Sperm GIRK2-Containing K⁺ Inward Rectifying Channels Participate in Sperm Capacitation and Fertilization

Abstract

The GIRK2-containing inward-rectifying K⁺ ion channels have been implicated in mammalian spermatogenesis. While the Girk2 null mice are fertile, the male weaver transgenic mice carrying a gain-of-function mutation in the Girk2 gene are infertile. To establish the exact period of spermatogenesis affected by this mutation, we performed StaPut isolation and morphological characterization of the germ cells present in the weaver testis. Germ cells representing all periods of spermatogenesis were identified. However, no spermatozoa were present, suggesting that this mutation only affected the haploid phase of spermatogenesis. Real-time PCR studies performed on StaPut purified germ cells from wild-type mice indicated that the Girk2 transcripts were exclusively expressed in spermatids. Immunofluorescence studies of mouse and boar spermatids/spermatozoa localized the GIRK2 K⁺ containing channels to the acrosomal region of the sperm plasma membrane. During porcine in vitro fertilization (IVF), GIRK2-containing channels remained associated with the acrosomal shroud following zona-induced acrosome reaction. Fertilization was blocked by tertiapin-Q (TQ), a specific inhibitor of GIRK channels, and by anti-GIRK2 antibodies. Altogether, studies in two different mammalian species point to a conserved mechanism by which the GIRK2 inward-rectifying K⁺ ion channels support sperm function during fertilization.

Keywords:

• GIRK2
• in vitro fertilization
• mouse
• pig
• sperm

Introduction

Dysfunctional spermatozoa are a major contributing cause of male infertility. Electrophysiological studies suggested that altered sperm membrane potential due to defective K⁺ transport was responsible for several cases of male infertility [Calzada and Tellez 1997]. Genetic and molecular analysis of an increasing number of transgenic mouse models with defects in spermatogenesis have supported the hypothesis that voltage activated ion channels play a significant role in male germ cell differentiation and sperm morphogenesis [Harada et al. 2003; Harrison and Roffler-Tarlov 1994]. These genetic animal models have made significant contributions toward supporting the current dogma that regulation of intracellular ions is critical for mediating the morphological changes observed during mouse spermiogenesis [Harada et al. 2003; Harrison and Roffler-Tarlov 1994]. The Girk2 null mice are fertile [Signorini et al. 1997], possibly due to compensation by related Girk genes. However, extensive genetic and molecular studies of the male-infertile ‘weaver’ transgenic mice, carrying a gain of function mutation in Girk2 gene, suggest that the GIRK2 inward-rectifying K⁺ ion channel plays a functional role in sperm development [Felix et al. 2002; Harrison and Roffler-Tarlov 1994; Vogelweid et al. 1993]. The exact molecular mechanisms involved in mediating male germ cell dysfunction are currently unknown. These ‘gain-of-function’ mutations in the GIRK2 subunit proteins have been shown to result in a loss of selectivity for K⁺ ions over Na⁺ ions since the mutant assembled GIRK2 K⁺ inward-rectifying ion channels are constitutively active and are no longer sensitive to G-protein regulation [Navarro et al. 1996; Tong et al. 1996].

In male germ cells, the Girk2 gene is exclusively expressed as a novel spliced isoform in spermatids and spermatozoa [Inanobe et al. 1999]. Previous Girk2 expression studies of weaver homozygous mice utilized histological analysis on sections of the seminiferous epithelium [Harrison and Roffler-Tarlov 1994; Vogelweid, et al. 1993]. These investigators reported that spermatid development was impaired in the weaver testis and thus responsible for the male infertility phenotype observed in these animals. Further, in situ hybridization studies [Schwartz et al. 1998; Wei et al. 1998] confirmed that Girk2 transcripts were present in the seminiferous epithelium of wild-type and weaver mutant mice. In addition, immunological studies [Felix et al. 2002; Inanobe et al. 1999] confirmed that GIRK2 Kir3.2d immunoreactivity was localized to step 2-12 spermatids and spermatozoa, and that GIRK1 immunoreactivity was mainly observed in the spermatogonia and early spermatocytes. In the present study, we have characterized the period and cell-type-specific expression patterns of both Girk2 and Girk1 transcripts that encode both of these GIRK subunits in highly purified, differentiating mouse germ cell populations. Our real-time PCR studies demonstrate that transcripts encoding the GIRK2 K⁺ ion channels are expressed exclusively at the later periods of spermatogenesis in the spermatids and spermatozoa, while transcripts encoding GIRK1 inward-rectifying K⁺ ion channels are exclusively expressed during the early periods of spermatogenesis in the proliferating spermatogonia. The functional analyses performed in this study utilizing anti-GIRK2 antibodies suggest that the GIRK2-containing inward-rectifying K⁺ ion channels present in the sperm plasma membrane are involved in regulating sperm function during fertilization.

