Glucocorticoids retard skeletal muscle development and myoblast protein synthesis through a mechanistic target of rapamycin (mTOR)-signaling pathway in broilers (Gallus gallus domesticus)

Abstract

Glucocorticoids exert a well-known catabolic protein action on skeletal muscle. The mechanistic target of rapamycin (mTOR) signaling pathway acts as a central regulator of protein metabolism. Whether glucocorticoids regulate protein synthesis through the mTOR pathway in skeletal muscle of chickens remains unknown. This study was performed to characterize the effect of glucocorticoids on the mTOR pathway in skeletal muscle development in chickens, and on protein synthesis in cultured embryonic myoblasts. Male 29-d-old chickens were given a dexamethasone injection (2 mg/kg) twice per day for 4 d (n = 16). Chicken embryonic myoblasts were exposed to dexamethasone for 24 h (100 µmol/L, n = 4 cultures). The interaction between dexamethasone and leucine was also investigated. ANOVA and Duncan’s multiple test were used to analyze the effects of the dexamethasone and leucine treatments. The results showed that dexamethasone decreased body weight gain, body weight, and feed efficiency. Protein synthesis was inhibited by in vitro dexamethasone exposure. Phosphorylation of mTOR and ribosomal protein S6 protein kinase (p70S6K) were inhibited by dexamethasone, suggesting the mTOR pathway may be involved in dexamethasone-regulated muscle protein synthesis. Phosphorylation of AMP-activated protein kinase (AMPK) was not altered in vitro but was reduced in vivo by dexamethasone. These results imply that the mTOR and AMPK pathways are both involved in retarding muscle development and protein synthesis by glucocorticoids, but the mTOR pathway is a critical point linking glucocorticoid and protein synthesis. Leucine, at least partially, inhibited the effects of dexamethasone on protein synthesis via the mTOR pathway.

• Chickens
• dexamethasone
• leucine
• muscle development
• protein metabolism
• signal pathway

Introduction

Stress is a common problem diminishing the quality and the quantity of meat in either wild birds or domestic chickens. Glucocorticoids, as the final effectors of the hypothalamic–pituitary–adrenal axis, participate in the arousal of stress responses and trigger physiological adjustments that shift energy away from growth toward survival (Matteri et al., 2000; Post et al., 2003). In skeletal muscle, a major store of protein, glucocorticoids elicit a variety of biological actions on protein metabolism and muscle development and contribute to whole-body metabolic homeostasis (Munck et al., 1984). In rats, muscle protein synthesis is inhibited after glucocorticoid administration (Southorn et al., 1990); the injection of dexamethasone, a synthetic glucocorticoid, acutely diminishes protein synthesis rates in skeletal muscle (Shah et al., 2000a). The inhibition of mRNA translation initiation appears to be a major site for glucocorticoid inhibition of protein synthesis (Rannels et al., 1980). Similarly, glucocorticoids impede the development of skeletal muscle in chickens (Dong et al., 2007; Lin et al., 2004a) by suppressing protein synthesis and increasing protein catabolism (Dong et al., 2007). This decline in protein synthesis is paralleled by increases in plasma insulin and glucose concentrations, which is consistent with a general increase in insulin resistance. Broiler chickens of modern strains have a fast muscle growth rate (Halevy et al., 2000) and a more refractory insulin cascade in skeletal muscle tissues (Dupont et al., 2004, 2008). These characteristics suggest that the study of this chicken model would be beneficial to understanding regulation of muscle protein synthesis.

The mechanistic target of rapamycin (mTOR) signaling pathway has emerged as a central mediator of metabolism and growth, and it acts as a central regulator of protein metabolism (Deng et al., 2009; Dennis et al., 1999; Yao et al., 2008), ribosome biogenesis (Mayer & Grummt, 2006), and cell proliferation (Yang & Yin, 2012) by sensing and integrating signals from hormonal factors, environmental stress factors, nutrient availability, and energy status. In a study with mammals, Wang et al. (2006) showed that glucocorticoids inhibit mTOR signaling in muscle cells. Moreover, mTOR activation inhibits glucocorticoid receptor (GR) transcription function and efficiently counteracts the catabolic processes in muscle provoked by glucocorticoids (Shimizu et al., 2011).

Glucocorticoids can lead to redistribution of energy. AMP-activated protein kinase (AMPK) responds to energy stress by suppressing cell growth and biosynthetic processes, in part through its inhibition of the mTORC1 pathway (Kimball & Jefferson, 2006). AMPK can adjust ribosomal protein S6 protein kinase (p70S6k) activation to cellular energy requirement (Kimura et al., 2003). These results indicate that the AMPK and mTOR signalling pathways may be associated.

Several studies have examined effects of the availability of amino acids (AA), especially branched-chain amino acids (BCAA), on mTOR signaling and protein metabolism (Kimball & Jefferson, 2006). Leucine can stimulate the phosphorylation of S6K1 and eukaryotic initiation factor 4E binding protein1 (4EBP1) (Kimball et al., 1999; Kong et al., 2014), and increase tissue protein synthesis (Li et al., 2011; Yin et al., 2010). Shimizu et al. (2011) reported that glucocorticoids inhibit mTOR activity via a distinct mechanism involving branched-chain amino acid transaminase 2 (BCAT2) gene activation.

