Hydroxysafflor yellow A suppresses liver fibrosis induced by carbon tetrachloride with high-fat diet by regulating PPAR-γ/p38 MAPK signaling

Abstract

Context: One approach to protect against liver fibrosis is the use of herb-derived natural compounds, such as hydroxysafflor yellow A (HSYA). The antifibrosis effect of HYSA against liver fibrosis has been investigated; however, its mechanisms have not yet been entirely revealed.

Objectives: To study the protective effects of HSYA on liver fibrosis induced by carbon tetrachloride (CCl₄) and a high-fat diet (HFD), and to determine the mechanism of action of HSYA.

Materials and methods: CCl₄ and HFD were used to mimic liver fibrosis in rats, and serum biochemical indicators were determined. The antifibrosis effects of HSYA were evaluated and its mechanisms were investigated by histopathological analysis, immunohistochemical staining, enzyme-linked immunosorbent assays, real-time-PCR, and western blotting.

Results: HSYA reduced CCl₄- and HFD-mediated liver fibrosis and ameliorated serum biochemical indicator, downregulated the expression of tissue inhibitor of metalloproteinase-1 (TIMP-1) (0.31 ± 0.03 protein, 0.59 ± 0.02 mRNA) and transformin growth factor-β1 (TGF-β1) (0.81 ± 0.02 protein, 0.58 ± 0.04 mRNA), and upregulated the expression of peroxisome proliferator-activated receptor-γ (PPAR-γ) (1.57 ± 0.13 protein, 2.48 ± 0.19 mRNA) and matrix metallopeptidases-2 (MMP-2) (2.31 ± 0.16 protein, 2.79 ± 0.22 mRNA) (p < 0.01, versus model group). These effects were significantly attenuated by PPAR-γ antagonist GW9662 via blocking the phosphorylation of p38 MAPK.

Discussion and conclusion: These data demonstrate a novel role for HSYA in inhibiting CCl₄- and HFD-mediated liver fibrosis, and reveal that PPAR-γ and p38 MAPK signaling play pivotal roles in the prevention of liver fibrosis induced by CCl₄ and HFD.

• CCl₄
• hepatic fibrosis
• herb
• HFD
• HSYA
• peroxisome proliferator-activated receptor-γ

Introduction

Liver fibrosis is characterized by the excessive accumulation of extra-cellular matrix (ECM), ultimately leading to liver dysfunction and irreversible cirrhosis (Friedman, 2003). The possibility that liver fibrosis is reversible has motivated us to explore effective treatments for this disease (Povero et al., 2010). Kohli et al. (2010) demonstrated that long-term consumption of a high-fat diet (HFD) could cause liver fibrosis through the generation of excessive reactive oxygen species and collagen deposition. In addition, it was previously reported that the repeated administration of carbon tetrachloride (CCl₄) to HFD-fed obese mice induced chronic oxidative stress that triggered inflammation and apoptosis, leading to fibrosis development in the liver (Kohli et al., 2013). Previous studies have shown that many strategies can effectively alleviate liver fibrosis (Comporti et al., 2008; Iimuro & Brenner, 2008). Despite these advances, the identification of a universally effective therapeutic drug for chronic liver injury and fibrotic progression remains a major medical challenge (Wang et al., 2010; Yang et al., 2008).

Previous studies have demonstrated that many natural compounds derived from herbs can reduce the severity of hepatic fibrosis in vivo and in vitro (Lee et al., 2012; Wang et al., 2010; Yu et al., 2012). Hydroxysafflor yellow A (HSYA) is an active ingredient of the herb Carthamus tinctorius L. (Asteraceae) (safflower) (Sun et al., 2012). HSYA is used extensively in traditional Chinese medicine for the treatment of cirrhosis, cerebrovascular, and cardiovascular diseases (Tien et al., 2010). Although previous studies have shown that HSYA was able to protect rat liver from CCl₄-mediated fibrogenesis (Li et al., 2012; Zhang et al., 2011), we wished to determine whether HSYA was also able to attenuate CCl₄- and HFD-induced liver fibrosis via a related mechanism.

