Cytokine and chemokine gene expression profiles in heterophils from chickens treated with corticosterone

Abstract

In chickens, corticosterone is the end-product of stress. However, the nature of the immune response to elevated plasma corticosterone concentrations at the molecular level has not yet been characterised. We recently demonstrated that exposure to corticosterone in drinking water for 1 week significantly upregulates mRNA expression levels for the pro-inflammatory interleukins (IL)-1β, IL-6, IL-18 and the pro-inflammatory chemokine CCLi2 in chicken lymphocytes, particularly 3 h after the treatment started. In the present study, we investigated cytokine and chemokine mRNA expression levels in circulating heterophils of chickens, and show that at 3 h post initial treatment with corticosterone in drinking water (20 mg/1L) the mRNA expression levels for IL-1β, IL-6, IL-10, IL-12α and IL-18 are upregulated. The mRNA expression levels for IL-6, IL-10 and IL-18 correlate with plasma corticosterone concentration and total heterophil counts. Corticosterone downregulated the expression levels of all pro-inflammatory cytokines at 24 h and 1 week post-treatments. Repeated treatment with corticosterone upregulated mRNA expression levels of transforming growth factor-β4 and the chemokine CCL16. These data indicate that cytokine and chemokine gene expression signatures in chicken heterophils can be altered during stress and therefore could be used as an indicator of stress.

Keywords::

• Chemokine
• chicken
• corticosterone
• cytokine
• gene expression
• heterophil

Introduction

In chickens, stress levels of glucocorticosteroids (GCs); (Thaxton and Siegel 1970; McFarlane and Curtis 1989; Maxwell et al. 1992; Scheele 1997; Hangalapura et al. 2003; Cheng and Muir 2004; Mashaly et al. 2004) or exogenous administration of corticosterone to increase circulating corticosterone concentrations (Davison and Flack 1981; Davison et al. 1983; Gross and Siegel 1983; Pilo et al. 1985; Freeman 1987; Puvadolpirod and Thaxton 2000; Post et al. 2003; Shini 2004; Lin et al. 2006; Virden et al. 2007) alter physiological, behavioural and performance responses and increase circulating heterophil to lymphocyte (H/L) ratios.

We are interested in the effects of stress on chicken leukocytes, especially heterophils and lymphocytes, because of their critical role in innate and adaptive immunity against all stressors, including pathogens. We have previously demonstrated that exogenous administration of corticosterone, to mimic stress, changes cytokine and chemokine mRNA expression levels in chicken peripheral blood and splenic lymphocytes. The mRNA expression levels for interleukin (IL)-1β, IL-6, IL-18 and transforming growth factor (TGF)-β4 were significantly up-regulated in peripheral lymphocytes of corticosterone-treated birds at 3 h post-treatment, while TGF-β4 and IL-18 mRNA levels remained elevated 1 week post-corticosterone treatments. Corticosterone-treated birds also showed greater mRNA expression levels of chemokines, particularly CCLi2, CCL5 (RANTES), CCL16 and CXCLi1, in peripheral and splenic lymphocytes at 3 h post-corticosterone administration (Shini and Kaiser 2008a).

In this study, we determined the mRNA expression levels of cytokines and chemokines in peripheral heterophils from chickens exposed to oral corticosterone, with the aim of understanding their potential role in immunological activities during the stress response. Although measuring cytokine mRNA expression levels by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) does not necessarily equate to the production of bioactive cytokines in the blood, recent publications have demonstrated that in the absence of effective bioassays, qRT-PCR is the most sensitive method available to reliably quantify expression of a broad spectrum of avian cytokines (Kaiser et al. 2000, 2003; Swaggerty et al. 2004; Withanage et al. 2004; Smith et al. 2005).

The heterophil, the avian equivalent of the mammalian neutrophil, is the first line of immunity against most foreign agents. Heterophils are non-lymphoid, normally multi-lobulated, granulated, motile and short-living cells that develop from myeloid-lineage cells in the bone marrow (Fox and Solomon 1981; Tizard 2009). Upon maturation, bone marrow heterophils are released into the circulation where they marginate through blood vessel endothelial cells into the sites of inflammation and infection, and provide an innate immune response for the chicken. Once migrated, heterophils do not re-enter the circulation, but rather perform their functions and die by apoptosis in the tissue; heterophils are consistently reproduced and released into the circulation.