Results

Morphological characterization of the germ cell populations present in seminiferous epithelium of the weaver testis was performed following StaPut isolation of germ cells (Fig. 1). Germ cells representing all the periods of spermatogenesis up to the elongating spermatids (steps 13-16) were isolated from the weaver testis. However, no fully differentiated spermatozoa were detectable in the seminiferous epithelium of these animals. To determine the exact period and cell-type specificity of Girk1 and Girk2 transcript expression, we then utilized RNA isolated from StaPut purified germ cell populations of wild-type animals for real-time PCR analysis.

Figure 1.  StaPut purification of germ cells from the weaver mouse testis. Testes from transgenic weaver mice were dissected and treated with collagenase to isolate the seminiferous cords and tubules. Germ cell suspensions were produced by trypsin digestion and the cells fractionated on a 2-4% BSA gradient (StaPut). The purities and yields as accessed by cytological examination under a microscope were > 98% except for the leptotene/zygotene spermatocytes (85%). The yields were 10⁷cells/testis. Spermatogoania (Gonia), leptotene/zygotene spermatocyte (Lep/Zgy), pachytene spermatocyte (Pachy), round spermatid (Rtid), elongated spermatid (Etid). Scale bar = 50 µm.

In the real-time PCR studies using gene-specific PCR primers (Fig. 2A), the Girk1 transcripts were exclusively expressed in the type A and B spermatogonia and not in any of the differentiated germ cells corresponding to later periods of spermatogenesis (Fig. 2B). On the contrary, Girk2 transcripts (Fig. 2C) were exclusively expressed in the spermatids (Fig. 2D). Taken together, these studies suggest that functional homotetrameric GIRK1 and GIRK2 inward-rectifying K⁺ ion channels are expressed in the early spermatogonial and haploid spermatid germ cell populations, respectively, in the seminiferous tubules of the mouse testis.

Figure 2.  Real-time PCR analysis of the expression levels of Girk1 and Girk2 transcripts in differentiating mouse germ cells. Total RNAs isolated from StaPut purified mouse germ cells were analyzed in the Bio-Rad iCYCLER using SYBR green fluorescent real-time PCR using Girk1 and Girk2 gene-specific primers (A, C). The mean threshold (c_t) number derived from the Bio-Rad iCYCLER software program was used to calculate the relative expression of the Girk1 and Girk2 (B, D) transcripts by the comparative 2^−ΔΔCt method. Internal reference controls (18S RNA) and reagent controls (minus RNA) were included in each assay. Melting curve analyses were performed to test for amplification of nonspecific PCR products. The bar graphics represent the means + SEM from triplicate samples (n = 3) p < 0.05. Data shown in panels B and C are representative of two independent experiments.

To investigate the spatial expression and localization of assembled GIRK2 K⁺ ion channels, immunolocalization analyses were performed on isolated mouse spermatids and spermatozoa. The GIRK2 channels were detectable in the caudal manchette of mouse spermatids (step 12; Fig. 3A, B), and in the acrosomal region of fully differentiated mouse spermatozoa (Fig. 3C-F). Note that in the mature mouse spermatozoa, a punctuated immunostaining pattern of the GIRK2 inward-rectifying K⁺ channels was observed in the acrosomal region. In western blot, the band of GIRK2 was detected between 41 and 57 kDa in mouse sperm and pig brain tissue (Fig. 3G). A presumed GIRK2 protein degradation product in mouse sperm migrated above 19 kDa. The same bands have been observed by polyclonal anti-GIRK2 antibodies from two different suppliers, and the brain isoforms of GIRK2 were also detected in mouse spermatozoa (Fig. 3H). In addition, colocalization of GIRK2 with the microtubules of caudal manchette was observed in mouse elongating spermatids (Fig. 4A-E). Similar to mouse spermatozoa, acrosomal localization of assembled GIRK2 K⁺ ion channels was observed in boar spermatozoa (Fig. 5A). In contrast, no immunostaining was observed in control studies using non-immune rabbit serum (Fig. 5B). Western blotting of boar sperm extracts revealed the expected band of approximately 40 kDa and a minor band at ∼70 kDa (Fig. 5C). Antibodies against GIRK1 (Fig. 5D) and GIRK3 (Fig. 5E) did not react with the acrosome of boar spermatozoa although there was a weak immunolabeling of GIRK3 in the mid-piece, suggesting that the K⁺ ion channels present in the boar sperm acrosome are made exclusively of GIRK2. For antibody control, immunofluorescence and western blotting of boar sperm extracts were performed using the same GIRK2 antibody, immunosaturated with recombinant GIRK2-protein. Immunosaturated GIRK2-antibody blocked all GIRK2 protein bands, in western blotting (Supplemental Fig. 1B; see supplemental figure online). Immunosaturation also eliminated immunofluorescence labeling seen with intact antibody (Supplemental Fig. 1A; see supplemental figure online).

