-3, TGF-β, and TNF-α mRNA expression as compared to sodium arsenite control rats (Figure 1).

Figure 1. Effect of naringin on sodium arsenite-induced alteration in renal mRNA expression of KIM-1, Caspase-3, TGF-β and TNF-α in rats (A), quantitative representation of mRNA expression of KIM-1 (B), Caspase-3 (C), TGF-β (D) and TNF-α (E). Results are represented as mean ± SEM, (n = 4) Data was analyzed by One-way ANOVA followed by post hoc Dunnett’s tests. *p < 0.05, **p < 0.01 and ***p < 0.001 as compared with the Arsenic Control group. ###p < 0.001 as compared to normal group. N: Normal group; As: Arsenic Control group; CoQ10 (10): Coenzyme Q10 (10 mg/kg, p.o.) treated group; N (20): naringin (20 mg/kg, p.o.) treated group; N (40): naringin (40 mg/kg, p.o.) treated group and N (80): naringin (80 mg/kg, p.o.) treated group.

Effect of naringin on sodium arsenite-induced pathological alteration in rat kidney

Figure 2A depicted the normal architecture of kidney tissue from normal rats with devoid of any changes like congestion, necrosis, and inflammatory infiltration with the presence of intact glomerulus basement membrane and tubules. Sodium arsenite caused massive renal damage reflected by the presence of intrinsic lesions within the glomeruli and epithelium. It also showed the presence of edema and inflammatory infiltration (Figure 2B). The thickness of glomerulus basement membrane was increased. Naringin (20 mg/kg) treatment showed the presence of moderate edema and inflammatory infiltration (Figure 2D). However, the thickness of glomerulus basement membrane was remains increased as that of sodium arsenite control rats. Naringin (40 and 80 mg/kg) treatment showed the reduction in the renal damage reflected by decreased inflammatory infiltration with the restoration of the glomerulus basement membrane (Figure 2E and F, respectively). Renal tissue from Coenzyme Q10 (10 mg/kg) treated rats showed mild number of inflammatory cells with reduced necrosis, edema, and thickens of glomerulus basement membrane was intact (Figure 2C).

Figure 2. Effect of naringin on sodium arsenite-induced alteration in kidney histology of rats. Photomicrograph of sections of kidney from normal group (A); Arsenic Control group (B); Coenzyme Q10 (10 mg/kg, p.o.) treated group (C); Naringin (20 mg/kg, p.o.) treated group (D); Naringin (40 mg/kg, p.o.) treated group (E) and Naringin (80 mg/kg, p.o.) treated group (F). H & E staining at 100× and respective inset at 400×.

Light microscopic evaluation of the renal tissue from the sodium arsenite control rats after Masson’s trichrome staining showed severe interstitial fibrosis (Figure 3B). Renal tissue from normal rats did not show the presence of any interstitial fibrosis (Figure 3A). Treatment with naringin (20 mg/kg) showed the presence of moderate interstitial fibrosis (Figure 3D) whereas naringin (40 and 80 mg/kg) and Coenzyme Q10 (10 mg/kg) treatment decreased interstitial fibrosis (Figure 3E, F, and C, respectively).

Figure 3. Effect of naringin on sodium arsenite-induced alteration in kidney histology of rats. Photomicrograph of sections of kidney from normal group (A); Arsenic Control group (B); Coenzyme Q10 (10 mg/kg, p.o.) treated group (C); Naringin (20 mg/kg, p.o.) treated group (D); Naringin (40 mg/kg, p.o.) treated group (E) and Naringin (80 mg/kg, p.o.) treated group (F). MT staining at 100×.

Effect of naringin on sodium arsenite-induced pathological alteration in rat liver

Liver tissue from normal rats showed the normal architecture of the hepatic tissue. The central vein in liver parenchymal cells was normal without any signs of inflammation, necrosis, congestion, and vacuolization (Figure 4A). Administration of sodium arsenite caused inflammatory infiltration, centrilobular necrosis, shrunken hepatocytes, chromatin condensation, cytoplasmic vacuolation, and vascular congestion in the hepatocytes of sodium arsenite control rats (Figure 4B). However, administration of Coenzyme Q10 (10 mg/kg) showed moderate histopathological changes in liver reflected by sinusoidal congestion, cytoplasmic vacuolation, and the presence of only a few inflammatory cells (Figure 4C). In naringin (40 and 80 mg/kg) treated rats, the histology of liver showed mild degree of vacuolization, moderate inflammatory cells, necrosis, and congestion around central vein (Figure 4E and F, respectively). However, moderate inflammatory infiltration, centrilobular necrosis, cytoplasmic vacuolation, and vascular congestion were present in the histological structure of hepatocytes from naringin (20 mg/kg) treated rats (Figure 4D).