Peroxisome proliferator-activated receptor gamma (PPAR-γ) is a ligand-activated transcription factor that is a member of the nuclear receptor superfamily, and has been reported to be a key transcriptional regulator in the reversal of activated hepatic stellate cell (HSC) morphology to the quiescent phenotype (Lee et al., 2003; Zhou et al., 2010). There is significant evidence suggesting that PPAR-γ might be a potential molecular target for anti-inflammatory therapies (She et al., 2005). Our previous study demonstrated that HSYA significantly increased PPAR-γ expression, alleviated liver injury, and reduced the proliferation of HSCs induced by CCl₄. These protective effects were blocked by the use of GW9662 as a specific antagonist of PPAR-γ (Wang et al., 2013). Seth et al. (2013) demonstrated that there was a significant downregulation of PPAR-γ in diet-induced obese (DIO) mice exposed to bromodichloromethane. However, the effect of CCl₄ on the expression of PPAR-γ in rats following the long-term consumption of an HFD is not known.

p38 MAP kinase (MAPK) is a member of a family of serine/threonine protein kinases associated with many cellular functions, including gene expression, immune response, cell proliferation, apoptosis, and response to oxidative stress. Li et al. (2013) showed that inhibition of p38 MAPK activation could suppress collagen production of activated HSCs. The activation of p38 MAPK was demonstrated in livers of HFD-fed mice, providing preliminary evidence for the involvement of p38 MAPK in HFD-induced hepatic steatosis (Sinha-Hikim et al., 2011). We hypothesized that p38 MAPK might play a key role in the ability of HSYA to mitigate the symptoms of hepatic fibrosis. In this study, we investigated the protective effects of HSYA on CCl₄- and HFD-mediated liver injury, and revealed a role for p38 MAPK and PPAR-γ in the mechanism of action of this natural product.

Materials and methods

Reagents

HSYA (purity >98%), extracted from C. tinctorius was a water soluble, yellow amorphous powder, was provided by Dr. Da Lei Zhang, Shandong Natural Drugs Research & Development Center (Shandong Province, China). HSYA was extracted and analyzed according to the method described previously (Wang et al., 2013). CCl4 and GW9662 were purchased from Sigma-Aldrich Co. (St Louis, MO).

Animals and treatments

Fifty male Sprague–Dawley rats weighing 200 ± 20 g were purchased from the Experimental Animal Department of Shandong Luye-Pharmaceutical Co. Ltd. (Shandong Province, China). Animals were maintained individually under controlled temperature (20 ± 3 °C) and humidity (50 ± 10%) with a 12 h light/dark cycle, and had free access to food and water. After a period of 1 week, the animals were randomly divided into five groups, consisting of 10 rats per group: (1) normal (control) group; (2) model group; (3) HSYA + GW9662 group; (4) HSYA group; and (5) GW9662 group. Except for the control group, all rats were treated with intragastric administration of 30% CCl₄ (dissolved in olive oil, v/v) at 1.0 ml/kg every other day for 8 weeks, and were fed an HFD (71% fat, 11% carbohydrates, 18% protein). Rats in the control group were fed a normal diet and received olive oil by gavage every other day for 8 weeks. Animals in groups 3–5 were administered HYSA at 10 mg/ml and GW9662 at 3 mg/ml by intraperitoneal injection daily for 8 weeks. HSYA was dissolved in saline solution. GW9662 was dissolved in fresh dimethyl sulfoxide (DMSO) and diluted in saline solution for injection. The optimal dose of HSYA was chosen based on our previous study (Wang et al., 2013). Upon completion of the experiments, all rats were anesthetized and sacrificed. Blood samples were collected, and serum was separated by centrifugation at 4 °C. The liver from each rat was removed and rinsed with cold phosphate-buffered saline (PBS). Portions of the liver were fixed in paraformaldehyde for histopathology and the remaining tissue was stored in liquid nitrogen until assayed. Animal care and experimental procedures were approved by the Ethics Committee for Animal and Human Experimentation of Binzhou Medical University in accordance with the National Institutes of Health Guide for Care and Use of Laboratory Animals (Publication no. 85-23, revised 1985).