The heterophil is highly phagocytic (Topp and Carlson 1972), therefore it responds to various chemotactic stimuli, such as invading microorganisms (Powell 1987a, 1987b; Genovese et al. 1999; Kogut 2002) and tissue inflammation (Campbell and Dein 1984; Latimer et al. 1988; Harmon 1998). Additionally, the heterophil responds to other non-infectious environmental stimuli associated with diet, light, trauma, temperature and other housing conditions. The heterophil (also the neutrophil) participation in stress responses has been investigated in many elegant studies (Mishler 1977; Davison and Flack 1981; Gross and Siegel 1983; Davis et al. 1991; Maxwell et al. 1992; Dhabhar et al. 1995; Boa-Amponsem et al. 2000; Post et al. 2003; Mashaly et al. 2004; Shini 2004; Campo et al. 2007; Shini et al. 2008b) that have demonstrated that corticosteroid administration results not only in lymphopenia, but also in heterophilia (i.e. neutrophilia) and have established that the H/L ratio (neutrophil/lymphocyte ratio in mammals) is a sensitive indicator of stress in chickens.

As in mammals (Agarwal and Marshall 2000; Elenkov 2004; Viswanathan and Dhabhar 2005; Calcagni and Elenkov 2006), stress in chickens influences the immune response and alters cytokine and chemokine responses (Hangalapura et al. 2006; Shini and Kaiser 2008a). Changes in hormonal, cytokine and chemokine content of the plasma and extracellular fluid can also influence heterophil movement and distribution in the body, and modify their immunological activities. The molecular events behind these changes are poorly understood, and the effect of corticosterone on the level of cytokine and chemokine gene expression in heterophils has not been reported. The purpose of the present study was to determine cytokine and chemokine gene (mRNA) expression levels in peripheral heterophils of chickens exposed to corticosterone in the drinking water as a measure of the heterophil response to stress.

Materials and methods

Birds, housing and treatments

Experiments were conducted with 90 layer chickens (Gallus gallus domesticus) selected at random from a single flock of commercial Hy-Line brown pullets. At 4 weeks of age, pullets were randomly divided into three treatment groups and were given ad libitum access to water and feed that met or exceeded National Research Council requirements (National Research Council 1994). Birds were tagged and kept in an environmentally controlled house in stainless steel cages; each cage held six birds. The light regimen was 17 h of light (05:00 to 22:00 h) and the temperature was kept at 22 ± 2°C during experiments. Birds were allowed to adapt to the experimental conditions for 3 weeks.

Corticosterone (Sigma Aldrich, Inc., St Louis, MO, USA) was dissolved in ethanol and diluted in the drinking water to achieve a final concentration of 20 mg/l. As shown in our previous experiments, administration of corticosterone increases circulating corticosterone above baseline levels (Shini 2006; Shini et al. 2007, 2008b, 2008c), and this is significantly correlated to H/L ratios. At 7 weeks of age, birds were exposed for 1 week to the following treatments in drinking water: corticosterone dissolved in ethanol, ethanol, or untreated water. Whole blood was collected from a wing vein of eight randomly selected chickens per group at 0 h, 3 h, 24 h and 7 days post continuous treatment with corticosterone. Lithium-heparin treated whole blood was used to perform blood cell counts and to isolate heterophils for RNA extraction. Plasma was used to determine corticosterone concentrations. All procedures conducted in this study were approved by the Animal Ethics Committee of the University of Queensland, Australia.

Absolute heterophil count

Total heterophil count was measured in an automated analyser (CELL-DYN^® System 3700CS, Abbott Park, IL, USA).

Corticosterone measurement

Corticosterone was measured by enzyme immunoassay using a commercial kit, OCTEIA CORT HS (Immunodiagnostic Systems Ltd., Bolton, UK). All samples were run in duplicate, and kit calibrators and controls were included in each analysis. Absorbance was measured at 450 nm, with a reference wavelength of 650 nm in an ELISA microplate reader (MRX^® II Dynex Technologies, Chantilly, VA, USA). The intra- and interassay coefficients of variation were L < 15; M < 7; H < 7%, and L < 20; M < 9; H < 9%, respectively, and the detection limit was 0.17 ng/ml.

