Telomere length and type 2 diabetes in males, a premature aging syndrome

Abstract

Background: Increased telomere shortening has been demonstrated in several diseases including type 2 diabetes. However, it is not known whether telomere length changes during the course of type 2 diabetes. Objective: To determine telomere length at different stages of type 2 diabetes, including early and late stages. Methods: A total of 93 males with type 2 diabetes and 10 years or more since original diagnosis; 96 males with less than one year of diagnosis; 98 age matched healthy males. Telomere length was estimated by means of real-time polymerase chain reaction. Fasting venous blood samples were obtained for measurement of lipid peroxidation and inflammation markers.Results: We found a greater telomere shortening in group (A) with type 2 diabetes of 10 years or more since original diagnosis, compared with the control group (C) of healthy males (5.4 vs 9.6 Kb) (p = 0.04) and with group B (5.4 vs 8.7kb) (p = 0.05). With regard to inflammatory markers TNF-α, malondialdehyde peroxidation and adiponectin we found significant differences. Conclusion: Telomere shortening increases with the duration of diabetes. The time of exhibition suggests in parallel that the progressive increase of inflammation and/or oxidative stress plays a direct role in telomere shortening.

Keywords::

• Type 2 diabetes mellitus
• telomere shortening
• oxidative stress

Introduction

Telomeres are DNA sequences necessary for DNA replication, which shorten at cell division at a rate related to levels of oxidative stress. Once shortened to a critical length, cells are triggered into replicative sequences. The tandem repeats of TTAGGG of the DNA sequence at the ends of eukaryotic chromosomes undergo attrition with each cell division, and their length is an indicator of the replicative potential of somatic cells [1]. Telomere length reflects the biological age of humans, which may differ from the chronological age [2]. Inflammation and oxidative stress accelerate the rate of telomere attrition in different cell types.

Recent data have implicated leukocyte telomere length shortening as a potential risk predictor for type 2 diabetes mellitus (T2DM) and its associated phenotypes. Shortening of telomere length has been reported to be associated with aging, stress, diabetes, hypertension, many other age related diseases and cancer [3]. Zee RY et al., reported an association of mean leukocyte telomere length shortening with T2DM in white subjects [4]. Telomere length reflects the biological age of humans, which may differ from the chronological age. In adults, telomerase maintains telomere length in young tissues, but its activity decays later on in life, likely contributing to a general telomere shortening [5,6].

Oxidative stress plays a crucial role in the pathogenesis of type 2 diabetes and in diabetes-associated complications. The generation of reactive oxygen species (ROS) is a common downstream mechanism whereby multiple by products of glucose and proinflammatory molecules exert adverse effects [7]. Inflammation and oxidative stress accelerate the rate of telomere attrition in different cell types. Oxidative DNA damage and telomere shortening occurs in type 2 diabetes [8].

Adiponectin (ADPN), an anti-inflammatory cytokine produced in fat cells, inhibit macrophage functions such as cytokine production (TNF-α) and is able to induce apoptosis [9]. ADPN antagonizes the stimulatory effect of TNF-α on vascular smooth muscle calcification [10]. The levels of the ADPN are reduced in patients with obesity, insulin resistence, type 2 diabetes, hypertension, and coronary artery disease [11].

So far there are no studies aimed to demostrate the association of telomeric shortening with the progression of the disease, and a concomitant increase of the inflammatory and/or oxidative markers, in type 2 diabetes. The pathogenesis of type 2 diabetes involves inadequate insulin secretion and resistance to the action of insulin. Suggestive data, link insulin resistance and accompanying hyperglycemia to an excess of abdominal adipose tissue, a link that appears to be mediated partially by adipocyte secretion of multiple adipokines that mediate inflammation, thrombosis, atherogenesis, hypertension, and insulin resistance. The adipokine adiponectin has reduced expression in obesity and appears to be protective against the development of type 2 diabetes.

Telomere length has not been investigated in diabetic patients at different stages. It would therefore be interesting to clarify whether diabetes is a premature aging syndrome, explore if the telomere length changes at different stages of the disease, and to explore if there is any correlation with the increasing inflammatory process and oxidative stress that takes place during the course of diabetes.

