Stress induces glucocorticoid-mediated apoptosis of rat Leydig cells in vivo

Abstract

Stress can disrupt endocrine signalling in the male reproductive axis through high concentrations of glucocorticoids, the hallmark of stress. Our previous work revealed that a stress level of exogenous glucocorticoids could induce apoptosis of rat Leydig cells, which are the primary source of testosterone. The aim of this study was to investigate whether stress can induce apoptosis in rat Leydig cells in vivo and, if so, whether the process is the result of a direct effect of glucocorticoids. In a chronically stressed rat model, serum corticosterone concentration was increased significantly whereas serum testosterone was decreased. The frequency of apoptotic Leydig cells in stressed rats was also increased. Adrenalectomised rats subjected to chronic stress showed an elevated serum testosterone, while the apoptotic frequency of Leydig cells was not increased. It was established that glucocorticoid-induced Leydig cell apoptosis is mediated by glucocorticoid receptors (GRs), which translocate from cytoplasm to nucleus. Adenovirus microRNA-induced downregulation of GR expression in vitro alleviated the corticosterone-induced increase in apoptosis of Leydig cells. These results indicate that the stress-induced increase in corticosterone secretion resulted in apoptosis in rat Leydig cells in vivo, and thereby decreased testosterone synthesis.

Keywords::

• Adenovirus microRNA
• adrenalectomy
• apoptosis
• glucocorticoid receptor
• Leydig cell
• testosterone

Introduction

Exposure to environmental and work-related stress is the cause of a variety of health problems, and is more prevalent in modern society than ever before. During stress, physiological adaptations counteract with the negative effects of the stressor and maintain homoeostasis. Among these adaptations, the most prominent reaction is that the activity of the hypothalamic–pituitary–adrenal axis is enhanced. The production of glucocorticoids is increased by stress; therefore, an elevated concentration of glucocorticoid is a biomarker of stress (Munck et al. 1984; Chrousos and Gold 1992). Many studies have shown that long-term excessive stress can impair male reproductive function, for instance, the failure of sexual function and decrease in fertility (Fenster et al. 1997; Korte 2001).

The main function of Leydig cells in the testes is to synthesise and secrete androgen. Testosterone is the most important sex steroid hormone that regulates male physiological function. An insufficient secretion of testosterone can result in abnormalities of male sexual function, leading to infertility. It is well known that the synthesis and secretion of testosterone are regulated by the hypothalamic–pituitary–gonadal axis. Glucocorticoids may affect gonadal function at multiple levels in the hypothalamic–pituitary–gonadal axis: (1) the hypothalamus (to decrease the synthesis and release of gonadotropin-releasing hormone); (2) the pituitary gland (to inhibit the synthesis and release of luteinising hormone (LH) and (3) the testis (to modulate steroidogenesis directly; Whirledge and Cidlowski 2010). LH secreted by the pituitary gland is the main factor, which regulates the biosynthesis and secretion of testosterone. Here, we focused our study on the third level, namely the decreased steroidogenic capacity of the testis resulting from glucocorticoid-induced apoptosis in Leydig cells. In recent years, studies have shown that glucocorticoids (corticosterone in rats) secreted by the adrenal cortex can reduce the synthesis of testosterone through the inhibition of the expression and activity of enzymes involved in testosterone biosynthesis (Srivastava et al. 1993; Gao et al. 1996; Dong et al. 2004). In the clinic, it was discovered that male patients with chronic stress, Cushing's disease or treated with glucocorticoids for a long time have increased glucocorticoid levels serum accompanied by decreased testosterone levels (Contreras et al. 1996; Vierhapper et al. 2000). Taken together, these phenomena suggested that there is a correlative relationship among stress, glucocorticoids and the function of Leydig cells, i.e. stress-induced increase in glucocorticoid production decreases testosterone production by Leydig cells in the testis.

