Interleukin-13 Induces Mucin 5AC Production Involving STAT6/SPDEF in Human Airway Epithelial Cells

Abstract

Mucus hypersecretion is commonly observed in many chronic airway inflammatory diseases. Mucin 5AC (MUC5AC) is a major airway mucin because of its high expression in goblet cells. Here, the authors identified a gene called SAM domain–containing prostate-derived Ets factor (SPDEF) that was induced by interleukin (IL)-13. Their results showed that specific knockdown of SPDEF reduced IL-13-induced MUC5AC expression in human airway epithelial cells. This finding was associated with decreased expression of anterior gradient 2 (AGR2) and Ca²⁺-activated Cl⁻ channel (CLCA1), which regulate IL-13-mediated MUC5AC overproduction. Furthermore, transfection with SPDEF siRNA enhanced expression of forkhead box a2 (Foxa2), a key transcription factor that is known to prevent mucus production. The authors also demonstrated that the repression of STAT6 inhibited expression of SPDEF and MUC5AC induced by IL-13. These results show that SPDEF plays a critical role in regulating a transcriptional network mediating IL-13-induced MUC5AC synthesis dependent on STAT6.

Keywords::

• anterior gradient 2
• Ca²⁺-activated Cl-channel
• forkhead box a2
• interleukin-13
• mucin
• SAM domain–containing prostate-derived Ets factor

INTRODUCTION

Mucus hypersecretion is a clinically important feature of several major airway diseases, including chronic obstructive pulmonary disease (COPD), cystic fibrosis, asthma, and bronchiectasis (Rose and Voynow 2006; Caramori et al. 2009; Hogg et al. 2004). Excessive mucus in airways has been linked to increased frequency and duration of infection, morbidity, and mortality and decline in lung function in respiratory diseases (Vestbo 2002). In asthmatic patients, mucus plugging in the airway lumen has been reported as a major contributing factor to fatal asthma (Kuyper et al. 2003). Interleukin (IL)-13 is a cytokine produced by T-helper type 2 (Th2) cells and other cells recruited to the lung during allergic and inflammatory responses. Studies of mouse allergic airway disease models show that IL-13 is required for allergen-induced airway inflammation and mucus production (Grunig et al. 1998; Wills-Karp et al. 1998; Whittaker et al. 2002; Lai and Rogers 2010; Kettle et al. 2010). Previous studies have shown that mucus production in mouse airways induced by IL-13 is critically dependent on the expression of the IL-13 receptor and the IL-13 signaling molecule signal transducer and activator of transcription 6 (STAT6) in airway epithelial cells (Kuperman et al. 2002, 2005). STAT6 pathways are involved in allergen-induced airway hyperreactivity and mucus production (Kuperman et al. 1998; Akimoto et al. 1998). However, the downstream molecular mechanisms of STAT6 mediated by IL-13 regulation of mucus hypersecretion have not been fully demonstrated.