Biochemical analysis

The levels of hyaluronic acid (HA), laminin (LN), type III collagen (III-C), type IV collagen (IV-C), and the activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum were measured according to the procedures described in the manufacturer’s assay kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, PR China). Hydroxyproline levels in the liver tissue were analyzed using a colorimetric kit (Cayman Chemical, Ann Arbor, MI).

Histological and immunohistochemical analysis

Liver tissues were fixed in paraformaldehyde and embedded in paraffin. Paraffin sections (3 µm thick) were stained with hematoxylin and eosin (H&E) or with Masson’s trichrome to determine the degree of necroinflammatory liver injury and collagen distribution, which were performed by an independent pathologist under blinded conditions (Peng et al., 2013). Immunohistochemical detection of TIMP-1, MMP-2, and TGF-β1 was performed using an SP kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, PR China) according to the manufacturer’s instructions. The primary antibodies used were rabbit polyclonal anti-TGF-β1, anti-TIMP-1, and anti-MMP-2 (1:50 dilution; Santa Cruz Biotechnology, Santa Cruz, CA). The secondary antibody was peroxidase-conjugated AffiniPure goat anti-rabbit IgG (1:200 dilution; Bioworld Biotechnology, Dublin, OH). After immunostaining, sections were counterstained with hematoxylin.

Enzyme-linked immunosorbent assay

Liver tissue homogenates were prepared in RIPA buffer, and TGF-β1 or tumor necrosis factor alpha (TNF-α) levels were determined using commercial enzyme-linked immunosorbent assay (ELISA) kits (R&D Systems, Minneapolis, MN) according to the manufacturer’s recommendations.

Total RNA extraction and real-time (RT)-PCR

Total RNA was extracted from liver tissue using Trizol reagent (TaKaRa, Shiga, Japan) according to the manufacturer’s instructions. RNA purity and concentration were determined by optical density at 260 nm and 280 nm, respectively. The mRNAs were then reverse transcribed directly into cDNAs using a PrimeScript RT Reagent Kit (TaKaRa, Shiga, Japan) with a Bio-Rad iCycler iQ5 Real-time Detection System (Bio-Rad Laboratories, Hercules, CA). The cDNA PCR amplification conditions were as follows: initial denaturation at 95 °C for 5 s followed by 40 cycles of denaturation at 95 °C for 5 s and annealing at 60 °C for 20 s. Gene expression levels were normalized to GAPDH mRNA. PCR primers were synthesized by Sangon Biotech Co. Ltd. (Shanghai, China). Primer sequences were as follows (shown as 5′–3′):

PPARγ (NM_013124.3) sense primer: CACTCGCATTCCTTTGACATC, PPARγ antisense primer: CGCACTTTGGTATTCTTGGAG; TGF-β1 (NM_021578.2) sense primer: GTGTGGAGCAACATGTGGAACTCTA, TGF-β1 antisense primer: TTGGTTCAGCCACTGCCGTA; TIMP-1 (NM_053819.1) sense primer: TGGCATCCTCTTGTTGCTATC, TIMP-1 antisense primer: CGAATCCTTTGAGCATCTTAGTC; MMP-2 (NM_031054.2) sense primer: GTGTCTTCCCCTTCACTTTTC, MMP-2 antisense primer: CATCATCGTAGTTGGTTGTGGT; GAPDH (NM_017008.4) sense primer: ACAGCAACAGGGTGGTGGAC, GAPDH antisense primer: TTTGAGGGTGCAGCGAACTT.