Isolation of peripheral blood heterophils, RNA extraction and real-time qRT-PCR

The mRNA expression levels of IL-1β, IL-2, IL-4, IL-6, IL-10, IL-12α, IL-12β, IL-13, IL-18, interferon (IFN)-γ, TGF-β4, chemokines (CCLi1, CCLi2, CCL5, CCL16, CXCLi1, CXCLi2) and chemokine receptors (CXCR1 and CXCR4) in heterophils were measured using real-time qRT-PCR assays.

Isolation of peripheral heterophils was conducted according to standard protocols (Kogut et al. 1995; Kogut et al. 2006). Briefly, whole blood pooled from eight birds of each treatment was mixed with 1% methylcellulose (25 centipoises; Sigma Chemical Co., St Louis, MO, USA) at a 1.5:1 ratio and centrifuged at 25g for 30 min at 4°C. The supernatant was transferred to a Falcon tube and diluted with Ca²+, Mg²+-free Hanks' balanced salt solution (HBSS, 1:1; Sigma Chemical Co.). The suspension was layered over a discontinuous Ficoll-Hypaque (Sigma Chemical Co.) gradient (specific gravity 1.077 over specific gravity 1.119) and centrifuged at 250g for 60 min at 4°C. After centrifugation, the histopaque layers containing the heterophils were collected and washed twice in RPMI 1640 medium (Sigma Chemical Co.) and resuspended in fresh RPMI 1640. Cell viability was determined by Trypan Blue exclusion and the purity of the heterophil suspensions was assessed by microscopic examination of stained smears. The cell concentration was adjusted to 1 × 10⁷ heterophils/ml and stored on ice until used.

Total RNA was extracted from peripheral blood heterophils using an RNeasy plus mini kit (Qiagen, Doncaster, Australia), following the manufacturer's directions. Isolated RNA was eluted in 50 μl RNase-free water, and stored at − 80°C until use. The yield of total RNA was determined using absorption of light at 260 and 280 nm in a Nanodrop (ND-1000) spectrophotometer.

Primers and probes were designed using the Primer Express software program (Applied Biosystems, Foster City, CA, USA); details are presented in Table I. For all cytokines and chemokines, either a primer or probe was designed from the sequence of the relevant genes to lie across intron-exon boundaries. All probes were labelled with the fluorescent reporter dye 5-carboxyfluorescein (FAM) at the 5′ end and with the quencher N,N,N,N′-tetramethyl-6-carboxyrhodamine (TAMRA) at the 3′ end. Reverse transcription and PCR were performed in separate reactions. First, 2 μg of RNA were reverse-transcribed into cDNA in a 20 μl RT reaction using SuperScript™ III First-Strand Synthesis System for RT-PCR (Invitrogen, Carlsbad, CA, USA) in a GeneAmp^® PCR system 9700 (Applied Biosystems, Melbourne, VIC, Australia). After template denaturation at 65°C for 5 min, 10 μl of cDNA Synthesis Mix were added per tube and the program was continued at 55°C for 50 min, at 85°C for 5 min and then held at 4°C until removal from the machine. The PCR was performed in a 10 μl reaction containing 2 μl of cDNA from the RT reaction, 5 μl TaqMan^® Universal PCR Master Mix (Applied Biosystems, Melbourne, VIC, Australia), 2 μl primer (at 3 μmol) and 1 μl probe (at 1.5 μmol). Each PCR plate contained target genes and 28S rRNA in triplicate and a no-template negative control containing 2 μl water instead of cDNA. The real-time reactions were carried out on an ABI Prism 7900HT Fast Real-Time PCR System (Applied Biosystems, Australia) with the following cycle profile: 95°C for 10 min, and 40 repeat cycles of 95°C for 15 s and then 60°C for 1 min.

Table I.  Real-time quantitative RT-PCR primers and probes.