Figure 3.  Immunolocalization of GIRK2 K⁺ ion channels to the manchette of mouse spermatids and the acrosomal region of mouse spermatozoa. GIRK2 labeling in the caudal manchette of mouse elongating spermatids was performed on paraffin testicular tissue sections (A, B). Mouse sperm heads with acrosomes as shown by differential interference contrast (DIC) light microscopy (C, E), and corresponding epifluorescence microscopy (D, F) of GIRK2 protein (red) and DNA stain DAPI (blue). Grayscale (A) and pseudo-colored, (B; GIRK2 = red; DNA = blue) views are shown. G, H) Western blot analysis. Lane 1: mouse sperm (30 µg/lane), 2: pig brain tissue (30 µg/lane), and 3: loading buffer. Membranes were incubated with rabbit polyclonal anti-GIRK2 antibodies from Alomone lab (Jerusalem, Israel) (G) and Chemicon International Inc. (Temecula, CA, USA) (H), respectively.

Figure 4.  Colocalization of GIRK2 (red) with the microtubules of caudal manchette (green), detected in mouse elongating spermatids by a monoclonal antibody against beta-tubulin (E7; Dev. Studies Hybridoma Bank, Iowa City, IA, USA). Sequential steps of spermatid elongation are shown (A-E). DNA was counterstained with DAPI (blue).

Figure 5.  Immunolocalization of GIRK2 (red) K⁺ ion channels in boar spermatozoa. GIRK2 immunostaining was readily detectable in the acrosomal region of boar spermatozoa. DNA was counterstained with DAPI (blue). Panel A shows immunostaining of spermatozoa with anti-GIRK2 and panel B immunostaining with non-immune rabbit serum (negative control). Panel C shows Western blot analysis of extracts from boar sperm. A total of 30 µg of protein isolated from boar spermatozoa were applied to each lane and analyzed by Western blot analysis using GIRK2 antibody. The expected major band, GIRK2 protein, is observed above 39 kDa. A minor band observed at around 70 kDa is probably a product of posttranslational modification. As a negative control on the same extracts, the membrane was incubated with non-immune rabbit serum in place of anti-GIRK2 antibody. Panels D and E show lack of reactivity to anti-GIRK1 and anti-GIRK3 antibody, respectively. Scale Bar = 10 µm.

To assess the participation of GIRK2 channels in sperm capacitation and the acrosome reaction (AR), boar spermatozoa were capacitated in the presence of a specific GIRK channel blocker, tertiapin-Q (TQ) and tested for their sensitivity to AR-inducing agents. Alternatively, AR was induced by Ca-ionophore or zona-pellucida extract (ZP) in the presence of 5.0 µg/ml TQ. After capacitation/AR, spermatozoa were stained for flow cytometric analysis with lectin PNA-FITC, which detects the remodeling of the outer acrosomal membrane during capaciation and AR (Fig. 6). There were no significant differences in fluorescence intensity of spermatozoa capacitated with/without TQ (Fig. 6A). However, capacitation in the presence of TQ, followed by AR-induction by Ca-ionophore, also in the presence of TQ, showed a lower fluorescence intensity compared to no treatment or heat-inactivated TQ (boiled at 100°C for 5 min; Fig. 6B). When the AR was induced by ZP protein extract after sperm capacitation, fluorescence intensity was lower in the presence of TQ compared to a control without TQ (Fig. 6C). Calcium influx occurs during sperm capacitation. Fresh boar spermatozoa were capacitated in the presence of TQ and the calcium levels were measured by flow cytometry. It was found that TQ induced the elevation of intracellular calcium during sperm incubation beyond the level observed in control capacitated spermatozoa (Supplemental Fig. 2; see supplemental figure online). A comparable increase was observed in spermatozoa capacitated in the presence of tetraethylammonium (TEA), a general potassium-channel blocker used as a positive control (Supplemental Fig. 2), caused by alteration of the membrane conductance and leading to an increase of intracellular Ca²⁺ level [Parodi and Romero 2008; Parodi et al. 2008; Parodi et al. 2010]. Altogether, it appears that GIRK2 channels may be involved in sperm capacitation and AR.