Fluorescence data from each sample were analyzed by the 2^−ΔΔCt method (Yu et al., 2012).

Western blotting analysis

Total protein extracts were obtained by homogenization of liver tissues as previously described (Trebicka et al., 2010). Protein concentration was determined using BCA Reagent (Sigma-Aldrich, Steinheim, Germany). Equal amounts of the samples (50 µg) were separated in 10% SDS-PAGE gels and proteins were electrophoretically transferred onto polyvinylidene fluoride (PVDF) membranes (Bio-Rad, Hercules, CA). After blocking with 5% non-fat dry milk in Tris-buffered saline, membranes were incubated with primary antibodies against p38 MAPK, phospho-p38 MAPK, PPAR-γ (Santa Cruz Biotechnology, Santa Cruz, CA), or β-actin (Bioworld Biotechnology, Atlanta, GA) (used as a sample loading control) overnight at 4 °C, and then incubated with horseradish peroxidase-conjugated secondary antibody (Beijing Zhongshan Golden Bridge Biotechnology Co. Ltd., Beijing, China). Target protein bands were visualized by using ECL detection kit (Thermo Scientific, Rockford, IL) according to the manufacturer’s instructions.

Statistical analysis

Data are presented as means ± SD. The results were analyzed by a one-way analysis of variance (ANOVA). Dunnett’s test was used for multiple comparisons (SPSS13.0 software, SPSS Inc., Chicago, IL). Differences were considered to be statistically significant if the p value was less than 0.05.

Results

HSYA ameliorates liver function

Compared with the normal group, the levels of LN, HA, III-C, IV-C, and the activities of ALT and AST in serum were significantly elevated after treatment with CCl₄ and HFD. Similarly, the hydroxyproline content in liver tissue was also elevated in HFD-fed rats treated with CCl₄. The levels of each of these parameters were further increased by treatment with PPAR-γ antagonist GW9662. HSYA treatment significantly alleviated CCl₄- and HFD-mediated liver injury in rats, and attenuated the effects of GW9662 on liver function (Tables 1 and 2).

Table 1. Effects of hydroxysafflor yellow A (HSYA) on levels of biological parameters in rat models of liver injury.

Group	HA (ng/ml)	LN (ng/ml)	III-C (ng/ml)	IV-C (ng/ml)
Normal	45.06 ± 4.05	14.85 ± 2.69	8.67 ± 1.92	22.76 ± 2.73
Model	513.6 ± 32.41^Δ	80.27 ± 12.29^Δ	38.62 ± 7.07^Δ	74.70 ± 10.05^Δ
HSYA+GW9662	334.9 ± 31.37^+#	50.50 ± 9.16^++#	28.18 ± 3.92^++#	49.87 ± 8.09^++#
HSYA	286.2 ± 7.49*	38.27 ± 4.88*	19.93 ± 3.24*	36.30 ± 7.58*
GW9662	553.4 ± 33.24^+*	90.81 ± 7.28^+**	45.25 ± 6.82^+**	92.67 ± 10.01^+*

Rats (n = 10 per group) were treated according to the procedures described in the Methods section, and serum levels of hyaluronic acid (HA), laminin (LN), type III collagen (III-C), and type IV collagen (IV-C) were measured. Data are presented as mean ± SD. ^Δp < 0.01 versus normal group; *p < 0.01 and **p < 0.05 versus model group; ⁺p < 0.01 and ⁺⁺p < 0.05 versus HSYA group; #p < 0.01 versus GW9662 group.

Table 2. Effects of hydroxysafflor yellow A (HSYA) on the activities of ALT and AST, and the levels of hydroxyproline in serum and liver in rat models of liver injury.