In our previous study using a chicken model, glucocorticoids were found to retard muscle development (Dong et al., 2007; Lin et al., 2004a) and suppress protein synthesis (Dong et al., 2007); The mTOR and AMPK pathways were reported to play important roles in energy (lipids) redistribution induced by glucocorticoids (Wang et al., 2012a,b,c). Thus, we hypothesized that these signaling pathways are involved in the dysregulation of muscular protein metabolism and muscle development during stress perturbations in chickens. In this study, we examined whether glucocorticoids inhibit protein synthesis via the mTOR and AMPK signaling pathway, and studied the involvement of AAs using fast-growing broiler chickens with high muscle yield and feed efficiency as a model for muscle development (Halevy et al., 2000). The results indicated that the mTOR pathway is likely involved in dexamethasone-suppressed protein synthesis, and that leucine can diminish the effects of dexamethasone on protein synthesis by stimulating the mTOR pathway. These findings reveal molecular mechanisms underlying the physiological responses in muscle to stress perturbations in chickens, and provide a novel nutritional strategy to ameliorate stress effects. Furthermore, the study provides a perspective from an animal model on the metabolic perturbations associated with long-term glucocorticoid use and dietary therapy in a clinical setting.

Methods

Ethics statement

All animal experiments were reviewed and approved by the Institutional Animal Care and Use Committee of Shandong Agricultural University and were performed in accordance with the “Guidelines for Experimental Animals” of the Ministry of Science and Technology (Beijing, PR China). Animal suffering was minimized.

Animals and in vivo treatment

Male broiler chicks (Arbor Acres, Gallus gallus domesticus) were obtained from a local hatchery (37.8 °C temperature and 55% relative humidity for the first 19 d, and 37.2 °C temperature and 65% relative humidity during days 20–21) at 1 d of age and reared in an environmentally controlled room. The brooding temperature was maintained at 35 °C (65% relative humidity) for the first 2 d, reduced gradually to 21 °C (45% relative humidity) until 28 d, and maintained at 21 °C until the end of the experiment (33 d). The light regime was 23 h light: 1 h dark. All chickens received a starter diet with 21.5% crude protein and 12.37 MJ/kg of metabolisable energy until 21 d, after which they received a grower diet with 19.5% crude protein and 12.90 MJ/kg of metabolisable energy (Zhao et al., 2009). All the birds had free access to feed and water during the rearing period.

Male broilers with similar body mass (BM) were assigned randomly into 16 pens of 10 birds each (160 birds in total). Beginning at 29 d of age, eight pens of chickens were provided supplementation with 1.0% l-leucine to the basal diet, while the other eight pens were provided with 0.68% l-alanine (isonitrogenous control) to the basal diet. Half of the chickens (four pens) from each diet treatment were randomly exposed to a subcutaneous injection of dexamethasone (2 mg/kg BM per day, twice per day, Lukang Cisen Pharmaceutical Corp., Shandong, PR China), while the other four pens were sham-treated with vehicle (0.9% saline) (Figure 1). The experiment lasted for 4 d. BM and feed intake were recorded daily.

Figure 1. Schematic diagrams of experimental design. DEX, dexamethasone; LEU, leucine.

At 33 d of age, half of the chickens from each treatment were sampled in a fasting state, after 12 h of feed withdrawal (the fasting period was 20:00 h–08:00 h); the other half was sampled in a feeding state after 3 h of re-feeding (the re-feeding period was 08:00 h–11:00 h). A blood sample was drawn from a wing vein using a heparinized syringe within 30 s, and samples were collected in iced tubes. Heparin sodium (Lukang Cisen Pharmaceutical Corp., Shandong, PR China) was used as an anticoagulant. Plasma was obtained after centrifugation at 400 g for 10 min at 4 °C and was stored at −20 °C for further analysis. Immediately after the blood sample was obtained, chickens were killed by cervical dislocation, following exsanguination (Close et al., 1997). The breast and thigh muscles were harvested and weighed, and a 1–2 g sample of breast tissue obtained from the left M. pectoralis major (PM) was frozen in liquid nitrogen and stored at −70 °C for further analysis.

Myoblast culture and in vitro treatments

Primary cultures of chicken fetal myoblasts were prepared using a modified version of the method described by Yablonka-Reuveni and Nameroff (1987). In brief, fertilized eggs were purchased from a commercial source and incubated at 37.5 °C under 60–70% relative humidity until fetal myoblasts were isolated from the excised breast muscles of 15-d-old embryos. After three consecutive washes with fresh Hank's solution, the muscle samples were minced and digested with 0.1% protease from Streptomyces griseus (Sigma, St. Louis, MO) in Dulbecco’s modified Eagle medium (DMEM, Hyclone, Logan, UT) at 37 °C for 40 min. The cell suspension was filtered and centrifuged twice at 800 g. Cell pellets were resuspended and single myoblasts were further enriched by density centrifugation with Percoll (Sigma, St. Louis, MO). Myoblasts were seeded on 35-mm collagen-coated dishes (Iwaki, Tokyo, Japan) at a density of 2 × 10⁶ cells/dish with DMEM containing 10% fetal bovine serum (Gibco, Paisley, UK), 100 U/mL penicillin, and 100 µg/mL streptomycin (Solarbio, Shanghai, PR China). The culture was maintained for 4 d at 37 °C in a humidified atmosphere containing 5% CO₂.

After a 12-h incubation in serum-free medium, myoblasts were exposed to DMEM-LM with or without dexamethasone (100 µmol/L) for 24 h. Leucine (Sigma, St. Louis, MO) was added to dexamethasone-treated cells at a concentration of 5, 10, or 15 mmol/L for 1 h. Following this, all cells were subjected to a 30-min puromycin exposure (1 µmol/L, Sigma, St. Louis, MO) for the detection of protein synthesis using an anti-puromycin antibody.