RNA target	Primer/probe sequence (5′-3′)^*	Acc. No.
28S	F GGCGAAGCCAGAGGAAACT	X59733
	R GACGACCGATTTGCACGTC
	P (FAM)-AGGACCGCTACGGACCTCCACCA-(TAMRA)
IFN-γ	F GTGAAGAAGGTGAAAGATATCATGGA	Y07922
	R GCTTTGCGCTGGATTCTCA
	P (FAM)-TGGCCAAGCTCCCGATGAACGA-(TAMRA)
TGF-β4	F AGGATCTGCAGTGGAAGTGGAT	M31160
	R CCCCGGGTTGTGTTGGT
	P (FAM)-ACCCAAAGGTTATATGGCCAACTTCTGCAT-(TAMRA)
IL-1β	F GCTCTACATGTCGTGTGTGATGAG	AJ245728
	R TGTCGATGTCCCGCATGA
	P (FAM)-CCACACTGCAGCTGGAGGAAGCC-(TAMRA)
IL-2	F TTGGAAAATATCAAGAACAAGATTCATC	AJ009800
	R TCCCAGGTAACACTGCAGAGTTT
	P (FAM)-ACTGAGACCCAGGAGTGCACCCAGC-(TAMRA)
IL-4	F AACATGCGTCAGCTCCTGAAT	AJ621249
	R TCTGCTAGGAACTTCTCCATTGAA
	P (FAM)-AGCAGCACCTCCCTCAAGGCACC-(TAMRA)
IL-6	F GCTCGCCGGCTTCGA	AJ250838
	R GGTAGGTCTGAAAGGCGAACAG
	P (FAM)-AGGAGAAATGCCTGACGAAGCTCTCCA-(TAMRA)
IL-10	F CATGCTGCTGGGCCTGAA	AJ621614
	R CGTCTCCTTGATCTGCTTGATG
	P (FAM)-CGACGATTCGGCGCTGTCACC-(TAMRA)
IL-12α	F TGGCCGCTGCAAACG	AY262751
	R ACCTCTTCAAGGGTGCACTCA
	P (FAM)-CCAGCGTCCTCTGCTTCTGCACCTT-(TAMRA)
IL-12β	F TGGGCAAATGATACGGTCAA	AJ564201
	R CAGAGTAGTTCTTTGCCTCACATTTT
	P (FAM)-CTGAAAAGCTATAAAGAGCCAAGCAAGACGTTCT-(TAMRA)
IL-13	F GCACGGCATGACGAACTG	AJ621250
	R GCAAGAAGTTCCGCAGGTAGA
	P (FAM)-CCGCCGAGCACCGACAATGA-(TAMRA)
IL-18	F AGGTGAAATCTGGCAGTGGAAT	AJ416937
	R ACCTGGACGCTGAATGCAA
	P (FAM)-CCGCGCCTTCAGCAGGGATG-(TAMRA)
CXCLi1	F TGGCTCTTCTCCTGATCTCAATG	AF277660
	R GCACTGGCATCGGAGTTCA
	P (FAM)-TCGCTGAACGTGCTTGAGCCATACCTT-(TAMRA)
CXCLi2	F GCCCTCCTCCTGGTTTCAG	AJ009800
	R TGGCACCGCAGCTCATT
	P (FAM)-TCTTTACCAGCGTCCTACCTTGCGACA-(TAMRA)
CCLi1	F GTATGAGTACACGGGAAGCAGATG	AY753571
	R CACAGCACTTCTTCCCCTCAA
	P (FAM)-CCCTACCATGGCGTGATATTCACCACC-(TAMRA)
CCLi2	F GGCAGACTACTACGAGACCAACAG	AJ243034
	R ACGGCCCTTCCTGGTGAT
	P (FAM)-ACACAACACCAGCATGAGGGCACTG-(TAMRA)
CCL16	F TGCACCACTTACATAACACACAAGAT	AY895166
	R TGAAGATGATGGCAGGCTTTG
	P (FAM)-CGCGGAACCTCATCCAGAGGCACTA-(TAMRA)
CCL5	F CCCTCTCCATCCTCCTGGTT	AY037859
	R TATCAGCCCCAAACGGAGAT
	P (FAM)-CCGCCCTCTTCCCTCAAGCCTC-(TAMRA)
CXCR1	F CGCAGACCTTCGGCTTTG	AF227961
	R GGGTGTGCACGGTGACTTC
	P (FAM)-CCTGCCCCTCCTGGTCATGCTTTAC-(TAMRA)
CXCR4	F TGCTGCCTCAATCCAATTCTT	AF294794
	R CAAGGCATTTTGTGCTGATGTT
	P (FAM)-ACGCCTTCCTGGGTGCCAAGTTC-(TAMRA)

* F, forward primer; R, reverse primer and P, probe.