Patients and methods

A total of 287 male subjects were included in this study. Three groups were established: Group A was comprised of 93 patients with Type 2 DM for 10 years or more from time of diagnosis, group B was comprised of 96 patients with recently diagnosed Type 2 DM (<1 year) age-matched with group A, and group C was the control group comprised of 98 subjects without diabetes, also age matched with patients from group A (±3 years). All subjects gave written informed consent before entering the study, which was conducted according to the principles of the declaration of Helsinki. All participants underwent complete physical examination in the morning of the study. They were questioned about previous and current diseases, use of medications and their smoking habits; ex-smokers who had given up smoking for a period of at least 3 years were considered as nonsmokers. Retinopathy was reported from the medical records. BMI, waist circumference, and waist-to-hip ratio were measured and calculated. Afterward, fasting blood samples were collected and centrifuged, and were either used immediately for measurement of biochemical parameters, or stored in−80°C until determination of TRF length and plasma oxidative markers.

Telomeric length measurement

DNA samples were extracted from white blood cells, and telomeric length was measured as previously described [12] by PCR amplification with oligonucleotide primers designed to hybridize to the TTAGGG and CCCTAA repeats. The final concentrations of reagents in the PCR were 0.2SYBR Green I (Molecular Probes), 15 mM Tris–HCl pH 8.0, 50 mM KCl, 2 mMMgCl2, 0.2 mMeach dNTP, 5 mM DTT, 1% DMSO and 1.25 U AmpliTaq Gold DNA polymerase. The final telomere primer concentrations were: tel 1,270 nM; tel 2, 900 nM. The final 36B4 (single copy gene) primer concentrations were: 36B4u, 300 nM; 36B4d, 500 nM. The primer sequences (written 5′→3′) were: tel 1, GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT;tel2,TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA; 36B4u,CAGCAAGTGGGAAGGTGTAATCC; 36B4d,CCCATTCTATCATCAACGGGTACAA. [12]. All PCRs were performed on the Rotor Gene Machine. The thermal cycling profile for both amplicons began with 95°C incubation for 3 min to activate the AmpliTaq Gold DNA polymerase.

For telomere PCR, 40 cycles of 95°C for 15 s, 54°C for 2 min, and for 36B4 PCR, 40 cycles of 95°C for 15 s, 58°C for 1 min were set. Rotor Gene analysis Software V6.0 was then used to generate the standard curve for each run and to determine the dilution factors of standards corresponding to the T and S amounts in each sample.

Lipid peroxidation and inflammation markers

Fasting venous blood samples were obtained for measurement of glycosylated hemoglobin fraction A_1c (HbA_1c), glucose, and lipids of diabetic patients. Insulin measurement was performed by radioimmunoassay (RIA, Linco Research, St. Charles, MO) and IR was calculated by the HOMA-IR method. Plasma levels of MDA as a marker of lipid peroxidation were measured by spectrofluorometry. TNF-α, IL-6 and ADPN measurements were performed using ELISA technique (Biosource, Invitrogen, Carlsbad, CA).

Statistics

We used descriptive statistics (mean ± SD) for demographic, anthropometric, and laboratory variables. In order to evaluate differences between telomere sizes, we employed Kruskal–Wallis test to determine the differences between Plasma levels of MDA, TNF-α, IL-6 and ADPN, using p < 0.05 as a cut-off for statistical significant, and Mann–Whitney U test to calculate group differences.

Power of the test

With base to the average, and standard deviation of the length of the telomere for group, and assuming the minimal difference to agreeing between the groups as 5 Kb, the sample power is 85%.

Results

General characteristics

Patient characteristics of the different groups are shown in Table I. None of the diabetic patients had ketonuria or any history of diabetic ketosis at any time, and were treated with oral agents, sulphonylurea (glipizide or glibenclamide) and/or metformin. Hence, they all had Type 2 diabetes. Diabetic patients had significantly higher plasma glucose, HbA1c, serum cholesterol, triglycerides and HOMA-IR, compared with control subjects.

Table I. Descriptive statistics of anthropometric features in three groups.