In airways, both in physiological and pathological conditions, mucus is produced by mucus-secreting cells present in the surface epithelium and submucosal glands, and the primary source of mucus is the goblet cells (Ordoñez et al. 2001; Rogers 2003; Caramori et al. 2009). In healthy individuals, a few mucus-producing cells are present distal to the trachea (Williams et al. 2006); however, in asthma and COPD patients, elevated numbers of goblet cells are coupled with excessive mucus production. The increase in the numbers of goblet cells is often termed goblet cell hyperplasia (GCH) or metaplasia. Goblet cells can rapidly secret mucus in response to certain stimuli by exocytosis to form a mucus layer that lines the airways (Rogers 2007). In ovalbumin-sensitized mice treated with a solubilized version of the IL-13 receptor, or in IL-13-deficient mice, goblet cell formation is either absent or strongly attenuated (Kumar et al. 2002). Mucin 5AC (MUC5AC) and MUC5B are major components of airway mucus produced by mucus-secreting cells (Hovenberg et al. 1996a, 1996b; Davies et al. 2002). MUC5B is mainly expressed in airway submucosal glands, which are restricted to more proximal, cartilaginous airways. In contrast, MUC5AC expression is generally restricted to goblet cells in upper and lower respiratory tracts (Reid et al. 1997). A few goblet cells are present in untreated cultures, but treatment with IL-13 results in up to a 10-fold increase in the density of goblet cells together with increased expression of MUC5AC (Atherton et al. 2003). These studies indicate a central role for IL-13 in mediating goblet cell formation in both an in vivo model of allergic asthma and an in vitro model of human respiratory epithelium. The transcription factor SPDEF (SAM [sterile α-motif] domain–containing prostate-derived Ets factor) has been implicated in regulating airway GCH. Chronic expression of SPDEF in epithelial cells of the mouse lung is associated with extensive goblet cell differentiation in the airways of transgenic mice (Park et al. 2007). It was reported that increased expression of SPDEF was found in the respiratory epithelium of mice stimulated by either IL-13 or an allergen and was associated with GCH. SPDEF appears to function downstream of STAT6, as the authors reported that IL-13-induced SPDEF expression was absent in STAT6-knockout mice. Chen and colleagues demonstrated that a deletion of the mouse SPDEF gene resulted in the absence of goblet cells in tracheal/laryngeal submucosal glands and in the conducting airway epithelium after pulmonary allergen exposure in vivo (Chen et al. 2009). Lentiviruses that expressed mouse SPDEF or green fluorescent protein (GFP; control) protein were used to infect NCI-H292 cells. After 5 days, MUC5AC mRNA increased approximately 12-fold in the cells expressing SPDEF, compared with the level in uninfected cells or cells expressing GFP.

Excessive mucus secretion is implicated in almost all chronic pulmonary diseases. IL-13 is a critical stimulus that up-regulates mucus production. Furthermore, in recent years, research has focused on the molecular effects of IL-13 on MUC5AC expression. The present study was undertaken to identify the role and mechanism of SPDEF that mediates IL-13-regulated MUC5AC expression in 16HBE cells. SPDEF small interfering RNA (siRNA) was transfected into 16HBE human bronchial epithelial cells before IL-13 stimulation. MUC5AC synthesis and the expression of the genes associated with MUC5AC biosynthesis were detected, respectively. Additionally, STAT6 siRNA was used to identify whether the effects of SPDEF on IL-13-induced MUC5AC expression was STAT6 dependent. We found that the transcription factor SPDEF may be a potential candidate that prevents mucus hypersecretion, providing us with a framework for the development of new strategies involving the diagnosis of and therapy for chronic pulmonary diseases.

MATERIALS AND METHODS

Materials

Roswell Park Memorial Institute (RPMI) 1640 medium, TRIzol, fetal bovine serum (FBS), and β-actin monoclonal antibody were purchased from Sigma (St Louis, MO). Lipofectamine 2000 and Opti-MEM reduced serum medium were purchased from Invitrogen (San Diego, CA). MUC5AC mouse monoclonal antibody (45M1) was purchased from Neomarkers (Fremont, CA). Antibodies against SPDEF (H-250), anterior gradient 2 (AGR2) (6C5), forkhead box a2 (Foxa2) (H-150), Ca²⁺-activated Cl ⁻ channel (CLCA1) (H-54), STAT6 (M-20), SPDEF siRNA (h), STAT6 siRNA (h), and the control siRNA were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Recombinant human IL-13 was purchased from Peprotech (London, UK).

Small Interfering RNA Preparation and Transfection

One day before transfection, cells were plated in growth medium without antibiotics per well; therefore, they were 90–95% confluent at the time of transfection. Next, cells were transfected with siRNA (either the control, SPDEF, or STAT6) using Lipofectamine 2000 and Opti-MEM reduced serum medium according to the manufacturer's recommendations.