Quantification was based on the increased fluorescence detected by the 7900 Fast Sequence Detection System due to hydrolysis of the target-specific probes by the 5′ nuclease activity of the rTth DNA polymerase during PCR amplification. Results are expressed in terms of the threshold cycle value (C_t), the cycle at which the change in the reporter dye passes a significance threshold (R_n). To account for variation in sampling and RNA preparation, the C_t values for cytokine- or chemokine-specific product for each sample were standardised using the C_t value of 28S rRNA product for the same sample. To normalise RNA levels between samples within an experiment, the mean C_t value for 28S rRNA-specific product was calculated by pooling values from all samples in that experiment. Tube-to-tube variations in 28S rRNA C_t values about the experimental mean were calculated. The slope of the 28S rRNA log₁₀ dilution series regression line was used to calculate differences in input total RNA. Using the slopes of the respective cytokine and chemokine or 28S rRNA log₁₀ dilution series regression lines, the difference in input total RNA, as represented by the 28S rRNA, was then used to adjust cytokine- and chemokine-specific C_t values, as follows:where: C_t = mean sample C_t; N_t = experimental 28S mean; C′_t = mean 28S of sample; S = cytokine or chemokine slope and S′ = 28S slope.

Statistical analysis

Experiments were repeated twice and PCR tests were repeated three times. Data from two repeated experiments were pooled for presentation and statistical analysis. The mean and standard error of the mean (mean ± SEM) for all cytokines and chemokines were calculated for each group (controls and corticosterone treatment). For statistical purposes an unpaired t-test was used to compare two means (control and corticosterone-treated) and determine the p-value. A 99% confidence interval for the true difference between the means was set, and the values were considered significant at p < 0.01.

Means ± SEM for plasma corticosterone concentrations and heterophil counts of controls and corticosterone-treated chickens were determined by analysis of variance (SAS Institute 1996). Differences were further separated using Duncan's multiple range test and considered significant at p < 0.05. Correlations between different significant measures were determined using Pearson's correlation coefficient (SAS Institute 1996).

Results

Quantitative Rt-pcr

The cytokine mRNA expression level changes (fold change over controls) in heterophils of corticosterone-treated chickens are shown in Figure 1. At 3 h post-initial exposure to corticosterone there was a significant increase (p < 0.001) in IL-1β, IL-6, IL-10, IL-12α and IL-18 mRNA expression levels in heterophils from treated birds when compared to controls. Expression of these cytokines was significantly decreased (p < 0.001) at 24 h and 1 week after continuous treatment with corticosterone when compared to control levels and levels at 3 h (Figure 1). In particular, the fold change in mRNA expression levels of IL-18 in the treated chickens was highly upregulated (i.e. 30-fold greater) at 3 h compared to controls, but decreased drastically at 24 h and 1 week. In contrast, TGF-β4 mRNA expression levels were significantly upregulated only at 1 week post-repeated treatment with corticosterone, i.e. 10-fold greater than control levels (Figure 1).

Figure 1.  Fold-changes in cytokine mRNA levels in peripheral heterophils from corticosterone-treated chickens at 3 h, 24 h and 1 week after initial exposure when compared to controls (untreated and ethanol [vehicle] treated birds). Error bars show SEM from triplicate samples (n = 16 chickens per group) from two separate qRT-PCR experiments; p < 0.01.

CCL16 mRNA expression levels in heterophils of birds treated with corticosterone were significantly increased at 3 h (p < 0.01), 24 h (p < 0.001) and 1 week (p < 0.001) compared to control levels (Figure 2). The mRNA expression levels of the chemokine receptor CXCR1 in peripheral heterophils of treated birds were also significantly increased (p < 0.01) at 3 h, 24 h and 1 week after initial treatment with corticosterone when compared to controls (Figure 2). mRNA expression levels for IFN-γ and CCL5, CCLi2 and CXCLi2 were essentially unchanged. Expression of mRNA for IL-2, IL-4, IL-12β, IL-13, CCLi1, CXCLi1 and CXCR4 in circulating heterophils was not detected in these experiments.