Measurements

Plasma parameters

Plasma concentrations of glucose and urate were measured spectrophotometrically with commercial diagnostic kits (Hitachi High-Technologies Corp., Tokyo, Japan). The detection limits were 3.89 mmol/L for the glucose assay and 150 µmol/L for the urate assay.

Plasma insulin was measured by radioimmunoassay with guinea pig anti-porcine insulin serum (3 V Bio-engineering Group Corp., Shandong, PR China). ¹²⁵I-labeled porcine insulin competes with chicken insulin for sites on the insulin-porcine antibody immobilized to the wall of a polypropylene tube. The insulin in this study is referred to as immunoreactive insulin. The sensitivity of the assay was 1 μIU/mL, and all samples were included in the same assay to avoid inter-assay variability. The intra-assay coefficient of variation was 6.9%.

Protein synthesis

To measure muscle protein synthesis, we used a technique involving the labelling of newly synthesized polypeptides with low concentrations of puromycin, then the detection of these proteins using an anti-puromycin antibody (Schmidt et al., 2009). After dexamethasone and leucine administration, 1 µmol/L puromycin was added to all wells, and the cells were incubated for an additional 30 min. Cells were then collected and subjected to Western blotting analysis using an anti-puromycin antibody as described below. The accumulation of puromycin-conjugated peptides into nascent peptide chains reflects the rate of protein synthesis in many different in vitro and in vivo conditions (Goodman et al., 2011; Nakano & Hara, 1979; Schmidt et al., 2009).

Protein preparation and Western blotting

Muscle and myoblast samples were homogenized on ice in radioimmunoprecipitation assay (RIPA) buffer (50 mmol/L Tris-HCl at pH 7.4, 1% nonyl phenoxypolyethoxylethanol-40 (NP-40), 0.25% sodium deoxycholate, 150 mmol/L NaCl, 1 mmol/L EDTA, 1 mmol/L phenylmethylsulfonyl fluoride, 1 μg/mL aprotinin, 1 μg/mL leupeptin, 1 μg/mL pepstatin, 1 mmol/L sodium orthovanadate, and 1 mmol/L sodium fluoride) and centrifuged at 12,000 g for 5 min at 4 °C. Protein concentration was determined using a bicinchoninic acid (BCA) assay kit (Beyotime, Jiangsu, PR China). Samples were boiled at 100 °C for 5 min in 1 × sample buffer. Protein extracts (80 μg) were electrophoresed in 7.5–10% SDS polyacrylamide gels (Bio-Rad, Richmond, CA) according to the Laemmli (1970) method. Separated proteins were then transferred onto a nitrocellulose membrane in Tris-glycine buffer containing 20% methanol. Membranes were blocked and immunoblotted with a 1:1000 dilution of a primary antibody including anti-puromycin, anti-p-mTOR (Ser2448), anti-mTOR, anti-p-p70S6K (Thr389), anti-p70S6K, anti-p-AMPK (Thr172), anti-AMPK, anti-p-Akt (Ser473) and anti-Akt. The antibodies for p-mTOR (Ser2448), mTOR, p-p70S6K (Thr389), p70S6K, p-AMPK (Thr172), and AMPK were purchased from Cell Signalling Technology (Beverly, MA) and were previously validated for use with chicken samples (Aoki et al., 2001; Duchêne et al., 2008; Proszkowiec-Weglarz et al., 2006). The puromycin antibody was purchased from keraFAST (Kerafast, Inc., Boston, MA), and the p-Akt (Ser473) and Akt antibodies were purchased from Beyotime (Jiangsu, PR China).

Protein was detected using either a goat anti-rabbit IgG (H + L)-HRP conjugated secondary antibody (1:2000, Bio-Rad, Richmond, CA) or a HRP-labelled goat anti-mouse IgG (H + L) secondary antibody (1:1000, Beyotime, Jiangsu, PR China) with enhanced chemiluminescence (ECL) plus western blot detection reagents (Beyotime, Jiangsu, PR China). β-Actin was used as an internal control (Beyotime, Jiangsu, PR China). Western blots were developed and quantified using BioSpectrum 810 with VisionWorksLS 7.1 software (UVP LLC, Upland, CA).

RNA preparation and analysis

mRNA expression was measured using real-time reverse transcription polymerase chain reaction (RT-PCR). Briefly, total RNA from PM muscle was extracted using TRIzol (Invitrogen, San Diego, CA). The quantity and the quality of the isolated RNA were determined with a biophotometer (Eppendorf, Hamburg, Germany) and agarose gel electrophoresis. Reverse transcription was performed in RT reactions (10 mL) consisting of 500 ng total RNA, 5 mmol/L MgCl₂, 1 mL RT buffer, 1 mmol/L dNTP, 2.5 U reverse transcriptase from avian myeloblastosis virus, 0.7 nmol/L oligo d(T), and 10 U ribonuclease inhibitor (TaKaRa, Dalian, PR China). cDNA was amplified in a 20 mL PCR containing 0.2 mmol/L of each primer (Sangon, Shanghai, PR China) and SYBR green master mix (TaKaRa, Dalian, PR China). Real-time PCR was performed at 95 °C for 10 s of predenaturation, followed by 40 cycles consisting of denaturation at 95 °C for 5 s and annealing and extension at 60 °C for 40 s. All samples were included in the same assay for one gene to avoid inter-assay variability. Primer for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was amplified and used as an internal control to normalize for the differences in individual samples. GAPDH was previously validated for use as housekeeping gene under the same experimental conditions as the present study (Wang et al., 2012a,b,c). The primer sequences for chicken mTOR, p70S6K, 4EBP1, Akt1, AMPKα2, and GAPDH are listed in Table 1. The PCR products were verified by electrophoresis on a 0.8% agarose gel and by DNA sequencing. Standard curves were generated using pooled cDNA from the samples being assayed, and the comparative cycle threshold method (2^−ΔΔCT) was used to quantify mRNA expression in accordance with the method of Livak and Schmittgen (2001). All samples were run in duplicate, and primers were designed to span an intron to avoid genomic DNA contamination.