Cell Culture and Transfection of SPDEF siRNA and STAT6 siRNA

Immortalized human airway epithelial 16HBE cells were plated in a 6-well plate with 5–6 × 10⁵ cells per well and cultured in 2 ml RPMI 1640 medium with 10% FBS. Cells were grown at 37°C in a humidified 5% CO₂ atmosphere. All studies were performed when 16HBE cells were 90–95% confluent. After the cells reached confluence, they were serum-starved for 24 h and divided into the following groups: (1) the untreated control group, grown in RPMI 1640 medium with no serum added to maintain low basal levels of MUC5AC expression; (2) the IL-13 group, treated with 25 ng/ml IL-13 for 24 h; and (3) the IL-13 + the control siRNA group, which were transfected with negative-control siRNAs, and then 25 ng/ml IL-13 was added to the serum-free RPMI 1640 medium; (4) the IL-13 + SPDEF siRNA group, cells were transfected with SPDEF siRNA and incubated with 25 ng/ml IL-13 for 24 h; (5) the SPDEF siRNA group, cells were transfected with SPDEF siRNA without any stimuli; (6) the IL-13 + STAT6 siRNA group, cells were transfected with STAT6 siRNA and incubated with 25 ng/ml IL-13 for 24 h; and (7) the STAT6 siRNA group, cells were transfected with STAT6 siRNA without any stimuli.

Cell Viability Assay

The 16HBE cells were examined for viability by seeding in 96-well plates and allowed to attach for 24 h prior to siRNA transfection. Next, cells were transfected with different concentrations of siRNA (either the control, SPDEF or STAT6) according to the manufacturer's recommendations. After 48 h, a cell viability assay was conducted. All medium from the 96-well plate was replaced with serum-free medium containing the CellTiter-Blue reagent (Promega, Madison, WI) as previously described (Hasegawa et al. 2008). Cell viability was measured using the SpectraMax M2 model microplate reader (Molecular Devices, Sunnyvale, CA). All experiments were performed in triplicate.

Real-Time Polymerase Chain Reaction Analysis

Total RNA was extracted from 16HBE cells in each group using TRIzol. Extraction was verified by electrophoresis on a 1.5% agarose gel and an absorbance (A_260/280) value of 1.8 to 2.0. The complementary DNA was generated using the iScript complementary DNA synthesis kit (Bio-Rad, Hercules, CA). Polymerase chain reaction (PCR) primers and conditions for SPDEF, MUC5AC, AGR2, Foxa2, CLCA1, and STAT6 are shown in Tables 1 and 2. Real-time PCR was performed with iQ SYBR Green Supermix (Bio-Rad) using PCR primers in an iCycler (Bio-Rad). The cycle threshold (C_t) of each gene transcript was normalized to the average C_t for glyceraldehyde-3-phosphate dehydrogenase (GAPDH).

Table 1. Sequence of primers used for gene amplification in PCR analysis.

Gene	Forward (5′ → 3′)	Reverse (5′ → 3′)
SPDEF	CGCCTCGTCTACCAGTTCG	CCTGTCTCCCTCTGTCCTCC
AGR2	GCAGGTGGGTGAGGAAAT	TTTGGCTCCAGGTTTGAC
CLCA1	GACTGGTAACCGCCTCAA	ATCCGTCAGCAGCACAAT
Foxa2	CCCACTTCCAACTACCGC	AACAAACGACCAGCAATCAC
MUC5AC	TCCACCATATACCGCCACAGA	TGGACCGACAGTCACTGTCAA
GAPDH	TCCCATCACCATCTTCCAG	GAGTCCTTCCACGATACCAA

Table 2. Amplification parameters for PCR analysis.

SPDEF	94°C, 4 min	94°C, 50 s	56°C, 30 s	72°C, 60 s	40 cycles	72°C, 8 min
AGR2	94°C, 2 min	94°C, 30 s	54°C, 30 s	72°C, 60 s	30 cycles	72°C, 5 min
CLCA1	94°C, 4 min	94°C, 30 s	58°C, 30 s	72°C, 60 s	40 cycles	72°C, 10 min
Foxa2	94°C, 3 min	94°C, 45 s	56°C, 30 s	72°C, 60 s	35 cycles	72°C, 7 min
MUC5AC	94°C, 2 min	94°C, 30 s	60°C, 30 s	72°C, 60 s	30 cycles	72°C, 5 min
GAPDH	94°C, 4 min	94°C, 45 s	55°C, 30 s	72°C, 60 s	40 cycles	72°C, 8 min