Group	Plasma ALT (U/l)	Plasma AST (U/l)	Hydroxyproline (μg/mg)
Normal	80.04 ± 8.99	26.69 ± 5.80	0.27 ± 0.03
Model	170.8 ± 12.46^Δ	83.39 ± 9.38^Δ	0.74 ± 0.05^Δ
HSYA+GW9662	155.8 ± 9.42^++#	65.26 ± 10.61^++#	0.57 ± 0.06^++#
HSYA	137.7 ± 10.15*	46.97 ± 10.69**	0.42 ± 0.07*
GW9662	189.2 ± 10.38^+**	108.5 ± 22.46^+*	1.08 ± 0.22^+*

Rats (n = 10 per group) were treated according to the procedures described in the Methods section. Hydroxyproline levels in liver tissue and the activities of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) in serum were measured. Data are presented as mean ± SD. ^Δp < 0.01 versus normal group; *p < 0.01 and **p < 0.05 versus model group; ⁺p < 0.01 and ⁺⁺p < 0.05 versus HSYA group; #p < 0.01 versus GW9662 group.

HSYA alleviates hepatic fibrosis induced by CCl₄ with HFD

H&E and Masson’s trichrome staining of liver sections were performed to evaluate histopathological changes. As shown in Figure 1, histological examination of liver sections from rats in the untreated control group revealed normal liver morphology. In contrast, the CCl₄ with HFD treatment groups showed typical damage in the liver structure, including hepatic steatosis, necrotic granulomas, infiltration of inflammatory cells, and collagen deposition with pseudo-lobe formations. As expected, these effects were markedly attenuated by HSYA treatment. Compared with the model group, GW9662 clearly enhanced the liver damage induced by CCl₄ with HFD. The negative effects of GW9662 on the liver were reversed by HSYA treatment.

Figure 1. Antifibrotic properties of hydroxysafflor yellow A (HSYA) on histological assessment of liver fibrosis in CCl₄ with HFD-treated rats. Rats were treated according to the procedures described in the Methods section. Paraffin sections of livers from treated rats were stained with hematoxylin and eosin (H&E) or Masson’s trichrome. Panels (A)–(E) show representative images of liver sections stained with H&E from the normal group, model group, HSYA+GW9662 group, HSYA group, and GW9662 group, respectively. Panels (a)–(e) are images of sections stained with Masson’s trichrome from the normal group, model group, HSYA+GW9662 group, HSYA group, and GW9662 group, respectively. Images were taken and analyzed using Image-Pro plus system (Media Cybernetics, Inc, Rockville, MD) (original magnification 200×).

HSYA inhibits pro-fibrotic cytokines TGF-β1 and TNF-α in liver tissue

The levels of TGF-β1 and TNF-α in the model group treated with CCl₄ with HFD were significantly increased compared with the normal group, and were further enhanced with GW9662. As shown in Figure 2, HSYA efficiently reduced the levels of TGF-β1 and TNF-α, and diminished the effects of GW9662 on expression of these proteins.

Figure 2. Effects of hydroxysafflor yellow A (HSYA) on the levels of TGF-β1 and TNF-α in liver homogenates. Levels of TGF-β1 and TNF-α were determined using the ELISA assay kit (R&D Systems, Minneapolis, MN). The data are expressed as mean ± SD. ^Δp < 0.01 versus normal group; *p < 0.01 and **p < 0.05 versus model group; ⁺p < 0.01 and ⁺⁺p < 0.05 versus HSYA group; #p < 0.01 and ##p < 0.05 versus GW9662 group.

HSYA reduces mRNA expression levels of pro-fibrotic factors and elevates hepatoprotective factors in chronic CCl₄/HFD-induced liver injury

The expression of target genes such as TIMP-1, TGF-β1, MMP-2, and PPAR-γ were analyzed using RT-PCR. The results indicated that the pro-inflammatory mediators TIMP-1 and TGF-β1 in liver tissue were increased after the administration of CCl₄ with HFD compared with the normal group; however, both these proteins were substantially downregulated by HSYA treatment (Figure 3). CCl₄ with HFD reduced the expression of the hepatoprotective factors MMP-2 and PPAR-γ compared with the normal group, while these effects were significantly reversed by HSYA. Compared with the model group, the PPAR-γ antagonist GW9662 further induced the expression of TIMP-1 and TGF-β1 mRNAs, and suppressed the expression of MMP-2 and PPAR-γ mRNAs.