Table 1. Gene-specific primers of related genes.

Gene name	Genbank number	Primer position	Primer sequences (5′→3′)	Product size (bp)
mTOR	XM_417614	Forward	gaagtcctgcgcgagcataag	92
		Reverse	tttgtgtccatcagcctccagt
p70S6K	NM_001030721.1	Forward	attcgatcacctcgcagattcatag	111
		Reverse	agtatttgatgcgctggcagaag
4EBP1	XM_424384	Forward	ttcccaccagccaggcttac	142
		Reverse	gtgtattcacacccacacggaga
Akt1	NM_205055.1	Forward	cattcccgccattatgaatgaagta	130
		Reverse	cttgtagccaatgaatgtgccatc
AMPKα2	NM_001039605.1	Forward	gggacctgaaaccagagaacg	215
		Reverse	acagaggagggcatagaggatg
GAPDH	NM_204305	Forward	ctacacacggacacttcaag	244
		Reverse	acaaacatgggggcatcag

AMPKα2, AMP-activated protein kinase α2; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; mTOR, mechanistic target of rapamycin; p70S6K, ribosomal protein S6 protein kinase; 4EBP1, eukaryotic initiation factor 4E-binding protein1.

Statistical analysis

A two-way ANOVA model was used to analyze the primary effects of the dexamethasone and leucine treatments and their interaction on growth performance, muscle development, and plasma parameters. All other data collected were subjected to a one-way ANOVA analysis, using the Statistical Analysis Systems statistical software package (Version 8 e, SAS Institute, Cary, NC). The homogeneity of variances among groups was confirmed using Bartlett’s test (SAS Institute, Cary, NC). When the primary effect of a treatment was significant, the differences between means were assessed using Duncan’s multiple range analysis. Means were considered significantly different at p < 0.05.

Results

In vivo experiments

Compared with the control, BM (p < 0.001, F(3,12) = 32.39), BM gain (p < 0.001, F(3,11) = 227.92), and feed efficiency (g BM gain per g feed intake, p < 0.001, F(3,11) = 39.76) of the broiler chickens were significantly decreased by dexamethasone treatment, while feed intake did not change significantly with dexamethasone treatment (p > 0.05). There was no significant effect on growth performance of broiler chickens with the dietary treatment (p > 0.05) (Table 2).

Table 2. The effect of dexamethasone (2 mg/kg body mass) and dietary treatments on the growth performance of broiler chickens.

Item	Treat	LEU	ALA	Mean	p value
BM (g)	DEX	1445 ± 20.0	1434 ± 10.9	1440	<0.001 (DEX)
	Control	1636 ± 30.5	1628 ± 8.67	1632	0.63 (AA)
	Mean	1540	1531		0.96 (DEX × AA)
BM gain (g/d)	DEX	−17.2 ± 2.96	−18.3 ± 3.43	−17.8^b	<0.001 (DEX)
	Control	62.5 ± 2.82	66.0 ± 3.10	64.3^a	0.71 (AA)
	Mean	28.4	23.9		0.48 (DEX × AA)
Feed intake (g/d)	DEX	131.0 ± 10.8	119.8 ± 2.76	125.4	0.076 (DEX)
	Control	133.5 ± 4.20	140.9 ± 2.65	137.2	0.76 (AA)
	Mean	132.3	130.3		0.15 (DEX × AA)
Feed:gain (g/g)	DEX	−7.49 ± 1.44	−7.22 ± 1.24	−7.33^b	<0.001 (DEX)
	Control	2.14 ± 0.05	2.14 ± 0.07	2.14^a	0.89 (AA)
	mean	−1.99	−2.54		0.88 (DEX × AA)

Values are mean ± SEM (n = 4). ^a,bMeans with different letters differ significantly (p < 0.05), by ANOVA and Duncan’s multiple test. AA, amino acid; ALA, alanine; BM, body mass; DEX, dexamethasone; LEU, leucine.

The breast (p < 0.001, F(3,60) = 19.51) and thigh muscle masses (p < 0.001, F(3,60) = 4.89) were significantly lower in the dexamethasone-treated chickens compared with the control chickens. Dexamethasone significantly increased the thigh yield (p < 0.05, F(3,59) = 1.97) but had no effect on breast yield (p > 0.05). In contrast, the leucine treatment significantly increased the breast yield (p < 0.05, F(3,60) = 3.24). There was an interaction between dexamethasone and leucine diet on breast mass (Table 3).

Table 3. The effect of dexamethasone (2 mg/kg body mass) and dietary treatments on skeletal muscle growth in broiler chickens.