It is known that the concentration of testosterone in the body is governed by the number of Leydig cells as well as the ability of individual Leydig cells to synthesise testosterone. Our previous studies showed that corticosterone injected into adrenalectomised (ADX) rats at greater than the physiological concentration can induce apoptosis in Leydig cells, thus contributing to the observed decrease in testosterone concentrations (Gao et al. 2002, 2003). Hence, glucocorticoid can evidently affect the concentration of testosterone in the body through controlling the number of Leydig cells. However, the experiment evaluated only the effect of exogenous glucocorticoids on Leydig cells, which might not mimic the complicated endocrine changes in response to stress with great accuracy. Stress results in increased corticosterone secretion in rats, and such stress-induced increases in glucocorticoid levels cause programmed cell death of neurons and thymocytes (Hatanaka et al. 2001; Joëls et al. 2004). Several papers have reported that stressed rats have a decreased concentration of testosterone synthesised and secreted by Leydig cells (Deviche et al. 2010). Here, we tested the hypothesis that stress impairs reproductive function in males through the actions on Leydig cells that reduce testicular testosterone production. The aim of this study was to use a rat model of chronic stress to investigate whether stress can induce Leydig cell apoptosis, thus contributing to the suppression of testosterone production during stress.

Materials and methods

Establishment of rat model of chronic stress

Animals

Male Sprague-Dawley (SD) rats (90 days old) were purchased from the Animal Centre of the Academy of Science of China (Shanghai, China) and maintained at 24 ± 1°C under a 12 h light/12 h dark cycle (09:00 h light on/21:00 h light off) with food and water freely available. All animal procedures (protocol number 03-048, renewed 25 September 2003) were approved by the Institutional Animal Care and Use Committee of Shanghai Jiao Tong University School of Medicine.

The chronic unpredictable stress procedures

Twenty male SD rats (90 days old) were divided randomly into a control group and a stress group with 10 rats in each (5 rats/cage). Experiments were done between 09:00 and 16:00 h. The control rats were sampled at the same time points but they were undisturbed for the duration of the experiment. Rats in the stress group were exposed to two of the following stressors per day for 21 consecutive days: immobilisation, forced swimming in ice-cold water or kept in a room at 4°C. Details of the procedures are as follows. Immobilisation: rats were restrained in wire mesh restrainers (19 cm circumference × 40 cm long) for 6 h a day. Swimming in ice-cold water: rats were forced to swim in ice-cold water for 5 min. Kept at 4°C: rats were kept in a cold room at 4°C for 30 min daily. The chronic unpredictable stress (CUS) sequence consisted of different types of stressors presented randomly, twice a day, over a period of 21 days.

At the completion of the protocol, at the end of a stress period, the rats were asphyxiated by CO₂. After decapitation, trunk blood was collected immediately and centrifuged at 500g. The serum supernatants were stored at − 70°C. Testes were retained. The overall design was repeated three times.

Determination of serum hormone concentrations

Corticosterone assay

Serum samples, collected and stored as above, were diluted 1:10 and processed in duplicate. The final values for each rat were averaged and are presented as ng/ml. Corticosterone concentrations were determined using an enzyme immunoassay kit (Corticosterone EIA Kit, Cayman Chemical, Ann Arbor, MI, USA) according to the manufacturer's instructions. Antibody cross-reactivity to other steroids did not exceed 1.01%. The assay specificity was 100% for corticosterone, the assay sensitivity was 230 pg/ml (detection limit: 40 pg/ml) and the intra-assay coefficient was 9.0%. Absorbance at 412 nm was measured using a spectrophotometer (BioTek, Winooski, VT, USA).

Testosterone assay

Serum testosterone concentrations were determined using a testosterone enzyme immunoassay kit (Cayman Chemical) based on the competition between testosterone and a testosterone–acetylcholinesterase (ACHe) conjugate for a limited number of testosterone-specific binding sites. Testosterone standards were prepared according to the manufacturer's instructions. Serum samples were diluted 1:10 and processed in duplicate. Following the preparation of testosterone standards, these and the serum samples as well as the necessary controls were loaded onto a 96-well plate. Each well was coated with mouse antirabbit IgG. Testosterone-specific ACHe tracer was added to most of the wells followed by the addition of the rabbit anti-testosterone antiserum to most of the same wells. The plate was then incubated for 1 h at room temperature to allow for competitive binding. After washing, the concentration of testosterone was determined by measuring the enzymatic activity of ACHe with Ellman's reagent (which contains the substrate for ACHe). The product of this enzymatic reaction has a yellow colour that absorbs at 412 nm. The plate was left to develop in the dark for approximately 1 h, then read at 412 nm with a spectrophotometer. All samples for hormone measurement were quantified in the same assay. The assay specificity for testosterone was 100%, the intra-assay coefficient was 9.0% and the detection limit was 6 pg/ml. Results were calculated with a computer spreadsheet program provided by Cayman Chemicals (http://www.caymanchem.com/eiatools/promo/kit).