	≥10 years Group A (n = 93)	≤1 year Group B (n = 96)	Without DM2 Group C (n = 98)	p Value
Age (years)	54.5 ± 6.9	54.4 ± 5.2	52.8 ± 5.9	0.70
Evolution time(years)	15.4 ± 3.3	0.5 ± 0.4	0.0	0.001^a
BMI (kg/m^2)	25.5 ± 3.3	27.8 ± 2.6	27.1 ± 4.8	0.30
Systolic B.P. (mmHg)	122.0 ± 14.8	121.0 ± 12.8	117.0 ± 12.5	0.80
Diastolic B.P. (mmHg)	79.0 ± 9.9	83.0 ± 9.5	79.0 ± 9.9	0.50
Glycemic profile
Glucose (mg/dl)	181.3 ± 106.2	171.7 ± 68.1	96.0 ± 8.0	0.001
Insulin (UI/ml)	13.0 ± 10.0	24.1 ± 15.5	15.5 ± 9.0	0.20
HOMA-IR	6.0 ± 5.0	9.1 ± 5.7	3.5 ± 1.8	0.03
HbA1C (%)	9.3 ± 2.3	8.4 ± 2.9	ND	0.30^a
Lipid profile
Triglycerides (mg/dl)	207.3 ± 91.4	300.8 ± 64.2	188.4 ± 86.3	0.60
Cholesterol (mg/dl)	188.5 ± 39.0	192.8 ± 41.2	193.5 ± 35.4	0.80
HDL (mg/dl)	37.7 ± 13.2	38.8 ± 7.0	35.8 ± 8.2	0.90
LDL (mg/dl)	109.3 ± 32.4	94.2 ± 43.8	120.0 ± 36.9	0.30
VLDL (mg/dl)	42.5 ± 17.8	59.9 ± 72.9	37.7 ± 17.3	0.50
Metabolic profile
Adiponectin (µg/ml)	11.3 ± 9.8	9.4 ± 5.2	ND	0.09^a
MDA(mmol/ml)	1.5 ± 3.0	0.8 ± 1.1	0.33 ± 0.35	0.03
IL-6(mmol/ml)	14.6 ± 8.5	17.0 ± 14.0	8.8 ± 10.0	0.9
TNF-α (pg/ml)	31.2 ± 18.1	13.8 ± 7.8	12.6 ± 11.7	0.02

Data shown as mean ± SD. Student’s t-test to determine the differences.

^aComparison was carried out using the Mann–Whitney U-test. (ND) data were non-determined.

Telomere length

In the present study, telomere length was determined from the peripheral blood in lymphocytes of a total of 287 males of the same age (53.9 ± 6 years), at two different stages in evolution of Type 2 Diabetes and healthy controls. Inter-individual differences in telomere length were clearly observed among these individuals studied. Our date revealed a significant shortening of telomere length in group A with longstanding type 2 diabetes compared with the controls (5.4 kb vs 9.5kb p = 0.04). Nevertheless in the group of diabetics of recent diagnosis had a non significant shortening (5.4kb vs 8.7kb p = 0.05) (Figure 1). We could demonstrate that the telomere is shorter in subjects in the group of diabetics with longer time of evolution compared to healthy subjects of the same age.

Figure 1. The length of telomeres was markedly shorter in the group with the longer evolution of Type 2 DM.

Lipid peroxidation and inflammation markers

With regard to inflammatory markers TNF-α and MDA peroxidation, we found significant differences with higher levels in the long-evolution group of patients with Type 2 DM. In these patients, adiponectin plasma levels were lower when compared to levels in controls (p = 0.03). In TNF-α levels, the group with the long evolution of Type 2 DM demonstrated significantly higher levels than the recently diagnosed group (p = 0.01) and of the control group (p = 0.001) (Table I).

Discussion

Telomere shortening seems to be a major component of cellular aging, both in vitro and in vivo [13,14]. There is evidence that telomere shortening increases progressively with the chronological age [15]. It is also known that some pathologies such as atherosclerosis and type 2 DM coincide with the shortening of the telomere [16,17]. Uziel O et al., suggest that diabetes is associated with premature cellular senescence, which can be prevented by good glycemic control in type 2 DM and reduced in type 1 DM. It is interesting that telomeres were found significantly shorter in the arteries of diabetic versus non-diabetic patients and in mononuclear cells of both–type 1 and type 2 diabetes [18].