Item	Treat	LEU	ALA	Mean	p value
Breast muscle mass (g)	DEX	128.3 ± 2.69	117.5 ± 2.86	122.9^b	<0.001 (DEX)
	Control	142.7 ± 2.12	143.6 ± 3.49	143.1^a	0.085 (AA)
	Mean	135.5	130.5		0.042 (DEX × AA)
Thigh muscle mass (g)	DEX	100.7 ± 2.28	101.6 ± 3.08	101.2^b	<0.001 (DEX)
	Control	111.6 ± 2.31	110.9 ± 2.82	111.2^a	0.98 (AA)
	Mean	106.2	106.2		0.75 (DEX × AA)
Breast yield (% BM)	DEX	18.4 ± 0.39	17.0 ± 0.32	17.7	0.38 (DEX)
	Control	18.1 ± 0.25	18.0 ± 0.36	18.0	0.023 (AA)
	mean	18.3^m	17.5^n		0.066 (DEX × AA)
Thigh yield (% BM)	DEX	14.5 ± 0.30	14.7 ± 0.38	14.6^a	0.025 (DEX)
	Control	14.0 ± 0.21	13.8 ± 0.25	13.9^b	0.83 (AA)
	mean	14.2	14.3		0.49 (DEX × AA)

Values are mean ± SEM (n = 16). ^a,b,m,nMeans with different letters differ significantly (p < 0.05), by ANOVA and Duncan’s multiple test. AA, amino acid; ALA, alanine; BM, body mass; DEX, dexamethasone; LEU, leucine.

In the fasting state, dexamethasone treatment significantly increased plasma concentrations of glucose (p < 0.001, F(3,42) = 15.19), urate (p < 0.001, F(3,40) = 15.49), and insulin (p < 0.001, F(3,27) = 7.25) compared with the control treatment. The plasma concentration of glucose (p < 0.05, F(3,42) = 15.19) was significantly lower in the leucine diet groups compared with the alanine diet groups. There was an interaction between dexamethasone and leucine diet on plasma glucose concentration (Table 4). In the re-feeding state, the plasma concentrations of glucose (p < 0.001, F(3,38) = 5.28), urate (p < 0.01, F(3,42) = 3.6), and insulin (p < 0.05, F(3,27) = 1.92) were significantly higher with the dexamethasone treatment compared with the control group (Table 5).

Table 4. The effect of dexamethasone (2 mg/kg body mass) and dietary treatments on plasma concentrations of glucose, urate, and insulin in broiler chickens in the fasting state.

Item	Treat	LEU	ALA	Mean	p value
Glucose (mmol/L)	DEX	14.7 ± 0.37	14.3 ± 0.72	14.5^a	<0.001 (DEX)
	Control	10.4 ± 0.49	13.1 ± 0.39	11.8^b	0.027 (AA)
	Mean	12.5^n	13.7^m		0.003 (DEX × AA)
Urate (µmol/L)	DEX	512.1 ± 45.2	539.2 ± 69.2	525.6^a	<0.001 (DEX)
	Control	218.6 ± 25.2	229.5 ± 19.2	223.6^b	0.67 (AA)
	Mean	359.0	391.7		0.86 (DEX × AA)
Insulin (µIU/mL)	DEX	13.1 ± 2.42	10.4 ± 1.90	11.8^a	<0.001 (DEX)
	Control	4.38 ± 0.70	4.34 ± 0.44	4.36^b	0.41 (AA)
	mean	9.04	7.37		0.42 (DEX × AA)

Values are mean ± SEM (n = 12). ^a,b,m,nMeans with different letters differ significantly (p < 0.05), by ANOVA and Duncan’s multiple test. AA, amino acid; ALA, alanine; DEX, dexamethasone; LEU, leucine.

Table 5. The effect of dexamethasone (2 mg/kg body mass) and dietary treatments on plasma concentrations of glucose, urate, and insulin in broiler chickens in the re-feeding state.

Item	Treat	LEU	ALA	Mean	p value
Glucose (mmol/L)	DEX	15.7 ± 0.86	17.3 ± 0.93	16.5^a	<0.001 (DEX)
	Control	14.1 ± 0.16	14.3 ± 0.33	14.2^b	0.19 (AA)
	Mean	14.9	15.7		0.29 (DEX × AA)
Urate (µmol/L)	DEX	785.1 ± 65.9	803.6 ± 78.7	794.7^a	0.004 (DEX)
	Control	547.5 ± 47.7	658.3 ± 50.9	605.3^b	0.31 (AA)
	Mean	666.3	730.9		0.46 (DEX × AA)
Insulin (µIU/mL)	DEX	18.6 ± 2.59	21.1 ± 3.02	19.9^a	0.035 (DEX)
	Control	15.2 ± 1.79	13.9 ± 1.77	14.5^b	0.79 (AA)
	Mean	17.0	17.5		0.43 (DEX × AA)

Values are mean ± SEM (n = 12). ^a,bMeans with different letters differ significantly (p < 0.05), by ANOVA and Duncan’s multiple test. AA, amino acid; ALA, alanine; DEX, dexamethasone; LEU, leucine.

In the fasting state (Figure 2), mRNA levels of mTOR (p < 0.01, F(3,18) = 7.86) and 4EBP1 (p < 0.01, F(3,19) = 8.17) were significantly increased, while mRNA level of AMPKα2 (p < 0.001, F(3,18) = 23.51) was significantly decreased by the dexamethasone treatment in the two dietary groups. Akt1 mRNA was increased only in the alanine-fed chickens (p < 0.05, F(3,18) = 4.27). In the re-feeding state (Figure 3), dexamethasone and diet had no significant effects on gene expression for mTOR, Akt1, and AMPKα2; however, p70S6K (p < 0.01, F(3,20) = 6.17) and 4EBP1 (p < 0.01, F(3,20) = 7.01) mRNAs were significantly elevated by dexamethasone on the two diets.