Isolation of Leydig cells and detection of apoptosis

Leydig cells were isolated from the control and stressed rats as described (Sriraman et al. 2000), which is a modification of an earlier procedure (Klinefelter et al. 1987). Testes were quickly removed and decapsulated, then subjected to collagenase III digestion (M199 medium with 0.25 mg/ml collagenase) at 34°C for about 20 min until the seminiferous tubules were separated. The medium containing the interstitial cells was aspirated and filtered through a 100 μm pore size nylon mesh. The filtrate was centrifuged at 300g for 10 min at 4°C to form a crude interstitial pellet, which was suspended in 50% (v/v) isotonic Percoll. The suspension was centrifuged at 20,000g for 45 min at 4°C. Percoll fractions corresponding to the densities of 1.070–1.090 g/ml were collected, and the cells in this fraction were diluted with 2 volumes of M199 and pelleted by centrifugation at 300g for 5 min at 4°C. The purity of the isolated cell fractions was evaluated by histochemical staining for 3β-hydroxysteroid dehydrogenase activity, with 0.4 nM etiocholanolone as the steroid substrate (Payne et al. 1980). The enrichment of the Leydig cells was up to a purity of 90% on average.

For the fluorescent-activated cell sorting (FACS) analysis, the Leydig cells isolated from both the stressed and control groups were resuspended with 1 × binding buffer and incubated with 5 μl of propidium iodide (PI) and 5 μl of Annexin-V-FITC (BD Pharmingen, San Diego, CA, USA) at room temperature for 15 min in the dark. The Leydig cells were then analysed by FACS. Annexin-V-FITC binds to cells that contain phosphatidylserine on the outer layer of the cell membrane, and PI stains the cellular DNA with a compromised cell membrane. This allows for discrimination between live cells (unstained with either fluorochrome) from apoptotic cells (stained only with Annexin-V-FITC) and necrotic cells (stained with both Annexin-V- FITC and PI).

Observation of the ultrastructure of Leydig cells with transmission electron microscopy

The stressed and control rats were anaesthetised by CO₂, injected i.p. with 0.3% pentobarbital sodium and then perfused with 2% (v/v) glutaraldehyde via the abdominal aorta. After perfusion, the testes were removed. Small fragments (about 2 mm wide) were taken from different sites of each testis and immersed in 2%(v/v) glutaraldehyde in phosphate-buffered saline (PBS, pH 7.2) for 2 h at 4°C. After washing with PBS, the fragments were post-fixed in 1% (w/v) osmium tetroxide in PBS (pH 7.2) for 2 h at 4°C, then washed with PBS again, dehydrated and embedded in Epon, following usual procedures. For each testis, an Epon-embedded specimen was taken at random and sections about 100 nm thick were cut serially. One out of every four sections was mounted on a single-hole, formvar film covered grid. The sections were double stained with saturated 3%(w/v) uranyl acetate in 50% (v/v) alcohol and lead citrate, then observed with a transmission electron microscopy (TEM; Philips CM120).

Determination of the serum corticosterone, testosterone concentrations and the apoptotic frequency of Leydig cells in ADX rats subjected to CUS treatment

Male SD rats, 90 days old, were randomly divided into three groups with eight rats in each: SHAM group (subjected to sham surgery), ADX group (subjected to adrenalectomy) and ADX+stress group (ADX rats subjected to stress).