Figure 4. Effect of naringin on sodium arsenite-induced alteration in liver histology of rats. Photomicrograph of sections of liver from normal group (A); Arsenic Control group (B); Coenzyme Q10 (10 mg/kg, p.o.) treated group (C); Naringin (20 mg/kg, p.o.) treated group (D); Naringin (40 mg/kg, p.o.) treated group (E) and Naringin (80 mg/kg, p.o.) treated group (F). H & E staining at 100×.

Discussion

Arsenic is ubiquitously present in the environment considered as a one of the heavy metal and human carcinogen.7 Arsenic has wide spectrum of application in the era of agriculture wood preservatives, herbicides, insecticides, fungicides, algaecides as well in the manufacturing of semiconductors, dyestuffs, glass, cigarette, smelters, and as metal alloys additive.48 The mechanism behind the arsenic toxicity is resembled its chemical forms and oxidative state. Arsenic responsible for the generation of reactive oxygen species (ROS) (intracellular peroxide, hydrogen peroxide, superoxide anion radicals, and hydroxyl free radicals), reactive nitrogen species (RNS), which provoke proinflammatory cytokines, profibrogenic cytokines, and assault mitochondrial respiratory chain which create obstacle in the antioxidant defence system further lead cellular DNA and protein marred.49^,50 Arsenic after ingestion promptly absorbed by the gastrointestinal tract and circulated in the blood to the kidney, liver, and spleen in other word almost affect all organs.51

Chronic arsenic exposure causes various disease and abnormalities in the several organs like kidney and liver.5 Abatement in body weight is an important signal for the impairment of the animal health status. Nandi et al. (2005) and Kaltreider et al. (2001) revealed that arsenic diminish the calibre of glucocorticoids and its receptor.52^,53 Glucocorticoid hormones involve in glucose regulation, lipid, carbohydrates, and protein metabolism. Inhibitory effect of sodium arsenite on the body weight and relative weight of kidney and liver resembles with the finding of previous researchers.54^,55 Rahman et al. (1998) explain that long time arsenic exposures upshot inception of diabetes mellitus that elicit the cause of weight loss of rats.56 Indeed, arsenic-induced nephrotoxicity in experimental animals is well-known events.57^,58 Arsenic exposure cause renal ruination which impinge tubular and glomerular deterioration with a simultaneous decrease in lysosomal latency as an early beacon of renal mishap.59 It has been revealed that arsenic is an important cause of chronic renal disease.60 Alteration in kidney function due to arsenic toxicity examined by measuring serum and urinary markers of the kidney. Creatine is picked up by skeletal muscles and converted to creatine phosphate by creatine kinase. Both creatine and creatine phosphate are converted non-enzymatically and irreversibly to creatinine. Urinary and serum creatinine are used to evaluate the creatinine clearance that emulate the glomerular filtration rate that is a salient feature of renal function.61 Arsenic damage the cells release creatine phosphokinase that is responsible for the conversion of phosphocreatine into creatine.62 The liver produces urea in the urea cycle as a waste product of the digestion of protein. Blood urea nitrogen (BUN) is a waste product of protein catabolism, terminated by the kidneys as urea, and an indication of renal health. Uric acid is the final product of purine metabolism, and it is formed from guanine and hypoxanthine via xanthine in reactions catalyzed by guanase and xanthine oxidase. The toxic effect of arsenic alters the guanase and xanthine oxidase that elevate the serum uric acid level.62 Previous finding expose that arsenic-treated rat show significant decreased in urinary creatinine and creatinine clearance and increased in the serum BUN and uric acid which in line with our investigation.63

Glutathione (GSH) is a tripeptide non-enzymatic antioxidant that has a beneficiary role in the cell protection against arsenic-induced reactive oxygen species.64 However, various mechanism have been postulated for the impairment of the GSH level in arsenic-induced toxicity; for conversion of As (v) to As (iii) arsenic act as an electron donor,65 sulfhydryl group oxidation impeder.66 In our study, present finding show that GSH level declined in the kidney and liver of arsenic-treated group compared to normal rats indicating oxidative stress resemble with the agreement of previous finding.67^,68 However, treatment with naringin noticeably elevate the GSH level in kidney and liver that is in line with the previous investigation.69