Figure 3. Effects of hydroxysafflor yellow A (HSYA) on mRNA expression of liver fibrosis-related genes TIMP-1, TGF-β1, MMP-2, and PPAR-γ. Total RNA was extracted from liver tissues from treated rats, and cDNA was synthesized. The mRNA levels were detected by real-time PCR. The data are expressed as mean ± SD. ^Δp < 0.01 versus normal group; *p < 0.01 and **p < 0.05 versus model group; ⁺p < 0.01 and ⁺⁺p < 0.05 versus HSYA group; #p < 0.01 versus GW9662 group.

HSYA mediates TIMP-1, MMP-2, and PPAR-γ protein expression and inhibits p38 MAPK phosphorylation

To further elucidate the mechanisms underlying the antifibrotic properties of HSYA, we measured the levels of TIMP-1, MMP-2, PPAR-γ, and p38 MAPK in HSYA-treated and untreated groups by western blotting and immunohistochemical analysis. We found that CCl₄ with HFD suppressed the expression of MMP-2 and PPAR-γ and enhanced TIMP-1 expression in liver tissue, while HSYA treatment noticeably reversed the expression of fibrogenic-related genes at the protein level (Figures 4 and 5). These data were consistent with the RT-PCR results. To elucidate the relationship between the activity of PPAR-γ and the p38 MAPK signaling pathway with respect to the hepatoprotective mechanism of HSYA, we examined the phosphorylation of p38 MAPK in liver tissues. As shown in Figure 5(a) and (b), the level of phosphorylated p38 MAPK was dramatically increased in the GW9662 group compared with the model group. HSYA significantly decreased the levels of phosphorylated p38 MAPK, markedly reversing the negative effects of PPAR-γ antagonism. Increased levels of phospho-p38 MAPK were not due to an increase in total p38 MAPK, since the total levels of this protein were unchanged by HSYA.

Figure 4. Effects of hydroxysafflor yellow A (HSYA) on TIMP-1 and MMP-2 protein expression. TIMP-1 and MMP-2 in liver sections were examined by immunohistochemistry and observed using a light microscopy at 400× magnification. Panels (A)–(E) represent TIMP-1 expression in the normal group, model group, HSYA+GW9662 group, HSYA group, and GW9662 group, respectively. Panels (a)–(e) represent MMP-2 expression in the normal group, model group, HSYA+GW9662 group, HSYA group, and GW9662 group, respectively. Results are expressed as fold increase over the control group. ^Δp < 0.01 versus normal group; *p < 0.01 versus model group; ⁺p < 0.01 and ⁺⁺p < 0.05 versus HSYA group; #p < 0.01 versus GW9662 group.

Figure 5. Effects of hydroxysafflor yellow A (HSYA) on p38, phospho-p38, and PPAR-γ protein expression. Proteins were isolated from livers and expression levels were determined by western blotting. Protein levels were quantified by densitometric scanning from five independent experiments. β-Actin was used as an internal control for equal loading. A representative study from five experiments is shown. Data are expressed as mean ± SD. ^Δp < 0.01 versus normal group; *p < 0.01 and **p < 0.05 versus model group; ⁺p < 0.01 and ⁺⁺p < 0.05 versus HSYA group; #p < 0.01 versus GW9662 group.