Bilateral adrenalectomy was carried out according to the following surgical procedure: anaesthesia was induced by intraperitoneal injection of 2% sodium pentobarbital (50 mg/kg). A dorsal midline skin incision was made from the 1st to 3rd lumbar vertebra. The muscle wall was entered with a pair of blunt forceps lateral to the spine on each side. Both adrenal glands, the left located lateral to the spleen on the anterior pole of the left kidney and the right located cranial to the right kidney and in close proximity to the vena cava, together with their fat pads, were lifted out of the incision with oval forceps and excised. Each adrenal gland was inspected under a stereomicroscope to ensure complete extraction. The skin incision was closed using wound clips. Rats assigned to the SHAM group underwent the same procedures as rats assigned to the ADX group, with the exception that the adrenals were left intact, and served as controls. Two days after ADX, blood was collected from the orbital venous plexuses, and serum corticosterone concentrations of ADX rats were measured with a corticosterone EIA Kit to evaluate whether the adrenalectomy was successful. The drinking water supplied to ADX rats was supplemented with 0.9% NaCl routinely to maintain electrolyte balance. Three days after ADX, all ADX rats were given corticosterone at 0.2 mg/100 g body wt per day for 21 days by intraperitoneal injection to maintain the minimal basal glucocorticoid level (Hansson et al. 2000; Hansson and Fuxe 2008). All surgical procedures and corticosterone injections were performed between 07:00 and 09:00 h. The ADX+stress group was exposed to CUS for 21 days starting 3 days after ADX. During the 21-day CUS treatment, rats were weighed on the first day (namely 3 days after ADX) and on the last day (namely 24 days after ADX) for the evaluation of the rats' health. At the end of the 21-day CUS period (24 days after ADX), blood samples were collected from the orbital venous plexuses in all groups, and serum corticosterone concentrations were assayed again to exclude regeneration of the adrenals. The next morning at 09:00 h after CUS exposure, all group rats were asphyxiated by CO₂ inhalation. After decapitation, serum was collected and Leydig cells were isolated and purified. Serum testosterone levels were measured by ELISA. The apoptotic frequencies of Leydig cells were determined by FACS. Autopsy was carried out on the ADX rats to verify successful adrenalectomy. The design was repeated three times.

Determination with immunofluorescence of glucocorticoid receptor translocation in Leydig cells of stressed rats

Confocal imaging was used to determine the translocation of glucocorticoid receptors (GRs) in rat Leydig cells in the testis. Frozen testis sections were dissected under a microscope, cut into small segments, fixed in 4% paraformaldehyde for 30 min and permeabilised with 0.1% (v/v) Triton X-100 for 5 min. The sections were rinsed three times (5 min each) with PBS. After blocking specimens with 10% (v/v) normal goat serum in PBS for 1 h, the testis sections were incubated overnight at 4°C with primary antibody specific for GR (Santa Cruz Biotechnology, Santa Cruz, CA, USA), diluted 1:50. The sections were rinsed three times with PBS (5 min each) and incubated with a fluorescent secondary antibody (Santa Cruz Biotechnology), diluted 1:100, for 2 h at 37°C in the dark. Hoechst33342 (Sigma, St Louis, MO, USA) diluted 1:800 in PBS was added to these sections 10 min before incubation with the second antibody to counter-stain cellular nuclei. After staining, the sections were rinsed with PBS again. Finally, the sections were mounted on slides with glycerol/PBS. Images were obtained with a laser scanning confocal microscope (Zeiss, Jena, Germany). The excitation wavelength was 543 nm and the emission wavelength was LP 560 nm for red fluorescence; and the excitation wavelength was 375 nm and the emission wavelength was BP 460 nm for blue fluorescence. In control staining conditions, a frozen section of testis was incubated with the secondary antibody alone, and showed no fluorescence.

Knockdown of GRs in Leydig cells with adenovirus-mediated RNA interference

Construction of recombinant adenoviruses expressing microRNA against rat GR: we designed and synthesised four pairs of oligonucleotide-encoding microRNA against rat GR and cloned them into pcDNA™6.2-GW/EmGFPmiR to generate an expression vector containing the oligonucleotide-encoding microRNA. The vector was transfected into rat embryonic fibroblast to detect the effect of interference for initial screening. The optimal oligonucleotide sequence was

Table

1F	TGCTGATCATATCCTGCATACAACACGTTTTGGCCACTGACTGACGTGTTGTACAGGATATGAT
1R	CCTGATCATATCCTGTACAACACGTCAGTCAGTGGCCAAAACGTGTTGTATGCAGGATATGATC

After screening, an Entry Clone was obtained through the BP reaction (Gateway technology, Invitrogen, Carlsbad, CA, USA) between the optimal expression vector and the pDONR221 vector. Then an LR recombination reaction was done between the Entry Clone and adenoviral backbone plasmid (pAD/CMV/V5-DEST) to generate the adenoviral expression construct in Escherichia coli DH5α. The resulting constructs were transfected into 293A cells mediated by Lipofectamine2000 (Invitrogen) to package infective adenoviruses. After several rounds of repeated infection of 293A cells, the adenoviruses were amplified to the appropriate titre. Here we named the recombinant adenoviruses containing microRNA against rat GR as miGR adenovirus. The production of adenoviruses was monitored by green fluorescent protein expression. GR expression in the infected cells was detected by Western blot.