Oxidative stress is an important feature of cell apoptosis and necrosis.70–73 It is well known that reactive oxygen species is generated during the process of cell death and an enhanced level of ROS occur due to the production of antioxidant and detoxifying enzymes catalase, or superoxide dismutase has a tutelary role.74–77 SOD abets the dismutation of superoxide to H₂O_2, which is cleaved by catalase.78–80 It has been revealed that the reaction of molecular oxygen with dimethylarsine (a metabolite of dimethyl arsenic acid) produce free radical species,81–83 Significantly decrease in the activity of SOD content may be due to the overproduction of superoxide during arsenic metabolism.84 In this investigation, arsenic treated group clearly reflects significant reduction of SOD content in kidney and liver due to oxidative stress which is in accordance with the previous study,36^,84^,85 whereas treatment with naringin remarkably soar the SOD level in aforementioned organs.86

Arsenic activate the release of iron from ferritin through the activation of heme oxygenase the rate-limiting enzyme in heme degradation.87 Free iron is assumed as a potent enhancer of ROS formation, as exemplified by the reduction of H₂O₂ with the generation of highly aggressive hydroxyl radical.88–92 Hydroxyl radicals penetrate membrane barriers and enter in the cell nucleus where it react mutagenically with DNA and play a noxious role.93–96 Reactive oxygen species can lead lipid peroxidation and havoc the membrane lipid bilayer arrangement that result in deactivation of membrane-bound receptors and enzyme and promote tissue permeability.91^,97–99 Evidence from the previous outcome show that arsenic exposure cause elevation of MDA level which is an end product of lipid peroxidation arises through the ROS generation lead oxidative stress in kidney and liver that is correlation with this investigation.52 This study revealed that treatment with naringin refurbishes the MDA level in kidney and liver that is in agreement with the previous paradigm.100

Nitric oxide (NO) interact with molecular oxygen and water generate stable oxidized product, i.e., nitrite and nitrate.101 NO play a vital role as a transcellular messenger in the various physiological processes. NADPH-dependent enzymes known as NO synthases (NOS) responsible for the production of NO from the terminal guanido nitrogen atom of l-arginine.102 NO retain an unpaired electron. Thus, it acts as a free radical. On arsenic exposure NO promptly react with O²⁻ produce a noxious product, peroxynitrite anion that oxidized sulfhydryl groups and thioethers further cause DNA damage.103 Basically, three mechanism participate in DNA damage via NO i.e. N-nitroso compound formation which cause DNA alkylation, interfering with primary amino group of DNA, which leads deamination and finally formation of ROS like peroxynitrite and hydroxyl radicals.104 NO or ROS or may be both are culprit indulge in arsenic-induced DNA strand cleavage, it is up to cell type examined. Mukherjee et al. (2006) aforementioned that rat treated with arsenic show a significant increase in NO production.105 Based on the evidence of this study, it is hypothesized that increase production of NO in kidney and liver due to generation of ROS, i.e., peroxynitrite which result oxidative stress concord with the finding of previous arsenic-induced toxicity model.85 However, treatment with naringin reflects down-regulation of NO level in kidney and liver.

Estimation of membrane-associated enzymes activities such as ATPases are an important hallmark of alteration in membranes under pathological states.106 Membrane bound ATPases comprises sulfhydryl group associated with enzymes and lipid dependent.107 It is previously claimed that sodium–potassium adenosine triphosphatase (Na/K ATPase) responsible for the energy-dependent eviction of sodium ions (Na⁺) and uptake of potassium ions (K⁺) play a crucial role in the maintenance of ionic homeostasis.108 Arsenic exposure causes oxidative stress that create hurdles in the antioxidant defence system wreck membrane lipids and debilitate Na/K ATPase functioning that could be important in water/ion transport alteration. Evidence from the previous study revealed that cellular transport incapacitate due to enervated ATP metabolism after arsenic or 4-hydroxy-2-nonenal (a lipid peroxidation product) exposure.109 It is clearly depicted from the various experiment that arsenic-treated rat show downregulation of Na/K ATPase activities in kidney due to increased in lipid peroxidation by free radicals which is consort with the our investigation.85

Heavy metals like arsenic, cadmium, lead, and mercury disturb the antioxidant defence system and depletion of thiol status cause ROS generation which ultimately show the deleterious effect on cellular enzymes.110 Arsenic exposure is an important cause of nephrotoxicity is kindred with oxidative stress, proximal tubular menace and necrosis of proximal tubular epithelial cell in kidney of rats.111 Kidney injury molecule-1 (KIM-1) is a transmembrane glycoprotein which is normally undetectable in normal kidney thoroughly express in dedifferentiated proximal tubule cells after toxic insult or ischemic acute kidney injury in animal models.112^,113 It is previously reported that KIM-1 is a promising tissue and urinary biomarker for kidney injury induced by various nephrotoxicants. Tissue and urinary expression of KIM-1 were elucidated by numerous nephrotoxic doses of cadmium, mercury, chromium, cisplatin, gentamicin, and folic acid.114^,115 In this study, we evaluate the possible role of KIM-1 in association with arsenic-induced nephrotoxicity has not been reported previously. Expression of KIM-1was increased in the control rats, whereas treatment with naringin reduced these increased level of renal KIM-1 mRNA expression as compared to control rats.