Figure 2.  Fold-change in chemokine mRNA levels in peripheral heterophils from corticosterone-treated chickens at 3 h, 24 h and 1 week after initial exposure when compared to controls (untreated and ethanol [vehicle] treated birds). Error bars show SEM from triplicate samples (n = 16 chickens per group) from two separate qRT-PCR experiments; p < 0.01.

In general, corticosterone treatment induced increased mRNA expression levels for pro-inflammatory cytokines and chemokines at 3 h post-initial treatment with corticosterone. Continuous treatment with corticosterone downregulated mRNA expression levels for all pro-inflammatory cytokines, but upregulated mRNA expression levels for the anti-inflammatory cytokine TGF-β4.

Plasma corticosterone concentration

Continuous administration with corticosterone via drinking water significantly (p < 0.001) increased plasma corticosterone concentrations in birds at 3 h, 24 h and 1 week post-initial treatment when compared to all control groups, birds given water alone or with ethanol (Table II). Plasma corticosterone concentration of corticosterone-treated birds decreased over time; however, the concentration of corticosterone at 1 week post-treatments was four times greater than basal levels (at 0 h) and levels in all control birds.

Table II.  Effects of administration of corticosterone in drinking water on plasma corticosterone concentrations^* and heterophil counts at 0 h, 3 h, 24 h and 1 week post-treatment.

Treatment and time	Control^†	Ethanol^‡	Corticosterone^‡
Plasma corticosterone concentration (ng/mL)
0 h	3.16 ± 0.03^a	3.23 ± 0.15^a	3.29 ± 0.10^a
3 h	3.55 ± 0.13^a	3.68 ± 0.20^a	17.57 ± 0.15^b
24 h	3.66 ± 0.09^a	3.75 ± 0.09^a	21.91 ± 0.88^c
1 week	3.59 ± 0.07^a	3.77 ± 0.04^a	13.23 ± 0.17^d
Heterophil count (10^3/μl)
0 h	5.05 ± 0.54^d	4.76 ± 0.40^d	4.57 ± 0.48^d
3 h	4.74 ± 0.46^d	4.19 ± 0.38^d	9.96 ± 0.82^c
24 h	4.91 ± 0.38^d	4.52 ± 0.50^d	10.40 ± 0.94^c
1 week	5.15 ± 0.50^d	4.57 ± 0.46^d	7.56 ± 0.76^b

Notes: ^a–dMeans with different superscripts within the same column (treatment) and row (time) differ significantly (p < 0.05)

* Values are mean ± SEM, n = 16

† Non-treated control

‡ Ethanol (vehicle) control; Corticosterone-treated.

Heterophil count

The number of circulating heterophils increased rapidly (p < 0.001) at 3 h after initial treatment with corticosterone (Table II). At 24 h post-treatment, the heterophil count of treated birds was unchanged when compared to the 3 h level, irrespective of continuous exposure to corticosterone. At 1 week post-continuous exposure to corticosterone in the drinking water, heterophil counts decreased in peripheral blood, yet were higher than those of control birds and the baseline counts (measurement at time 0 h).

Correlation between plasma corticosterone concentration, heterophil count and cytokine and chemokine mRNA expression levels

Plasma corticosterone concentration and heterophil count were moderately correlated with each other in birds treated with corticosterone at 3 h and 1 week post-treatments (data not shown). High positive correlations were found between plasma corticosterone concentrations and IL-6, IL-10 and IL-18 mRNA expression levels at 3 h (p < 0.05, 0.01 and 0.05, respectively), and CXCR1 at 24 h (p < 0.05) respectively (Table III). Circulating heterophil counts were also significantly correlated with the mRNA expression levels of IL-6, IL-10 and IL-18 at 3 h (p < 0.01, 0.01 and 0.001, respectively) and CXCR1 at 24 h (p < 0.02) post-treatment with corticosterone. Corticosterone concentrations and circulating heterophil counts correlated negatively with CCL16 mRNA expression at 1 week (p < 0.01 and 0.05, respectively) post-repeated treatments with corticosterone (Table II).

Table III.  Correlation of plasma corticosterone concentrations and total circulating heterophils with heterophil cytokine and chemokine mRNA expression levels.