Figure 2. The effect of dexamethasone (daily subcutaneous injection of 2 mg/kg body mass for 4 days) and dietary leucine supplement (1%) on the mRNA expression of mTOR, p70S6K, 4EBP1, Akt1, and AMPKα2 in PM of broiler chickens in the fasting state. The values shown are mean ± SEM (n = 6); ^a,bmeans with different letters are significantly different (p < 0.05), by ANOVA and Duncan’s multiple test. AMPKα2, AMP-activated protein kinase α2; DEX, dexamethasone; LEU, leucine; mTOR, mechanistic target of rapamycin; PM, M. pectoralis major; p70S6K, ribosomal protein S6 protein kinase; 4EBP1, eukaryotic initiation factor 4E binding protein1.

Figure 3. The effect of dexamethasone (daily subcutaneous injection of 2 mg/kg body mass for 4 d) and dietary leucine supplement (1%) on the mRNA expression of mTOR, p70S6K, 4EBP1, Akt1, and AMPKα2 in PM of broiler chickens in the re-feeding state. The values shown are mean ± SEM (n = 6); ^a,b,cmeans with different letters are significantly different (p < 0.05), by ANOVA and Duncan’s multiple test. AMPKα2, AMP-activated protein kinase α2; DEX, dexamethasone; LEU, leucine; mTOR, mechanistic target of rapamycin; PM, M. pectoralis major; p70S6K, ribosomal protein S6 protein kinase; 4EBP1, eukaryotic initiation factor 4E binding protein1.

In the fasting state for the alanine-fed chickens, the phosphorylation of mTOR, p70S6K, Akt, and AMPK was not affected (p > 0.05) by the dexamethasone treatment. For leucine-fed chickens, compared with the leucine treatment alone, dexamethasone + leucine significantly inhibited the phosphorylation of mTOR (p < 0.01, F(1,8) = 13.46) and p70S6K (p < 0.05, F(1,6) = 7.58), but showed no effect on Akt or AMPK (p > 0.05, Figure 4).

Figure 4. The effect of dexamethasone (daily subcutaneous injection of 2 mg/kg body mass for 4 d) and dietary leucine supplement (1%) on the phosphorylation of mTOR, p70S6K, Akt, and AMPK in PM of broiler chickens in the fasting state. The values shown are mean ± SEM (n = 6); ^a,bmeans with different letters are significantly different (p < 0.05); *p < 0.05 and **p < 0.01, by ANOVA and Duncan’s multiple test. AMPK, AMP-activated protein kinase; DEX, dexamethasone; LEU, leucine; mTOR, mechanistic target of rapamycin; PM, M. pectoralis major; p70S6K, ribosomal protein S6 protein kinase.

In the re-feeding state for the alanine-fed chickens, dexamethasone significantly retarded the phosphorylation of mTOR (p < 0.05, F(1,11) = 7.24), p70S6K (p < 0.05, F(1,8) = 6.27), Akt (p < 0.01, F(1,5) = 24.95), and AMPK (p < 0.01, F(1,5) = 17.65) compared with control. Compared with the dexamethasone groups, the phosphorylation of mTOR (p < 0.001, F(1,11) = 80.62), p70S6K (p < 0.01, F(1,9) = 11.11) and Akt (p < 0.001, F(1,5) = 24274) in chickens treated with dexamethasone + leucine was increased (Figure 5).

Figure 5. The effect of dexamethasone (daily subcutaneous injection of 2 mg/kg body mass for 4 d) and dietary leucine supplement (1%) on the phosphorylation of mTOR, p70S6K, Akt, and AMPK in PM of broiler chickens in the re-feeding state. The values shown are mean ± SEM (n = 6); ^a,b,cmeans with different letters are significantly different (p < 0.05); *p < 0.05 and **p < 0.01, by ANOVA and Duncan’s multiple test. AMPK, AMP-activated protein kinase; DEX, dexamethasone; LEU, leucine; mTOR, mechanistic target of rapamycin; PM, M. pectoralis major; p70S6K, ribosomal protein S6 protein kinase.

In vitro experiments

Both protein synthesis (p < 0.05, F(1,6) = 6.57) and the phosphorylation of mTOR (p < 0.01, F(1,6) = 28.39) and p70S6K (p < 0.05, F(1,6) = 4.59) were suppressed by dexamethasone compared with control (Figure 6A–C). Protein synthesis was restored to normal after leucine exposure (p < 0.01, F(3,12) = 5.96) (Figure 6A), and compared with dexamethasone treatment alone, the phosphorylation of mTOR (p < 0.05, F(1,6) = 9.10) was increased (Figure 6B); phosphorylation of p70S6K was not significantly altered during leucine supplementation (p = 0.095, F(1,6) = 3.93, but seemed to be increased 2.3-fold at the low leucine dose; Figure 6C). Dexamethasone and leucine exposure had no significant effect on the protein level of phospho-AMPK (Figure 6D).

Figure 6. The effect of dexamethasone (100 µmol/L for 24 h) and leucine (5 mmol/L or 10 mmol/L or 15 mmol/L for 1 h) treatments on protein synthesis and phosphorylation of mTOR, p70S6K, and AMPK in myoblasts in vitro. The values shown are mean ± SEM (n = 4); ^a,bmeans with different letters are significantly different (p < 0.05); *p < 0.05 and **p < 0.01, by ANOVA and Duncan’s multiple test. AMPK, AMP-activated protein kinase; DEX, dexamethasone; LEU5, 5 mmol/L leucine; LEU10, 10 mmol/L leucine; LEU15, 15 mmol/L leucine; mTOR, mechanistic target of rapamycin; p70S6K, ribosomal protein S6 protein kinase.