Western Blotting

Cultured 16HBE cells in each group were washed with phosphate-buffered saline (PBS) and then lysed in buffer (50 Mm Tris·HCl, pH 7.5, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 0.1% sodium dodecyl sulfate [SDS], 1% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 10 μg/ml of leupeptin, 10 μg/ml of aprotinin, and 1 mM sodium orthovanadate) at 4°C for 30 min. Cell debris was removed by centrifugation (11,000 × g) for 10 min at 4°C. Aliquots of supernatant containing equal amounts of protein (BCA Protein Assay Kit; Beyotime, Beijing, China) were suspended in SDS sample buffer and boiled for 5 min. The proteins were separated by SDS-polyacrylamide gel electrophoresis and transferred electrophoretically to polyvinylidene difluoride membranes (Bio-Rad). The membranes were incubated with 5% skim milk in PBS containing 0.05% Tween 20 for 1 h and incubated with anti-SPDEF, anti-AGR2, anti-Foxa2, anti-CLCA1, or anti-STAT6 antibodies (all at 1:1000) for approximately 12–16 h (overnight) at 4°C. Thereafter, the membranes were incubated for 1 h with horseradish peroxidase–conjugated goat anti-mouse or anti-rabbit antibodies (all at 1:2500) to detect the primary antibodies, followed by incubation with horse-radish peroxidase–conjugated avidin-biotin complex (1:10,000) (Zhongshan Goldenbridge Biotechnology, Beijing, China). Spots were developed with the enhanced chemiluminescence reagent kit (Keygen, Nanjing, China) according to the manufacturer's instruction. Results were expressed as the ratios of the expression of SPDEF, AGR2, Foxa2, or CLCA1 to that of β-actin.

Enzyme-Linked Immunosorbent Assay

After 24 h incubation of 16HBE cells with various stimuli, cell supernatants were prepared with PBS at multiple dilutions, and 50 μl of each sample was incubated with an equal volume of bicarbonate-carbonate buffer at 40°C in a 96-well plate until dry. The plates were blocked with 2% FBS for 1 h at room temperature and incubated with 50 μl of mouse monoclonal anti-human gastric MUC5AC antibody (45M1) (1:100), which was diluted with PBS containing 0.05% Tween 20 and dispensed into each well. After 1 h, 100 μl of horseradish peroxidase–conjugated goat anti-mouse immunoglobulin G (1:10,000) was dispensed into each well. The color reaction was developed with 3,3,5, 5-tetramethylbenzidine peroxidase solution and stopped with 1 mol/L H₂SO₄. Absorbance was read at 450 nm (Sunrise remote; Tecan). The MUC5AC protein content in each sample was estimated in comparison to a standard mucin (polymeric porcine gastric mucin) as previously described (Ali et al. 2002; Viswanathan et al. 2006). In groups that provided multiple samples, the mean value of MUC5AC protein content was used in the analysis.

Immunofluorescence and Confocal Laser Scanning Microscopy

The cells in each group were seeded onto sterile cover slides that were in a 24-well plate and cultured to 70–80% confluence. Slides were fixed with 4% paraformaldehyde for 20 min and washed three times with PBS. Next, slides were permeabilised with 0.1% Triton X-100 for 15 min and washed three times with PBS. Slides were blocked in 5% bovine serum albumin (BSA) for 1 h at room temperature and were incubated with anti-MUC5AC (45M1) overnight at 4°C. After washing three times with PBS, slides were treated with fluorescein isothiocyanate goat anti-mouse IgG (1:100) for 1 h in the dark. The slides were again rinsed with PBS three times and mounted with 50% glycerol and stored in the dark. Immunofluorescence was examined using a Leica Sp2 confocal microscope.

Statistical Analysis

Data are expressed as mean ± SD. All data were analysed using the SPSS 17.0 statistical package. Analysis of variance (ANOVA) or Student's t test was used to determine the levels of difference between groups. When p < .05, the difference was considered significant.