Figure 6.  Flow cytometric monitoring of boar sperm capacitation, and Ca-ionophore or ZP induced acrosome reaction (AR) in the presence of tertiapin-Q (TQ). Fresh boar spermatozoa (Non-cap) were incubated in capacitation medium for 4 h at 38.5°C, 5% CO₂. Five µg/ml TQ was present during capacitation (A), or during both capacitation and Ca-ionophore induced AR (B). Controls included heat-inactivated TQ (Inact TQ; boiled at 100°C for 5 min), distilled water (DW; vehicle for TQ), or DMSO (vehicle for Ca-ionophore). C) AR was induced using ZP protein extract (equivalent 10 eggs/µl). Spermatozoa were incubated with PNA-FITC, and flow cytometric analysis was performed using a Guava EasyCyte Plus System. Average fluorescence intensity of PNA-FITC in each treatment is shown, representing three replicates with semen from three different boars. Values are expressed as the mean percentages ± SEM. Different superscripts a-c in each group of columns denote a significant difference at p < 0.05.

Several critical functional characteristics are traditionally used to assess the fertilizing ability of spermatozoa that are subsequently utilized for in vitro fertilization (IVF), or intracytoplasmic sperm injection (ICSI) procedures. These include assays to assess the ability to undergo acrosome reaction and bind to and penetrate egg-zona pellucida. Porcine oocytes were fertilized with different concentrations of TQ (Fig. 7). Fertilization rates declined progressively with increased concentrations of TQ (0.6-5.0 µg/ml). Heat-inactivated TQ and vehicle for TQ (distilled water) were added during IVF as positive and negative controls, respectively. There were no significant differences in fertilization rates among non-treated ova and ova treated with heat-inactivated TQ or vehicles (Fig. 7). Furthermore, porcine oocytes were fertilized in the presence of anti-GIRK2 antibody, and the fertilization rates decreased significantly with increasing concentrations of anti-GIRK2 antibody (Supplemental Fig. 3; see supplemental figure online).

Figure 7.  Effect of GIRK channels blocker, tertiapin-Q (TQ) on porcine fertilization in vitro. Heat-inactivated TQ and a vehicle for TQ (distilled water) were added in IVF medium as controls. Experiments were repeated 2-4 times. Values are expressed as the mean percentages ± SEM. ▪ % monospermic and □ % polyspermic oocytes. Different superscripts a-d in each group of columns denote a significant difference at p < 0.05. Numbers of inseminated ova are indicated in parentheses.

To examine the changes in GIRK2 localization during the zona-induced acrosomal exocytosis, anti-GIRK2 antibodies were added directly to fertilization medium during porcine IVF. Immunochemical analysis fertilized, fixed ova showed that the predominant binding site for anti-GIRK2 antibody added to the fertilization medium was the acrosomal region of the zona-bound spermatozoa, while no immunostaining was detectable in ova fertilized in the presence of non-immune serum (Fig. 8A). Zona bound spermatozoa with intact acrosomes immunoreactive to anti-acrosin antibodies were somewhat more abundant in the group fertilized in the presence of anti-GIRK2 antibody, compared to ova fertilized in the presence of non-immune serum (Fig. 8B).