As an internal control, β-actin protein abundance was not significantly affected by dexamethasone or leucine in the in vivo or in vitro experiments.

Discussion

In the present study, an interaction between glucocorticoids and branched-chain AA treatments on protein synthesis in broiler chickens was demonstrated. We found that dexamethasone retarded myoblast protein synthesis and muscle development, and suppression of the mTOR-signaling pathway may be involved, as hypothesized. Leucine rectified this detrimental effect of dexamethasone by stimulating the mTOR pathway.

Dexamethasone retards muscle growth

Glucocorticoids participate in the arousal of stress responses, and shift energy expenditure away from production to survival (Matteri et al., 2000; Post et al., 2003). As expected, the present study showed a significant decrease in body weight, weight gain, and feed efficiency with the dexamethasone treatment, indicating energy redistribution during stress perturbations; this result agrees with findings in mammals (Price et al., 2001; Tsiotra & Tsigos, 2006) and in chickens (Wang et al., 2012a,b). There are controversial reports on the effect of dexamethasone administration on feed intake. In the present study, feed intake (expressed as g/chicken) of dexamethasone-treated chickens was not significantly affected. However, the lower weight gain, lower gain: feed ratio and actual feed consumption similar to controls indicate that the suppressed growth was due to increased energy waste, rather than the decreased consumption of feed, which agrees with our previous results (Lin et al., 2004a).

According to our previous report (Lin et al., 2006), the significantly decreased breast and thigh muscle mass in dexamethasone-treated chickens implies severely suppressed development of skeletal muscle. The breast yield was not significantly altered by the dexamethasone treatment in the present study, indicating that the development of breast muscle was arrested parallel with BM. However, thigh yield was increased by dexamethasone treatment, indicating that overall body growth was more severely retarded than thigh muscle mass. Further, the result also suggested that breast muscle is more susceptible to stress than thigh muscle (Lin et al., 2006). However, these results disagree with those of Lin et al. (2006) and Dong et al. (2007), who reported that breast and thigh muscle masses were more severely retarded than body mass in broilers subjected to long-term dexamethasone treatments (7 or 10 d) at approximately 35 d of age. Thus, the results also indicate that the retarded development of skeletal muscles by dexamethasone is exposure time dependent.

Dexamethasone-induced muscle development retardation may be associated with suppressing protein synthesis

We further evaluated protein synthesis rate in vitro and found this was decreased in myoblasts during dexamethasone exposure. This observation is supported by findings of Dong et al. (2007), who reported that glucocorticoids retard the growth of skeletal muscle by suppressing protein synthesis and increasing protein catabolism in chickens.

Also in agreement with previous reports (Lin et al., 2004a,b), the plasma concentrations of glucose and urate were significantly increased after dexamethasone administration in fasting and re-feeding states, indicating enhanced glycogenolysis/gluconeogenesis and protein catabolism, respectively, in dexamethasone-treated chickens. In the present study, the plasma concentrations of glucose and insulin were significantly increased by dexamethasone, which is consistent with a general increase in insulin resistance. Thus, the results suggested that the increase in proteolysis by dexamethasone is paralleled by insulin resistance. Associated with our previous studies related to fatty acids (Wang et al., 2012a,b,c) and glucose metabolism (Zhao et al., 2009) in chickens, these results imply that glucocorticoids trigger physiological responses in muscle to stress perturbations, including decreases in fatty acid oxidation, glucose uptake, and protein synthesis. These physiological responses could shift energy investment away from growth and redirect it toward survival, manifested by the growth retardation and muscle development suppression in chickens.

mTOR inhibition may be involved in dexamethasone-suppressed protein synthesis

As an important mediator in cellular metabolism, mTOR plays a key role in controlling protein synthesis at the transcriptional and translational levels by sensing and integrating signals from nutrients and energy. In mammals, there is evidence that demonstrates the linkage of mTOR signaling with glucocorticoid regulation in protein synthesis. Rannels et al. (1980) revealed that the inhibition of mRNA translation initiation appears to be a major site for glucocorticoid inhibition of protein synthesis. Shah et al. (2000a,b,c,d) reported that glucocorticoids could abrogate mTOR signaling by dephosphorylating p70S6K and 4EBP1 in mammalian skeletal muscle cells. Similarly, in the present study, the phosphorylation of mTOR and p70S6K was significantly inhibited in chickens given the dexamethasone treatment compared with the control, during re-feeding the 0.68% l-alanine diets, indicating that dexamethasone may have suppressed protein synthesis by inhibiting the mTOR-signaling pathway. This speculation was further tested using in vitro myoblasts. Our observations are supported by Long et al. (2001), who reported that dexamethasone inhibits the stimulation of muscle protein synthesis as well as p70S6K phosphorylation.