RESULTS

Cell Viability

We analyzed cell viability after RNA silencing as described in Materials and Methods. No differences in viability were observed after any of the siRNA treatments at the concentration of 50 nM. A concentration of 100 nM siRNA led to a specific decrease in viability (Figure 1). Therefore, 50 nM siRNA was utilized to knock down gene expression in our experiments. No significant cytotoxicity was observed for IL-13 treatments at the concentration of 25 ng/ml used in the present studies (data not shown).

Figure 1. Cell viability after siRNA transfection in 16HBE cells. Overall cell viability was determined in 16HBE cells 48 h after siRNA transfection using CellTiter-Blue colorimetric cellular metabolism assays. The concentrations of siRNA were administered as 10, 50, 100, and 200 nM. Cell viability was described as a percentage of the control group, which was set as 100%. ^Δp > .05, *p < .05, compared with the untreated group. Data were shown as mean ± SD of three independent experiments.

Expression of SPDEF after IL-13 Stimulation and SPDEF siRNA Transfection

Both SPDEF mRNA and protein expression levels were detected by real-time PCR and western blotting. SPDEF expression was enhanced by IL-13 dose dependently (Figure 2A). This finding was consistent with Park and colleagues’ reports, which demonstrated that intratracheal treatment with IL-13 caused goblet cell hyperplasia in association with increased SPDEF staining in mice (Akimoto et al. 1998). They also implicated that increased SPDEF staining was observed following repeated intratracheal administration of dust mite allergens to wild-type mice but was not observed in IL-13 −/− mice. These results indicated that IL-13 may be a potent activator of SPDEF. SPDEF production in cells transfected with SPDEF siRNA and stimulated by IL-13 was lower than the levels in cells pretreated only with IL-13 (Figure 2B, C).

Figure 2. SPDEF gene expression and protein production in 16HBE cells. Gene expression and protein production were detected by real-time PCR and Western blotting and normalized to GAPDH and β-actin, respectively. The mean of mRNA content in untreated cells was set to 1 (A). *p < .05, **p < .01, compared with the untreated group; ^##p < .01, compared with IL-13-stimulated and IL-13 + SPDEF control siRNA. Western blotting analysis was performed using the SPDEF antibody (B). Results were shown as mean ± SD of three independent experiments.

Knockdown of SPDEF Reduced the Expression of MUC5AC Induced by IL-13

To examine the effects of SPDEF siRNA on MUC5AC expression induced by IL-13, we detected both the levels of MUC5AC gene expression and protein production in 16HBE cells by real-time PCR, enzyme-linked immunosorbent assay (ELISA), and inmmunofluorescence. IL-13 increased MUC5AC gene expression and protein production in a concentration-dependent manner (Figure 3A) even when the cells were transfected with the control siRNA (Figure 3B). Pretreatment of cells with SPDEF siRNA noticeably reduced IL-13-mediated MUC5AC gene expression and protein production. In addition, MUC5AC gene expression and protein production in the untreated cells were lower compared to the cells transfected with SPDEF siRNA and then stimulated with IL-13 (Figure 3B, 8).

Figure 3. SPDEF regulates MUC5AC expression in 16HBE cells. MUC5AC gene expression was detected by real-time PCR, and MUC5AC protein was assessed by ELISA, as described in Materials and Methods. *p < .05, **p < .01, compared with the untreated group; ^#p < .05, compared with IL-13-stimulated and IL-13 + SPDEF control siRNA. Data were shown as mean ± SD of three independent experiments.

Figure 8. Intracellular MUC5AC protein production in 16HBE cells. The cells were transfected with SPDEF siRNA or STAT6 siRNA and treated with IL-13 for 24 h in 16HBE cells. The cellular protein was detected by immunofluorescence and observed by confocal laser scanning microscopy (CLSM) (800 × magnification). The cellular MUC5AC protein in each group was detected using MUC5AC antibody (45M1) and fluorescein isothiocyanate (green) goat anti-mouse IgG, as described in Materials and Methods.