Figure 8.  A) Immunocytochemical analysis of spermatozoa bound to the zona pellucida (ZP) of porcine oocytes in the presence or absence of anti-GIRK2 antibody (red). a-a”) Porcine oocytes were fertilized with rabbit polyclonal anti-GIRK2 antibody, and b-b” porcine oocytes were fertilized with non-immune rabbit serum as control. The white arrow indicates GIRK2 localization in the sperm acrosome (red fluorescence; a’). Spermatozoa DNA (blue) was counterstained with DAPI. B) Acrosomal status of zona-bound spermatozoa during IVF was determined by anti-acrosin antibody staining (green fluorescence). a-a”‘) Porcine oocytes were fertilized with rabbit polyclonal anti-GIRK2 antibody (red). b-b”‘) Porcine oocytes were fertilized with non-immune rabbit serum as control. Spermatozoal DNA (blue) was counterstained with DAPI. Dim oocyte autofluorescenc is visible in the background of panel b’’.

Colloidal gold labeling and transmission electron microscopy (Fig. 9A-H) demonstrated that anti-GIRK2 antibodies added to IVF medium during fertilization recognized epitopes within the acrosomal shroud and on the surface of membrane vesicles formed by the outer acrosomal membranes of zona-bound spermatozoa. No such labeling was observed when the non-immune rabbit sera were added to IVF media in place of anti-GIRK antibodies (Fig. 9I).

Figure 9.  Immunogold labeling detects the GIRK2 epitopes to which the anti-GIRK antisera bound after being added to fertilization medium during porcine IVF. Zygotes fertilized in the presence of rabbit polyclonal anti-GIRK2 antibody (A-H) or normal rabbit serum (I), were fixed in formaldehyde, incubated with colloidal gold-conjugated anti-rabbit IgG, post-fixed, and processed for transmission electron microscopy. A) Acrosome-reacted boar sperm head, with long arrow spanning the acrosomal region and short arrow spanning the equatorial segment. B) Detail of panel A, showing colloidal gold labeling of GIRK2 on acrosomal membrane vesicles. C) Colloidal gold labeled vesicles on the lateral edge of sperm head acrosome after acrosome reaction (AR). D) Acrosomal shroud of a zona-bound spermatozoon. Arrowheads point to colloidal gold particles. E-G) Vesiculated outer acrosomal membrane; panels F and H show detail of colloidal gold labeling on the surface of acrosomal membrane vesicles. H) Oblique section through equatorial segment and postacrosomal sheath of a zona-bound spermatozoon, showing the absence of GIRK2 labeling beyond the acrosomal region of the sperm head. I) Note the absence of colloidal gold labeling in a zona bound, acrosome-reacted sperm head during control fertilization with addition of non-immune rabbit serum. Scale bars: A = 500 nm; B = 200 nm; C-E = 100 nm; F, G = 50 nm; H = 500 nm; I = 200 nm.

Discussion

One of the goals of this study was to analyze the period and cell-type-specific expression patterns of the GIRK inward-rectifying K⁺ ion channels during spermatogenesis, and to determine the specific role that these inward-rectifying K⁺ ion channels play in germ cell differentiation and sperm function. Weaver (wv/wv) mutant mice were initially utilized for these studies since neurodegeneration of cerebellar granule cells in the brain and testicular infertility pathologies observed in these animals have been extensively documented by genetic, morphological, molecular, and electrophysiological techniques.