We found that telomere length is shorter in patients with longstanding type 2 diabetes, and to a lesser extent in those with a shorter course of the disease. These findings had been described previously, but only in patients with type 2 diabetes, irrespective of the time length of the disease. There is no immediate explanation of the cause of this phenomenon, but the relative increase of oxidative markers observed in patients with longstanding of type 2 diabetes could be a contributing factor. Shortening of telomeres has been reported to be present in patients with chronic activation of inflammatory cells. The most significant finding was that observed in patients with more than 10 years after type 2 diabetes was diagnosed (Group A).

It is known that chronic oxidative stress accelerates cellular ageing and shortens telomere length [19,20]. Therefore, our findings support the fact that telomere shorting in longstanding diabetic patients might be caused, in part, by the action of oxidative stress. In contrast, telomeres of patients with less than one evolution of type 2 diabetes had no shortening when compared to the control group, perhaps due to a shorter time of exposure to oxidative stress.

The size of the telomere had not been explored during different times of evolution of Type 2 DM. In the present study, we were able to demonstrate that differences exist between the size of the telomere in patients with longstanding Type 2 DM and those recently diagnosed. In view of these results, we can suggest that the duration of DM contributes to telomere attrition by means of a multifactorial process, involving persistent inflammation. Telomere attrition has attracted attention as a possible associate of cardiovascular disease, vascular sequence, and vascular ageing and appears to be an age independent predictor of coronary mortality in adults [21–24].

The importance of telomere length as a marker of aging has been well established, but its function as a predictor of patient survival is still controversial. Cawthon et al. [25] performed a study in this respect where patients between 60 and 97 years of age were included, used DNA that had been stored 20 years previously. Results obtained led to the conclusion that telomere length can be considered as a predictor of survival. Bischoff et al. studied a larger population of subjects between 73 and 101 years of age with the same objective. They found a strong correlation between telomere length and survival time after taking samples. Subjects, more than 100 years of age were included at the beginning of the study. However, telomere length was not a better indicator than patient’s age, and for this reason the authors ruled out telomere length as a predictor of survival [26]. In our opinion, the results from Cawthon are more reliable because study subjects were observed from earlier ages until death [25]. In the study by Bischoff et al., only half of the patients died, which made it impossible to determine the outcome of the other patients [26].

Telomere attrition has been associated with hypertension, endothelial dysfunction, arterial stiffening, atherosclerosis, and cardiovascular mortality [27]. Diabetes is marked by increased oxidative stress and low-grade inflammation. Subjects with type 2 diabetes and microalbuminuria have shorter TRF length and increased arterial stiffness, than those without microalbuminuria. Additionally, TRF length is associated with age, and albumin excretion rate. As shorter TRF length indicates older biological age, the increased arterial stiffness in patients with type 2 diabetes who have microalbuminuria, may be due to the more pronounced “aging” of these subjects [28].

It has been well established that diabetics have multiple associated diseases such as atherosclerosis, renal insufficiency, myocardial infraction and shorter telomere for a shorter lifespan [28]. It is likely that the accelerated shortening of telomeres in these patients has a direct relationship with those pathologies as well as with premature ageing [29,30]. It remains to be established if telomere shortening changes with the severity of the disease or with appropriate medical control. Maeda et al., investigating the correlation between clinical laboratory data and telomeric status of male patients with metabolic disorders and no clinical history of vascular events, assessed all correlations between the laboratory data and the telomeric parameters. The patients showed a significant negative correlation among the bilirubin and creatine phosphokinase with the aging-associate change of the telomeric and subtelomeric parameters. Lowered serum bilirubin and creatinine phosphokinase levels correlated to genomic aging represented by telomere attrition of patients with metabolic disorders [31].

Interestingly, the telomeric shortening and highest levels of TNF α found were in the diabetic group with long time evolution, and this same group also had lower ADPN levels. We could demonstrate that the telomere is shorter in subjects in the group of diabetics with more time of evolution compared to healthy subjects of the same age. In view of our findings we could conjecture that telomeric shortening could be modulated by Oxidative DNA damage. O S Al et al., investigated the significant positive association of adiponectin to telomere length, and suggests that adiponectin may be an anti-aging agent by way of improving insulin sensitivity, decreasing inflammation and cell oxidative function, and reversing endothelial dysfunction [32].

In our study, the time of exhibition suggests in parallel, that the progressive increase of inflammation and/or oxidative stress plays a direct role in telomere shortening. Further investigation is needed to find out if telomere length can be used as a marker of the severity and progression of type 2 DM.

Declaration of interest: The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.