Infection of Leydig cells with adenoviruses

Leydig cells were plated with Leydig cell medium (LCM). On the day of infection (Day 1), adenovirus stock was thawed and diluted to a multiplicity of infection (MOI) of 100 in fresh LCM. LCM containing the adenovirus at a MOI of 100 was added to the Leydig cells, and the cells were maintained in a 34°C incubator over night. The following day (Day 2), the medium containing the virus was removed and replaced with fresh LCM. The cells were harvested at 3 days post-infection and assayed for the knockdown of the target gene.

Western blot analysis for knockdown of GR

The infected Leydig cells were lysed in RIPA buffer (1% (v/v) NP-40, 0.1% (w/v) SDS, 0.5% (w/v) deoxycholate, 150 mM NaCl, 10 mM Tris–HCl and 1%(v/v) PMSF) at 4°C for 30 min. The total protein concentration was measured with a BCA protein assay kit (Pierce, Rockford, IL, USA). Equal amounts of extracts (20 μg) were electrophoresed on 8% (w/v) SDS-polyacrylamide gels (SDS-PAGE gel), and the separated proteins were electrotransferred to a nitrocellulose membrane. The membranes were blocked with 5% (v/v) non-fat milk in PBS-T (PBS with 0.1% (v/v) Tween-20) for 1.5 h at room temperature and incubated with primary antibodies overnight at 4°C. After washing, the membrane was treated with peroxidase-conjugated secondary antibody (1:5000) for 1 h at room temperature, followed by a final series of washes with PBS-T. Signals were detected with an enhanced chemiluminescence kit (Pierce) and developed on X-ray film (Kodak). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was detected as an internal control. Primary antibodies used in this study were anti-GR antibody (Santa Cruz; 1:125) and anti-GAPDH antibody (Cell signalling, Danvers, MA, USA; 1:1000).

Effect of knockdown of GRs on Leydig cell apoptosis induced by a high concentration of corticosterone

Leydig cells isolated from 90-day-old SD rats were plated in 6-well plates at a density of 1 × 10⁶cells/ml and divided into three groups: (1) control; (2) treatment with corticosterone and (3) infection with recombinant adenoviruses plus treatment with corticosterone. After incubation for 48 h at 34°C, recombinant adenoviruses were added into the third group with an MOI of 100. After 72 h, corticosterone was added to both the second and the third group to a final concentration of 200 nM. After treatment with corticosterone for 24 h, Leydig cells were harvested through digestion with 0.25% (w/v) trypsin and analysed for the frequency of apoptosis with FACS. The operational procedure was similar to that described above. The only difference was that Annexin-V-FITC was replaced with Annexin-V-APC.

Statistics

All experiments were repeated three times. Data were generally expressed as mean ± SD. Student's t-test and a one-way ANOVA were used for statistical comparisons. P < 0.05 was set as statistically significant.

Results

Serum corticosterone and testosterone concentration in stressed rats

Enzyme immunoassay was used to assay the effect of stress on the serum hormone concentration in rats. Serum corticosterone concentration in stressed rats (110 ± 5 ng/ml, n = 30) was increased significantly compared with that in the control rats (50 ± 3 ng/ml, n = 30; P < 0.01, Student's t-test); while the concentrations of serum testosterone were significantly lower in stressed rats (3.0 ± 0.1 vs. 5.8 ± 0.2 ng/ml, n = 30 in each group; P < 0.01, Student's t-test). These data indicated that the rat model of chronic stress was established successfully. In addition, the data show that stress can suppress the synthesis and secretion of testosterone by rat Leydig cells.

FACS analysis of apoptotic Leydig cells labelled with Annexin-V-FITC in stressed rats

PI and Annexin-V-FITC-labelled FACS assay was used to verify whether stress can induce apoptosis in rat Leydig cells. As shown in Figure 1, the frequency of apoptosis in Leydig cells in stressed rats (n = 3) was significantly greater than that in control rats (n = 3; P < 0.01, Student's t-test).