Discussion

Although numerous Western medications have been used to inhibit the progression of hepatic fibrosis (Zeng et al., 2011), none have achieved satisfactory therapeutic effects. Therefore, we have focused on traditional Chinese herbal medications, which generally have negligible side effects compared with Western medications. HSYA extracted from the flower of C. tinctorius (safflower) could effectively inhibit liver fibrosis induced by chronic administration of CCl₄ (Zhang et al., 2011). It was recently demonstrated that an HFD was correlated with the likelihood of progression from benign steatosis to non-alcoholic steatohepatitis and non-alcoholic fatty liver disease (NAFLD), as a result of oxidative stress and inflammation. Previous studies have shown that antioxidant compounds derived from natural herbs can remarkably reduce fibrosis, oxidative stress, and inflammation of NAFLD induced by an HFD in rats (Kohli et al., 2013; Xiao et al., 2013). However, the effect of HSYA on CCl₄- and HFD-mediated liver fibrosis has not previously been examined. Our study was designed to investigate the protective effects of HSYA and reveal the involvement of candidate genes and pathways in the inhibition of hepatic fibrosis.

Based on the “two-hit” theory, rats were fed with an HFD (first hit) and administered CCl₄ (second hit) to induce oxidative stress in the liver (Kohli et al., 2013). We showed that long-term consumption of an HFD and subsequent chronic oxidative stress induced by multiple CCl₄ administrations led to liver fibrosis, and that HSYA ameliorated CCl₄- and HFD-mediated liver fibrosis and improved liver function. We found that HSYA dramatically decreased the activities of AST and ALT liver function biomarkers in serum, which were elevated by the administration of CCl₄ and long-term HFD consumption. Hydroxyproline, LN, HA, III-C, and IV-C are considered to be important indices reflecting the degree of hepatic fibrosis (Hayasaka & Saisho, 1998; Murawaki et al., 1996). In the present study, we found that CCl₄ in combination with an HFD increased the levels of these markers in serum or hepatic tissues, and that these effects were significantly attenuated by HSYA. Furthermore, histopathological analyses demonstrated that HSYA significantly ameliorated the degree of necroinflammatory liver injury and collagen deposition, as assessed by H&E and Masson’s trichrome staining.

TGF-β1 and TNF-α are recognized as the most potent and ubiquitous factors in chronic liver injury (Domitrovi et al., 2011; Lewindon et al., 2002; Trebicka et al., 2010). TGF-β1 is involved in many cellular processes, including HSC proliferation, differentiation, and death. TGF-β1 also mediates the production and deposition of collagens in the liver, and triggers multiple Smad signaling pathways in liver fibrosis (Inagaki & Okazaki, 2007). Hepatocyte necrosis and apoptosis are caused by noxious stimuli that promote liver inflammation and the production of TNF-α by Kupffer cells, which in turn activate HSCs, resulting in liver fibrogenesis (Canbay et al., 2003). Previous studies demonstrated that long-term HFD-feeding induced steatohepatitis associated with increased TGF-β1 and TNF-α production (Ishihara et al., 2012). In our study, the levels of TGF-β1 and TNF-α in the model group were significantly higher than those in the normal control group and were dramatically increased by GW9662. However, the upregulation of these pro-fibrotic cytokines and the negative effects of GW9662 were markedly reversed by treatment with HSYA.

Matrix metalloproteinases (MMPs) are a family of zinc metallo-endopeptidases that promote ECM degradation. TIMPs are tissue-specific MMP inhibitors that bind to active sites of MMPs in hepatic fibrosis (Cheung et al., 2009). Under physiological conditions, MMPs and TIMPs are in homeostasis. However, during the development of liver fibrosis, MMP activity is substantially reduced, which results in an accumulation of ECM due to its increased synthesis and decreased degradation (Lin et al., 2012). Using immunohistochemical staining, we found that CCl₄ with an HFD significantly inhibited MMP-2 expression and enhanced TIMP-1 expression, while these effects were completely reversed by HSYA. We also observed that HSYA upregulated MMP-2 expression and downregulated TIMP-1 expression at the mRNA level. These data indicate that HSYA can effectively promote ECM degradation and block liver fibrosis by increasing MMP-2 expression and decreasing TIMP-1 expression at the protein or gene level.