Expression of AGR2 and CLCA1 Are Up-regulated by IL-13 But Down-regulated by SPDEF siRNA

In order to investigate the molecular effects of SPDEF on IL-13-induced MUC5AC expression, the levels of AGR2 and CLCA1, which are closely correlated with MUC5AC overproduction, were detected in 16HBE cells. The gene expression and protein production of AGR2 and CLCA1 were up-regulated by IL-13. However, significant decreases in the expression levels of AGR2 and CLCA1 were observed in the cells in which SPDEF was knocked down by transfected SPDEF siRNA, even stimulated by IL-13. Cells transfected with the control siRNA and then treated with IL-13 showed no significant difference in AGR2 and CLCA1 expression levels compared with cells pretreated only with IL-13 (Figure 4).

Figure 4. SPDEF regulates the gene expressions and protein production of AGR2 and CLCA1 in 16HBE cells. Real-time PCR and Western blotting were used to assess the expression level of mRNA (A) and protein (B) in each group. Western blotting analyses were performed using antibodies against AGR2 and CLCA1, as described in Materials and Methods. **p < .01, compared with the untreated group; ^##p < .01, compared with IL-13-stimulated and IL-13 + SPDEF control siRNA. Data represent three independent experiments.

Foxa2 Production Inhibited by IL-13 Is Enhanced by SPDEF siRNA

Both Foxa2 mRNA and protein expression levels were detected by real-time PCR and Western blotting. Foxa2 is a transcriptional factor that plays a negative role in mucus hypersecretion. In 16HBE cells, Foxa2 significantly inhibited the activity of the MUC5AC-luciferase construct in a dose-dependent manner. In the present study, in IL-13-primed 16HBE cells, Foxa2 expression was lower than the level in untreated cells. After transfection with SPDEF siRNA and then treatment with IL-13, the cells showed increased Foxa2 expression, compared with the levels in the cells transfected with the control siRNA and then stimulated by IL-13 (Figure 5).

Figure 5. SPDEF regulates the gene expressions and protein production of Foxa2 induced by IL-13 in 16HBE cells. We used real-time PCR and Western blotting to assess the expression levels of mRNA (A) and protein (B) in each group. Western blotting analysis was performed using antibodies against Foxa2, as described in Materials and Methods. **p < .01, compared with the untreated group; ^##p < .01, compared with IL-13-stimulated and IL-13 + SPDEF control siRNA. Results are representative of three independent experiments.

Knockdown of STAT6 Decreased IL-13-Induced SPDEF and MUC5AC Expression

The IL-13-induced increase in SPDEF expression was shown to be STAT6-dependent in mice; therefore, we examined whether this mechanism could be extended to 16HBE cells. In the cells transfected with STAT6 siRNA and then stimulated with IL-13, the gene expression and protein production of SPDEF (Figure 6) and MUC5AC (Figures 7, 8) were lower than in the cells only stimulated by IL-13, independent of transfection with the control siRNA. Cells transfected with STAT6 siRNA before IL-13 stimulation showed higher levels of MUC5AC gene expression and protein production compared to the untreated cells (Figures 7, 8).

Figure 6. Effects of STAT6 on IL-13-induced SPDEF gene expression and protein production. The mRNA and protein expression of SPDEF and STAT6 were detected by real-time PCR (A) and Western blotting (B), as described in Materials and Methods. **p < .01, compared with the untreated group; ^##p < .01, compared with IL-13-stimulated and IL-13 + SPDEF control siRNA. Data are shown as mean ± SD of three independent experiments.

Figure 7. STAT6 regulates MUC5AC gene expression and protein production in 16HBE cells. MUC5AC gene expression was detected by real-time PCR, and MUC5AC protein was assessed by ELISA, as described in Materials and Methods. *p < .05, **p < .01, compared with the untreated group; ^#p < .05, compared with IL-13-stimulated and IL-13 + SPDEF control siRNA. Data are shown as mean ± SD of three independent experiments.