Figure 1.  FACS analysis of apoptotic Leydig cells labelled with Annexin-V-FITC in stressed and control rats. (A) Representative FACS data for Leydig cells from stressed and control rats. (B) Leydig cells were isolated from the testes of control and stressed rats. The apoptotic frequency of Leydig cells was determined through FACS analysis. The apoptotic frequency in the stress group was increased significantly compared with that of the control group. The asterisk (*) denoted a significant difference between the stress and the control groups (n = 3 rats, P < 0.01; Student's t-test).

TEM analysis of apoptotic Leydig cells in stressed rats

The ultrastructure of the testes of both control and stressed rats was observed by TEM to further explore whether stress can lead to apoptosis of rat Leydig cells. The ultrastructural analysis showed that Leydig cells of control rats had a normal morphology and structure (Figure 2A,B). Leydig cells in stressed rats were shrunken, with condensed nuclear chromatin gathering at the edge of nuclei. Mitochondria in the cytoplasm were swollen or had vacuolar degeneration, and there were many vesicles in the cytoplasm. Hence, the Leydig cells in stressed rats displayed some characteristics of early apoptosis (Figure 2C,D).

Figure 2.  Electron micrograph of apoptotic Leydig cells from control and stressed rats. The rats in the stress group were exposed to CUS, and the control group was undisturbed during the experiment. Testes from rats in both the stress group and the control group were removed, and the ultrastructure was observed by TEM. Leydig cells in the control group (A and B) had typical ultrastructural characteristics associated with this cell type: abundant smooth endoplasmic reticulum in the cytoplasm ( → ) and heterochromatin rimmed beneath the nuclear membrane. The Leydig cells in stressed rats displayed some morphological changes of early apoptosis. Cell shrinkage (star in C), condensation of nuclear chromatin (▴ in D), mitochondria swelling (* in D) and mitochondria vacuolar degeneration were found in Leydig cells from stressed rats (C and D). There were many vesicles (open triangle in D) in the cytoplasm of Leydig cells from stressed rats. Magnification: A and C, bar = 5000 nm; B, bar = 2000 nm; and D, bar = 1000 nm.

Serum corticosterone and testosterone concentrations and frequency of apoptotic Leydig cells in ADX rats subjected to CUS treatment

Two days after ADX, the serum corticosterone concentrations had declined to undetectable levels by contrast with the SHAM group (corticosterone: 51 ± 5 ng/ml). At the end of the 21-day CUS treatment (namely 24 days after ADX), the serum corticosterone concentrations of the ADX+stress group (28 ± 5 ng/ml) were also not increased significantly.

As shown in Figure 3, both the ADX group (n = 24) and the ADX+stress group (n = 24) had elevated serum testosterone concentrations in contrast to the SHAM group (n = 24; P < 0.05, one-way ANOVA). Serum testosterone concentration was not significantly different between the ADX group and ADX+stress group (P>0.05). The apoptotic frequency of Leydig cells was not significantly different among these three groups (P>0.05, one-way ANOVA).

Figure 3.  Serum testosterone concentration and the apoptotic frequency of Leydig cells in ADX rats subjected to CUS treatment. ADX+stress group: ADX and exposed to CUS for 21 days; SHAM group: sham surgery as a control. (A) Both the ADX group and ADX+stress group had elevated serum testosterone concentrations compared with the SHAM group. *P < 0.05, vs. SHAM, one-way ANOVA. Serum testosterone concentration was not significantly different between the ADX group and ADX+stress group (P>0.05). Values are mean ± SD (n = 24 in each group). (B) The apoptotic frequency of Leydig cells in these three groups was not significantly different from each other (P>0.05, one-way ANOVA). Values are shown as mean ± SD (n = 3 per group).

Immunofluorescent detection of translocation of GR in Leydig cells from stressed rats

Immunofluorescence laser confocal microscopy was used to assay the subcellular localisation of GR in Leydig cells. As shown in Figure 4, GR labelled with red fluorescence was seen only in the cytoplasm of Leydig cells in the control rats. By contrast, the red fluorescence appeared in the cytoplasm and in the nucleus of Leydig cells of stressed rats. The result indicated that some GRs moved from the cytoplasm to the nucleus in Leydig cells in response to stress. The data indicate that the activation of GR is involved in the stress-induced apoptosis of Leydig cells, consistent with the mediation of apoptosis in Leydig cells by glucocorticoid.