Arsenic intoxication leads generation of ROS, which cause production of apoptosis and modification of cells.116 Arsenic compounds such as Arsenic trioxide (As₂O₃) combine with adenine nucleotide translocator in the mitochondria or directly act on the mitochondria responsible for opening of mitochondrial permeability transition pore and thus release cytochrome c (Cyt c),117 decline mitochondrial membrane potential, activation of caspases, i.e., caspase-3 and caspase-9.118^,119 Caspase-3 is an important apoptotic marker imparts in cytoskeletal deterioration, nuclear decrease as well as cells alteration in coordination with apoptosis.120 It has been previously reported that arsenic-treated rats show activation of renal casapase-3 expression via enhanced apoptosis and cytoskeletal disintegrity which is concurrent with the finding of our investigation.85^,121 Naringin treated group show a remarkably decrement in Caspase-3 level in arsenic administered rats as compared to control rats.

Transforming growth factor-β (TGF-β) is a protein involve in various cellular processes including differentiation, growth, immunosuppression, angiogenesis, cancerization as well as extracellular matrix formation. TGF-β1 is isoforms of TGF-β apprehend the cell cycle in G1 phase that evoke restrain of cell proliferation and promote apoptosis. TGF-β1 is a vigorous profibrogenic cytokine and increased in TGF-β1 levels due to oxidative stress cause activation of profibrotic signaling pathways.122 Previously it is reported that arsenic lead ROS generation which aggravates pro-inflammatory and profibrogenic cytokines in renal and hepatic tissue.50 In normal tissue, non-parenchymal cells (fat-storing cell, kupffers cell, and endothelial cell) source of TGF-β1 production.123 From the evidence of previous study, it is cleared that sodium arsenite treated group show significant upregulation of renal TGF-β which is in line with our investigation.124 This study shows noteworthy down-regulation of renal TGF-β on treatment with naringin.

Tumor necrosis factor-alpha (TNF-α) is an important pro-inflammatory chemokines and cytokines that play a key role in adaptive and innate immunity. Due to its pro-inflammatory characteristic it involves in recruitment and activation of inflammatory cells at the injury sites.125 It is well described that ROS is produced by cytokines and elevated level of ROS by the metabolism of arsenic may be responsible for the activation of TNF-α synthesis.126 It has been already documented that ROS generation is the consequences of arsenic exposure that leads to tissue fibrosis.127 TNF-α play a foremost role in the actuation of HSCs (hepatic stellate cells), predominant cells impart in the creation of collagen type-I in the liver and involve in remodelling of the extracellular matrix and histological hepatic fibrosis.128 In kidney, glomerular mesangial cells are the prime genesis of TNF-α.129 TNF-α abate glomerular blood flow and GFR by activating mesangial cells to beget vasodilatory and vasoconstrictive mediators.130 Ramanathan et al. (2005) previously claimed that on arsenic administration there was a conspicuous upswing in the extent of renal TNF-α which is in accordance with findings of this investigation.131 However, arsenic-exposed rat treated with naringin show a significant reduction in renal TNF-α level.

In conclusion, the results of this investigation shows that naringin treatment ameliorates arsenic-induced renal and hepatic damage in rats, which could be due its antioxidant and anti-inflammatory properties via down-regulation of elevated oxido-nitrosative stress, KIM-1, Caspase-3, TGF-β, and TNF-α levels.

Acknowledgments

The authors acknowledge Dr. S. S. Kadam, Vice Chancellor, Bharati Vidyapeeth Deemed University and Dr. K. R. Mahadik, Principal, Poona College of Pharmacy for their keen interest and providing the necessary facilities to carry out the study.

Declaration of interest

We are also thankful to the All India Council of Technical and Education (AICTE), India for financial support by awarding GPAT Scholarship to one of the authors Mr. Mohammad Adil for the research work.

The authors report no conflicts of interest. The authors alone are responsible for the content and writing of this article.