DISCUSSION

IL-13 is the pleiotropic 12-kDa protein product of a gene on chromosome 5 at q31 that is produced in large quantities from CD4 + Th2 cells activated by various antigens (Minty et al. 1997; de Vries 1998). This cytokine plays an important role in airway inflammation in allergic and nonallergic asthma, as well as in COPD (Zheng et al. 2000). In normal human bronchial epithelial (NHBE) cells, IL-13 also induces GCH and MUC5AC synthesis (Kondo et al. 2002; Atherton et al. 2003). Airway epithelial hypertrophy, GCH, and mucus hypersecretion have been shown in IL-13 transgenic mice (Zhu et al. 1999). IL-13-induced mucus production can be a pathologically devastating event that can lead to airway congestion and lung dysfunction. These studies demonstrate that direct effects of IL-13 on airway epithelial cells are both necessary and sufficient for mucus production in airway inflammation, and suggest that a better understanding of the effects of IL-13 on mucus hypersecretion may help guide the development of new airway inflammation disease therapies.

Recent studies have begun to identify key molecular pathways responsible for mucus production induced by IL-13. Yasuo and colleagues reported that IL-13 induced Ca²⁺-activated Cl⁻ channel (CLCA) expression as well as MUC5AC expression together with the development of GCH in cultured NHBE cells (Yasuo et al. 2006). They demonstrated that the expression of the transfected CLCA1 gene induced mucin production, and niflumic acid, a blocker of Cl⁻ efflux, inhibited MUC5AC production in NCI-H292 cells (Zhou et al. 2002). Furthermore, it has been confirmed that hCLCA1 has calcium-activated chloride channel activity (Gruber et al. 1998); therefore, hCLCA1 is likely to enhance mucus secretion by mediating the active transport of chloride ions via a calcium-activated chloride channel. CLCA1 is a potential target for asthma therapy, including mucus hypersecretion and airway hyperresponsiveness (Nakanishi et al. 2001).

SAM pointed domain–containing ETS transcription factor (SPDEF) was first described as a member of the ETS family of transcription factors expressed in relatively high abundance in the prostate (Oettgen et al. 2000; Yamada et al. 2000), and it was initially referred to as prostate-specific ETS (Pse) or prostate-derived ETS factor (PDEF). A recent study showed that SPDEF is expressed in epithelial cells located in the trachea, bronchi, and tracheal glands (Akimoto et al. 1998). Dust mite exposure and the presence of IL-13 induces SPDEF expression and goblet cell hyperplasia, which is consistent with a role for SPDEF in mucus cell hyperplasia and increased mucus production caused by Th2 cytokines and allergens. In the present study, IL-13 obviously increased MUC5AC expression. These effects were inhibited when SPDEF siRNA was transfected into 16HBE cells before IL-13 stimulation, suggesting that SPDEF may be an important factor in the regulation of IL-13-induced MUC5AC expression. In addition, in the cells transfected with SPDEF siRNA before IL-13 stimulation, MUC5AC expression was still higher compared to the levels in the untreated cells. These data indicate that in addition to SPDEF, other pathways may be involved in IL-13-mediated MUC5AC expression. These results were consistent with reports demonstrating that IL-13 induced mucus hypersecretion through mitogen-activated protein kinase (MAPK) and phosphoinositide 3-kinase (PI3K) signaling pathways (Atherton et al. 2003; Kono et al. 2010).

To investigate the molecular mechanisms by which SPDEF regulates IL-13-induced MUC5AC production, the expression of anterior gradient 2 (AGR2) and CLCA1 was detected. AGR2 is a mucin chaperone protein in the endoplasmic recticulum (ER) and act as a peptidyl N-acetylgalactosaminyltransferase in the Golgi. AGR2 was identified as an ER protein that belongs to the protein disulfide isomerase family (PDI) of chaperones, which facilitates the folding of proteins targeted for the secretory pathway (Persson et al. 2005). AGR2 binds to unfolded regions of the mucin protein in the ER to enhance protein folding and the posttranslational modification of serine and threonine residues, the sites of O-glycosylation in the Golgi. In the present study, we found that IL-13 induced obvious AGR2 and CLCA1 production in 16HBE cells, and the cells transfected with SPDEF siRNA before IL-13 stimulation showed a decreased expression of AGR2 and CLCA1 at the gene transcription and the protein production levels. These results were consistent with previous reports that implicated that AGR2 expression was induced by transfection with both SPDEF and forkhead box a3 (Foxa3) expression plasmids in the mouse lung epithelial cell line MLE15, and mouse CLCA1 mRNA was significantly induced in Scgb1a1-rtTA/TRE2-SPDEF mice that were treated to induce SPDEF expression (Rogers 2003). These data suggest that SPDEF plays an important role in regulating the expression of genes associated with IL-13-induced mucus hypersecretion.