Figure 4.  Stress-induced nuclear translocation of GR in Leydig cells. Immunofluorescence laser confocal microscopy was used to determine the subcellular localisation of GR in Leydig cells in both control and stressed rats. The blue Hoechst stain defines the nuclear boundary. GR (red) was localised within the cytoplasm in Leydig cells of control rats, but were translocated to the nucleus in Leydig cells of rats exposed to chronic unpredictable stress (CUS) (stress). These data showed that CUS induced GR nuclear translocation in Leydig cells.

Knockdown of the GR expression in Leydig cells by adenovirus-mediated RNA interference and corticosterone-induced apoptosis

Leydig cells displayed green fluorescence after infection with recombinant adenovirus for 48 h, showing that the Leydig cells were infected with recombinant adenovirus efficiently. The rate of infection was ∼70%. To test the interference efficiency, Western blot analysis was used to examine GR expression. Figure 5 shows that after exposure to adenovirus for 72 h, GR expression in Leydig cells infected with miGR adenoviruses (i.e. containing microRNA against rat GR) was decreased compared with that in the Leydig cells infected with the control adenoviruses. These data indicated that the miGR adenovirus can knockdown GR expression in Leydig cells.

Figure 5.  Knockdown in vitro of GR expression by adenovirus-mediated RNA interference. Cultured Leydig cells were infected with miGR adenovirus (expressing miRNAs targeting the rat GR gene) or control adenovirus for 72 h (MOI = 100). Intact Leydig cells served as the blank control. Total protein samples (20 μg) were electrophoresed in 8% polyacrylamide gel and transferred to a nitrocellulose membrane. The protein of interest was detected by antibody against GR, and the luminescent signal was detected by exposing the membrane to an X-ray film. GAPDH was used as the internal control for normalisation.

PI and Annexin-V-APC-labelled FACS assay was used to test whether GR knockdown in Leydig cells could decrease the frequency of apoptosis induced by a high dose of corticosterone. Figure 6 shows that the apoptotic frequency in Leydig cells incubated with corticosterone after miGR adenovirus infection (n = 6) was significantly decreased compared with that of the cells treated with corticosterone alone (n = 6; P < 0.01, one-way ANOVA). This result shows that downregulation of GR expression can reduce the effect of a high concentration of corticosterone on inducing apoptosis in Leydig cells.

Figure 6.  FACS analysis of Annexin-V-APC labelling of apoptotic Leydig cells with knockdown of GR expression. (A) Representative FACS data for Leydig cells treated with or without miGR adenovirus (Ad) infection. Leydig cells with or without miGR adenovirus infection were incubated with 200 nM corticosterone for 24 h at 34°C. Leydig cells treated with the vehicle served as the control. Leydig cells were analysed by FACS with Annexin-V-APC/PI double staining. (B) Leydig cells treated with corticosterone alone (CORT group) showed an increased apoptotic frequency compared with that of the control. *P < 0.01, vs. Control, one-way ANOVA. Leydig cells treated with corticosterone after infection with miGR adenovirus (CORT+Ad group) showed a decreased apoptotic frequency compared with cells treated with corticosterone alone (CORT group). **P < 0.01, vs. CORT group, one-way ANOVA. Values are mean ± SD (n = 6).

Discussion

It is known that stress affects reproduction (Orr et al. 1994; Fenster et al. 1997). One of the causes of stress-derived dysfunction in reproduction in males appears to be the decrease in Leydig cell steroidogenesis (Monder et al. 1994a; Marić et al. 1996; Hardy and Ganjam 1997; Hardy et al. 2002). In recent years, there has been a series of studies on the effect of stress or glucocorticoid, the principal stress hormone, on the function of Leydig cells. Clinical and experimental studies have shown adverse effects of excessive glucocorticoid on testicular testosterone production. A number of mechanisms, mainly focused on excessive glucocorticoid-induced inhibition of expression and activity of the enzymes concerned with testosterone biosynthesis in Leydig cells, have been put forward to explain the suppression of testosterone secretion during stress (Welsh et al. 1982; Payne and Sha 1991; Orr et al. 1994). The results of these studies suggest that stress is able to reduce the concentration of testosterone in the body through interrupting the ability of individual Leydig cells to synthesise testosterone. However, two factors can be considered that could result in stress reducing testosterone secretion in male mammals by acting on Leydig cells. One is the ability of a single Leydig cell to synthesise testosterone, and the other is the number of Leydig cells. Our previous studies showed that exposure to stress levels of exogenous glucocorticoid indeed induces Leydig cell apoptosis in vivo and in vitro (Gao et al. 2002, 2003; Chai et al. 2008), but our present experiments, which reflect endocrine changes in the body under stress conditions, demonstrated that a stress-induced increase in endogenous glucocorticoid level can also cause Leydig cell apoptosis.