Treatment and time	IL-6	IL-10	IL-18	CCL16	CXCR1
Plasma corticosterone concentration
3 h	0.884^*	0.955	0.985	NS	NS
	p < 0.05	p < 0.01	p < 0.05
24 h	NS	NS	NS	NS	0.937
					p < 0.05
1 week	NS	NS	NS	− 0.995	NS
				p < 0.01
Total heterophil count
3 h	0.977	0.964	0.987	NS	NS
	p < 0.01	p < 0.01	p < 0.001
24 h	NS	NS	NS	NS	0.875
					p < 0.02
1 week	NS	NS	NS	− 0.946	NS
				p < 0.05

Note: NS not significant

* Pearson's r.

Discussion

This is the first study of effects of corticosterone treatment, to mimick stressors, on cytokine and chemokine mRNA expression levels in chicken peripheral leukocytes. Initially, we evaluated cytokine and chemokine mRNA expression levels in peripheral lymphocytes, and there was an effect of corticosterone, particularly on the expression of pro-inflammatory cytokines and chemokines, which were upregulated (Shini and Kaiser 2008a).

The results of this study are in agreement with those from other investigators who have employed a similar model of stress (i.e. corticosterone treatment in feed or water, in immature or adult chickens; Davison and Flack 1981; Davison et al. 1983; Gross and Siegel 1983; Post et al. 2003; Lin et al. 2006). However, these authors only used behavioural, physiological and performance indicators to investigate effects of corticosterone on chickens.

Like other immune cells, chicken heterophils express genes for specific cytokines and chemokines and therefore participate in the regulation (modulation) of the initial defence response to pathogens (Kogut et al. 2003, 2005) and presumably other stressors. In this study, we demonstrated that corticosterone upregulates mRNA expression levels of cytokines (IL-1β, IL-6, IL-10, IL-12-α and IL-18) in heterophils at 3 h post-initial treatment. We also found that, in contrast to initial treatment, continuous treatment with corticosterone (for 1 week) downregulated mRNA expression levels for IL-1β, IL-6, IL-10, IL-12-α and IL-18 (which recover and apparently reach control levels). Chronic treatment with corticosterone increased the expression of the cytokine TGF-β4, chemokine CCL16 and the chemokine receptor CXCR1 (at 3 and 24 h).

To maintain immunological self-tolerance and immune homeostasis, the immune system depends on both activation and downregulation mechanisms. From studies on humans, rodents and chickens, it has been established that the immune system responds to elevated levels of corticosterone with an increase of circulatory innate immune effector cells (neutrophils/heterophils) and suppression of adaptive immune cells (lymphocytes), and this contributes to the enhancement of immune surveillance in organs to which leukocytes traffic during stress (Mishler 1977; Davison and Flack 1981; Dhabhar 2002). Although, these observations started ca. 30 years ago, the molecular pathways used by the immune system in response to stressors are not yet well understood. It is also still unclear what inflammatory mediators stimulate heterophil entering in the circulation, and lymphocyte redistribution into immune organs.

From our experiments with the chicken, we suggest a role for cytokines and chemokines in the stimulation of leukocyte movement and regulation of inflammatory vs. anti-inflammatory activities. In response to increased levels of plasma corticosterone the cytokine and chemokine milieu changes, and appears different in different stages of the stress response. We previously showed that pro-inflammatory cytokine gene expression (IL-1β, IL-6 and IL-18) and chemokine gene expression (CCLi2 and CXCLi2) were upregulated in peripheral blood lymphocytes (Shini and Kaiser 2008a), and in the present study we demonstrated that pro-inflammatory cytokine gene expression in heterophils is also influenced by corticosterone. Such molecules might stimulate the proliferation of heterophils in the bone morrow (IL-1β, IL-6 and IL-18) and subsequently activate their influx from the bone marrow and spleen into peripheral blood (CCLi2 and CXCLi2). In this respect we suggest that pro-inflammatory cytokines (that activate/proliferate) and chemokines (that attract) support immune cells to effectively deal with potential changes in the internal environment. IL-1β and IL-6 are both pleiotrophic pro-inflammatory cytokines, which play a critical role in several components of host defence, including CNS-orchestrated events such as stress responses (O'Connor et al. 2003). IL-1β and IL-6 also amplify T and B lymphocyte proliferation. IL-18 is also a pro-inflammatory cytokine that in mammals plays a critical role in initiating an inflammatory response, including neutrophil activation (Okamura et al. 1995). In our study, the increase in peripheral heterophil counts positively correlated with IL-18 mRNA expression levels.