The modulatory role of insulin/IGF1 on mTOR signaling has been well documented in mammals. Insulin/insulin-like growth factor 1 (IGF1) and downstream signaling proteins, such as PI3K and Akt, play important roles in cell growth and proliferation, partially through activating mTOR phosphorylation (Anthony et al., 2001). Akt, a positive upstream regulator of mTORC1, connects the PI3K signal to mTORC1 via tuberous sclerosis 1 (TSC1) (Inoki et al., 2005). Bodine et al. (2001) reported that the Akt/mTOR pathway is a crucial regulator of skeletal muscle hypertrophy and can prevent muscle atrophy. In contrast, the inactivation of Akt blocks the phosphorylation of mTOR and two downstream proteins, 4EBP1 and p70S6K. Our present data (Figure 5) suggest that dexamethasone may affect the mTOR pathway and muscle development via dysregulating the insulin-Akt signaling cascade. This insensitivity to insulin-Akt signaling is paralleled by hyperglycaemia and hyperinsulinemia. The exact role of Akt in glucocorticoid-mediated protein metabolism requires further study in vitro.

In addition, the mTOR inhibition by dexamethasone also might be associated with the activation of AMPK, according to a study by Kimura et al. (2003) who reported that AMPK and mTOR-signaling pathways are possibly linked. mTOR is a serine/threonine protein kinase that has been proposed to play a central role in skeletal muscle nutrient and energy sensing (Fingar et al., 2004). AMPK modulates metabolism in response to energy demand by responding to change in AMP. AMPK is switched on by an increase in the AMP/ATP ratio (Hawley et al., 2005; Woods et al., 2005). AMPK controls the activation of mTOR and protein synthesis through several possible mechanisms. First, AMPK phosphorylates TSC2 directly to inhibit mTOR function (Gao et al., 2002). Second, AMPK may also inhibit the activity of mTOR directly by phosphorylation at Thr²⁴⁴⁶ (Cheng et al., 2004). Third, AMPK phosphorylates and inhibits the activity of eukaryotic elongation factor 2 (Browne et al., 2004). Fourth, AMPK phosphorylates raptor in mTORC1 (Gwinn et al., 2008). In this study, the phosphorylation of AMPK was inhibited by dexamethasone compared with the control, at re-feeding with the 0.68% alanine diet. The result suggests glucocorticoids may increase the energy levels of cells in response to energy demand during stress perturbation. In addition, the mTOR pathway appears to be more sensitive to dexamethasone administration than the AMPK pathway. In the fasting state of leucine-fed chickens, the phosphorylation of mTOR and p70S6k was inhibited by dexamethasone, but the phosphorylation of AMPK was not significantly affected. This result is consistent with studies on the in vitro myoblasts. These findings imply that the AMPK pathway is unlikely to play an important role in the response of protein synthesis to glucocorticoids, while the mTOR pathway may be a critical point linking protein synthesis in regulation by glucocorticoid. However, the change at the transcriptional level was not consistent with the observations on protein phosphorylation, suggesting that post-transcriptional regulation participates in dexamethasone action. The function of mTOR and AMPK-signaling pathways and the linkage between them during the regulation by glucocorticoids need further verification using an activator or inhibitor.

Dexamethasone-suppressed protein synthesis is alleviated by leucine

Growing evidence suggests that dietary supplementation with AA confers beneficial effects on stress (Yin et al., 2015). As an essential BCAA, the metabolic roles for l-leucine go far beyond serving exclusively as a substrate for de novo protein synthesis. A recent study shows that leucine regulates protein and lipid metabolism in animals, resulting in enhanced cellular respiration and energy partitioning (Duan et al., 2015). mTOR regulates multiple cellular functions including translation in response to nutrients, especially leucine. Exercise, insulin, IGF1, and AA stimulate muscle protein synthesis partially through the activation of the mTOR pathways (Bolster et al., 2004; Deldicque et al., 2005). Although insulin alone can increase muscle protein synthesis in animals, some AAs (particularly leucine) appear to be much more potent anabolic agents (Crozier et al., 2005; Kimball & Jefferson, 2006). The results of this study demonstrate that breast yield was enhanced in leucine-fed chickens compared with dietary alanine. In addition, the in vitro data indicate that the dexamethasone-induced suppression of protein synthesis was restored to a normal level after leucine treatment. The phosphorylation of mTOR was also increased, but p70S6K phosphorylation was not significantly increased (p = 0.095, even at the low dose), during leucine exposure compared with dexamethasone treatment. Similarly, our in vivo data in the re-feeding state show that the phosphorylation of mTOR and p70S6K in chickens treated with dexamethasone + leucine was increased compared with the dexamethasone groups. These results suggest that dexamethasone-suppressed protein synthesis is alleviated by leucine, possibly through an mTOR-dependent pathway. The results imply that the suppression of myoblast protein synthesis and muscle development induced by glucocorticoids is energy dependent, and that nutrition supplementation could relieve the stress response. These findings in chickens agree with a result in mammals (Kong et al., 2014), which revealed that AA administration promoted cell proliferation and protein synthesis by stimulating the mTOR-signaling pathway.

In conclusion, the effect of glucocorticoids on skeletal muscle development and myoblast protein synthesis was investigated in broiler chickens. The results indicate that dexamethasone suppresses the normal increase in body mass and skeletal muscle growth. Phosphorylation of the mTOR and AMPK pathways was inhibited by the dexamethasone treatment, suggesting that the suppressed mTOR and AMPK pathways are likely involved in retarding muscle development and myoblast protein synthesis by glucocorticoids, but the mTOR pathway is a critical point linking protein synthesis. Furthermore, the results also indicate that leucine may stimulate the mTOR pathway and protein synthesis and then reverse the effects of the dexamethasone treatment, suggesting a need for energy supplementation during stress perturbatation.

Declaration of interest

The authors report no conflicts of interest. This work was supported by grants from the National Natural Science Foundation of China (Nos. 31272467 and 31301993).