To observe whether stress-induced increases in glucocorticoid concentrations can cause rat Leydig cell apoptosis, it is crucial to establish a reliable rat stress model. The intensity and duration of exposure to stressor are two key facts involved in the establishment of this model. Methods that have been used to establish a rat model of chronic stress include the following: immobilisation (Wright et al. 2006), constant illumination (Willner et al. 1987, 1996; Papp et al. 2002; Gouirand and Matuszewich 2005), cold stress (housing in a room at 4°C; Finlay et al. 1995; Sahin and Gümüşlü 2007) or forced swimming in cold water (Bidzinska et al. 1993), intermittent electric shocks (Retana-Márquez et al. 2003), crowding and social stress (Mormède et al. 1990; Monder et al. 1994b; Blanchard et al. 1995, 2001), noise (Manikandan et al. 2005; Atkinson et al. 2006; Samson et al. 2007; Chen et al. 2008), fasting (De Boer et al. 1989) and surgery (Gray et al. 1978). To avoid habituation to stress occurring in experimental rats, the CUS rat model was established as described in the Methods, involving exposure of rats to two different stressors per day (immobilisation, forced swimming or moving to a cold room). A significantly increased serum corticosterone concentration was measured in our rat model. These data were consistent with those reported by others (Retana-Márquez et al. 2003; Mravec et al. 2008); hence, a successful-repeated stress model was established. FACS and TEM analysis showed that the CUS procedure induced rat Leydig cell apoptosis, thereby resulting in decreased testosterone secretion.

Previous studies from our laboratory showed that a large dose of corticosterone induces Leydig cell apoptosis in ADX rats and cultured rat primary Leydig cells, resulting in decreased testosterone production (Gao et al. 2003). Here, we subjected ADX rats to CUS and found that stress did not decrease serum testosterone in ADX rats. As the ADX rats were given a low maintenance dose of corticosterone, this result indicated that stress cannot induce Leydig cell apoptosis in the absence of stress levels of endogenous corticosterone. In our experiment, the serum corticosterone concentrations of ADX rats were undetectable 2 days after ADX, and were not increased significantly at the end of CUS treatment, confirming complete bilateral adrenalectomy, nor did adrenal regeneration occur during the experiments, as confirmed by autopsy and measurement of serum corticosterone. The body weight of ADX rats was not statistically less than the sham-operated controls during the stress protocol, indicating maintenance of good health.

The inhibition of Leydig cell steroidogenesis by high concentration of glucocorticoid is mediated by GR (Hales and Payne 1989), which is expressed in immature and adult Leydig cells (Ge et al. 1997). Unliganded GR is localised predominantly within the cytoplasm, but it translocates rapidly to the nucleus following hormone binding and exerts effects through increasing or decreasing the expression of the target genes. In our study, immunofluorescence analysis with laser confocal microscopy showed that GR was clearly translocated into the nucleus in Leydig cells of stressed rats, and was involved in the expression of apoptosis-associated gene, which could result in programmed death of Leydig cells. Here, we did not seek changes in GR mRNA or GR protein level in Leydig cells of stressed and control rats, but this will be studied in future experiments.

To evaluate whether Leydig cell apoptosis in stressed rats is mediated by corticosterone at the molecular level, the expression of GR in Leydig cells was knocked down. A decreased frequency of apoptosis in Leydig cell was found following down-regulated GR expression. Overall, the data above demonstrate that stress-induced Leydig cell apoptosis in rats is mediated by corticosterone actions via GR in these cells.

Stress is a common problem in human society, and the frequency of stress-induced diseases affecting the male reproductive system is increasing. How to prevent the impairment of reproductive health has become a new challenge. Our findings might provide new insight into the relationship between environment and the reproductive health of men.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (grant numbers 30570681, 214503 and 31000662). Technical assistance by Mr Qiang-Su Guo, from the Department of Histology and Embryology, and the staff from the Department of Cell Biology at Shanghai Jiao Tong University School of Medicine are greatly appreciated.

Declaration of interest: The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.