Forkhead box a2 (Foxa2) is a member of the winged helix nuclear factor gene family. It plays a key role in regulating GCH. Conditional deletion of Foxa2 in mouse airway epithelial cells leads to a large increase in goblet cells, and nuclear expression of Foxa2 protein is reduced in goblet cells in IL-13-overexpressing mice (Wan et al. 2004). In transgenic mice overexpressing IL-1β, decreased expression of Foxa2 is also associated with increased numbers of MUC5AC-positive goblet cells (Lappalainen et al. 2005). Additionally, Foxa2 is down-regulated by activation of either IL-13 or epidermal growth factor receptor (EGFR) pathways, which is inversely correlated with MUC5AC expression (Zhen et al. 2007). Therefore, Foxa2 plays an important role in protecting airway epithelial cells against excessive mucin production, especially MUC5AC overproduction. Park and colleagues found that Foxa2 was not detected in the goblet cells located in the conducting airways of transgenic mice overexpressing SPDEF; however, Foxa2 staining was observed throughout the epithelium in control mice (Akimoto et al. 1998). To better investigate the role of SPDEF in the regulation of IL-13-induced MUC5AC production, Foxa2 expression was assessed in the present study. We transfected 16HBE cells with SPDEF siRNA and then incubated the cells with IL-13. The results showed that IL-13 greatly inhibited Foxa2 expression. Cells transfected with SPDEF siRNA showed increased levels of Foxa2 expression. All the results suggest that SPDEF exerted a negative effect on Foxa2 expression, which is an important transcriptional factor that protects against IL-13-induced MUC5AC overexpression.

All the results indicate that SPDEF regulates a number of important genes involved in MUC5AC synthesis induced by IL-13. IL-13-induced mucus production in mouse airways is critically dependent on STAT6 (Kuperman et al. 2006). However, it remains unclear whether the effects of SPDEF on IL-13-induced MUC5AC expression are STAT6 dependent in 16HBE cells. In order to demonstrate the role of STAT6 in IL-13-mediated SPDEF and MUC5AC expression, STAT6 was knocked down by transfecting STAT6 siRNA into 16HBE cells. IL-13 increased SPDEF expression greatly, which is consistent with the exacerbated MUC5AC synthesis. When cells were transfected with STAT6 siRNA in the presence of IL-13, SPDEF expression was significantly reduced. STAT6 siRNA showed similar effects on MUC5AC expression as on SPDEF expression. These results demonstrate that the effects of SPDEF on IL-13-induced MUC5AC expression are STAT6 dependent. Furthermore, STAT6 siRNA did not decrease IL-13-increased MUC5AC mRNA expression and protein production to baseline levels. These results are consistent with a previous study that indicated that sphingosine kinase 1 regulates IL-13-induced MUC5AC production via extracellular signal-regulated kinase (ERK) phosphorylation, and independent of STAT6 phosphorylation (Kono et al. 2010).

CONCLUSIONS

In the present study, we investigated the role of the transcription factor SPDEF in regulating IL-13-induced MUC5AC overproduction. With the presence of IL-13, SPDEF coactivated AGR2 and CLCA1 gene promoters to increase MUC5AC gene expression and protein production. The inhibitory effect of SPDEF on the expression of Foxa2, a key transcription factor that is known to prevent mucus production, may contribute to excessive mucus hypersecretion induced by IL-13. We determined that SPDEF is a critical transcription factor regulating IL-13-induced MUC5AC overproduction, and this effect was STAT6 dependent. Expanding our knowledge regarding SPDEF activities and its regulation is important to the identification of novel treatments to prevent excessive mucus secretion in chronic airway inflammatory diseases.

Declaration of interest: The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.