The results of this study suggest that at later stages corticosterone, which pharmacologically is anti-inflammatory, downregulates pro-inflammatory cytokines and upregulates anti-inflammatory cytokines. In mammals, this would suggest a shift from predominantly Th1 cells to Treg (Th3/Tr1) cells, which secrete TGF-β1 and IL-10. Chicken TGF-β4 is the orthologue of mammalian TGF-β1 (Kaiser et al. 2005); TGF-β4 is primarily an anti-inflammatory cytokine with an important role in immunoregulation. Upregulation of mRNA expression levels of TGF-β4 in heterophils of chickens repeatedly treated with corticosterone (at 1 week) could counteract the effects of the pro-inflammatory cytokines expressed 3 h post-treatment. TGF-β4 might therefore regulate the anti-inflammatory effects of corticosterone. IL-10 is the best-characterised anti-inflammatory cytokine to date. The mechanism of IL-10 action is widely accepted to be through inhibition of expression of pro-inflammatory cytokines and their receptors and induction of synthesis of cytokine receptor antagonists (Elenkov 2004). Recent studies in mammals have found that IL-10 is a component of an endogenous regulatory feedback system that limits/regulates the production of pro-inflammatory cytokines under some conditions. Therefore, we can speculate that the increase of IL-10 mRNA expression levels in our model of stress in the early stages may be, at least in part, to counteract the early overproduction of pro-inflammatory cytokines. Corticosterone upregulated mRNA expression levels of CCL16 and CXCR1 in heterophils. The expression of other chemokines (CCLi2, CCL5 and CXCLi2) was low at all time-points, in contrast to the effect of corticosterone on chemokine gene expression in chicken lymphocytes, where CCLi2, CCL5, CCL16 and CXCLi1 are upregulated (Shini and Kaiser 2008a).

Glucocorticoid hormones affect virtually all tissues of the body. Most, if not all, of these effects are mediated by binding to their receptors, glucocorticoid receptor (GR) and mineralocorticoid receptor (MR; De Kloet et al. 2005). GR has been proposed to display a low affinity for corticosterone, whereas MR displays high affinity for corticosterone and is almost fully occupied at low plasma corticosterone concentrations (Breuner and Orchinik 2001). GR (or corticosteroid receptors) exist in immune cells and are expressed with variable intensity on different lymphoid cell subsets, being high in immature thymocytes, intermediate in mature B and T cells, and low in polymorphonuclear granulocytes (such as neutrophils and heterophils; Sapolsky et al. 2000). Similar to mammalian granulocytes, heterophils might express low levels of GC receptors. If so, many of the effects of corticosterone on heterophils could be largely mediated through its binding to other cell types such as macrophages and lymphocytes. Glucocorticoid receptors expressed on immune cells bind corticosterone and interfere with the function of NF-κB, which regulates the expression of the wide range of immunologically related genes, including the expression of cytokines and chemokines. Whereas the focus of the anti-inflammatory effects of GC focus on NF-κB inhibition, the GR undoubtedly interferes with the function of other transcriptional regulators. It is considered that protein–protein interactions similar to those described for GR–NF-κB are involved with GC inhibition of activator protein-1 (AP-1) and nuclear factor of activated T lymphocytes (NF–AT; De Kloet et al. 2005).

In conclusion, we have shown that initial treatment with corticosterone not only increases the number of circulating heterophils, but also transcriptionally upregulates mRNA expression levels of pro-inflammatory cytokines (IL-1β, IL-6, IL-10, IL-12 and IL-18), the chemokine CCL16 and a chemokine receptor (CXCR1). This is the first demonstration of the inducible expression of pro-inflammatory molecules in avian heterophils by a stress hormone. Further research is needed to understand endocrine and immune molecule cross-talk in avian species, and especially pathways by which innate cells are involved in the stress response.

Declaration of interest: The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.