PPAR-γ is a nuclear hormone receptor in the ligand-dependent transcription factor superfamily and is involved in the activation and apoptosis of HSCs. Previous studies have demonstrated that the level of PPAR-γ was high in quiescent HSCs, but that its expression and activity were reduced during HSC activation in vitro and in vivo (Miyahara et al., 2000; She et al., 2005). Furthermore, PPAR-γ overexpression in vivo significantly attenuated hepatic fibrosis (Yang et al., 2006). Based on these studies, PPAR-γ has been proposed to play a key role in the inhibition of liver fibrosis. In this study, we demonstrated that HSYA notably increased PPAR-γ expression, reversing the inhibition of PPAR-γ protein and mRNA expression resulting from treatment with CCl₄ and HFD, as well as PPAR-γ antagonist GW9662. Similar results were obtained previously (Wang et al., 2013). In addition, the effect of HSYA on TIMP-1 and MMP-2 can be significantly reversed by GW9662 at the protein or gene level. These results demonstrate that PPAR-γ is an important factor in HSYA-mediated inhibition of hepatic fibrosis.

p38 MAPK is a member of a class of evolutionarily conserved serine/threonine mitogen-activated protein kinases. p38 MAPK is involved in the regulation of proinflammatory cytokines such as TGF-β1 and TNF-α, and exhibits an inverse relationship with hepatocyte proliferation (Awad et al., 2000; Goldstein et al., 2010). Previous studies have demonstrated that the protective effect of HSYA against LPS-induced acute lung injury was associated with the significant inhibition of p38 MAPK phosphorylation in vitro and in vivo (Song et al., 2013; Sun et al., 2010). He et al. (2008) revealed that the non-receptor tyrosine phosphatase Shp2 promotes adipogenesis through the Shp2-p38MAPK-p300-PPARγ signaling pathway, by inhibiting the phosphorylation of p38 MAPK and enhancing PPAR-γ expression. Consistent with this, the PPAR-γ agonist rosiglitazone has been shown to downregulate gonadotropin-releasing hormone-mediated phosphorylation of p38 MAPKs in LbT2 cells (Sakaida et al., 2004). In addition, Yan et al. (2013) reported that obesity-related glomerulopathy may be caused in part by suppressed PPAR-γ expression and increased p38 MAPK activation. Accordingly, we hypothesized that HSYA ameliorated hepatic fibrosis through regulation of the PPAR-γ/p38 MAPK pathway. We demonstrated that p38 MAPK was activated following administration of CCl₄ in HFD-fed rats, and that PPAR-γ antagonist GW9662 further increased levels of phospho-p38 MAPK. Nevertheless, HSYA significantly alleviated CCl₄- and HFD-mediated liver injury, suppressed p38 MAPK activation, and markedly reversed the negative effects of a PPAR-γ antagonist. Hence, targeting of PPAR-γ/p38 MAPK signaling events may be a potential therapeutic option by which HSYA ameliorates hepatic fibrosis, and warrants further exploration.

In conclusion, our study demonstrated that HSYA dramatically inhibited CCl₄- and HFD-induced liver fibrosis by decreasing the expression of pro-inflammatory and pro-fibrogenic cytokines, and by promoting the expression of PPAR-γ, leading to inhibition of p38 MAPK phosphorylation. We have reported for the first time that PPAR-γ is involved in the regulation of p38 MAPK phosphorylation in the pharmacological mechanism of HSYA. The mechanistic data from our study provide important insights into the role of PPAR-γ/p38 MAPK signaling on the antifibrotic properties of HSYA.

Declaration of interest

The authors report no conflicts of interest. The authors alone are responsible for the content and writing of this article. This study was supported by the National Natural Science Foundation of China (No. 81073123).