The weaver (wv) gene mutation is the result of a single base-pair change, Gly to Ser substitution affecting amino acid residue 156 in the subunit protein encoded by the Girk2 gene. In the brain, GIRK1 and GIRK2 subunits form heterotetramers to produce functional G-protein-activated inwardly rectifying K⁺ ion channels. Genetic analyses have indicated that homozygous weaver (wv/wv) mutation is associated with loss of granule cells in the cerebellum and dopaminergic neurons in the midbrain. This mutation leads to loss of the G-protein-mediated inward rectifier K⁺ ion currents, subsequently resulting in chronic depolarization and reduced selectively for K⁺ ions over Na⁺ and Ca⁺⁺ ions [Abraham et al. 1999; Corey and Clapham 2001; Harrison and Roffler-Tarlov 1994; Navarro et al. 1996; Surmeier et al. 1996; Wei et al. 1998]. Our studies have confirmed that GIRK inward-rectifying K⁺ ion channel expression profiles in the seminiferous epithelium of the testis are drastically different from the brain. Previous studies have indicated that Girk1 transcripts, encoding the GIRK1 inward-rectifying K⁺ ion channel subunit, are exclusively expressed in the spermatogonia [Inanobe et al. 1999; Vogelweid et al. 1993]. However, the exact cell-type-specificity of GIRK K⁺ ion channel expression were not well defined in the respective mouse germ cell populations, since these studies were performed using either total testis extracts or by in situ hybridization on serial sections through the seminiferous epithelium. In the present study, we have addressed this issue by utilizing RNA isolated from StaPut purified mouse germ cell populations, and have verified that transcripts encoding the GIRK2 K⁺ ion channel subunit are exclusively expressed in the haploid spermatids, while transcripts encoding GIRK1 K⁺ ion channel are exclusively expressed in the diploid proliferating spermatogonia. Since no overlapping expression of Girk1 and Girk2 transcripts occurs in the testis during spermatogenesis, only homotetrameric GIRK1 and GIRK2 inward-rectifying K⁺ ion channels are most likely assembled in the respective germ cells. The functional role that homotetrameric GIRK1 inward-rectifying K⁺ ion channels play in regulating cellular proliferation during the early periods of spermatogenesis is currently unknown. However, our studies suggest that the GIRK2-containing K⁺ ion channels, expressed in the haploid spermatids and spermatozoa, play critical roles in spermatid morphological differentiation and sperm function during fertilization.

Molecular studies by Inanobe et al. [1999] showed that the Girk2 transcripts expressed in the spermatids were a unique splice variant encoding GIRK2 subunits lacking the N-terminal region common to the other GIRK2 isoforms identified in the brain and other somatic cell types. These investigators demonstrated that the GIRK2 subunit isoforms were able to form both functional homotetrameric and heterotetrameric channels with GIRK1 subunits when expressed in frog oocytes. Interestingly, genetic studies have indicated that Girk2 null mice do not show any neurodegeneration or male infertility phenotypes, suggesting that the weaver mutation constitutes a ‘gain-of-function’ mutation that is responsible for the pathologies observed in the brain and testis of these animals [Lester and Karschin 2000; Luscher et al. 1997; Signorini et al. 1997; Slesinger et al. 1996]. In the present study, we used two different mammalian species and a combination of immunolocalization analyses and sperm function assays to demonstrate that the homotetrameric Girk2-encoded K⁺ inward-rectifying channels play specific roles in mediating the process of fertilization. The rate of sperm-zona penetration significantly decreased in the presence of anti-GIRK2 antibody during IVF (Supplemental Fig. 1). The inhibition of sperm-zona penetration by anti-GIRK2 antibody was neutralized by antibody saturation with recombinant GIRK2 protein (Supplemental Fig. 1D). This effect may be due to blocking the K⁺ channel, since the antibody used in the present study recognizes the pore-facing, C-terminal cytoplamic tail of GIRK2 protein (as opposed to the N-terminal half of GIRK2, buried in the membrane). It is possible that the epitope became exposed to potential antibody binding during capacitation or zona-induced acrosomal exocytosis, both of which encompass rearrangement of acrosomal membrane domains on/in the acrosome [Liu et al. 1996; Morais-Cabral et al. 2001; Zhou et al. 2001]. Tertiapin-Q (TQ) is a high affinity blocker for inward-rectifier K⁺ channels [Jin and Lu 1999]; it blocks K⁺ channel pore by occluding α-helix into the channel vestibule [Jin et al. 1999]. In mouse pancreatic islet cells expressing GIRK channels, adrenaline-mediated inward currents and adrenaline-induced hyperpolarization were suppressed by TQ [Iwanir and Reuveny 2008]. When TQ was co-administered with 1 µg mastoparan to inflamed mice, the mastoparan-induced analgesia, thought to be mediated by GIRK channels, was inhibited by TQ at nanomolar concentrations [Gonzalez-Rodriguez et al. 2010]. Additionally, 100 nM TQ inhibited channel currents in the recombinant GIRK1 and GIRK2 channels co-expressed in Xenopus oocyte [Kanjhan et al. 2005]. In the present study, a dose dependent decrease in fertilization rates have been observed in porcine oocytes in the presence of TQ, supporting a role of sperm GIRK channels in the fertilization process.

Previously, Acevedo et al. [2006] reported that a potassium channel blocker, tolbutamide inhibited sperm capacitation and acrosome reaction (AR) in the mouse, in a dose-dependent manner (50-500 µM). Patch clamp studies established the existence of inwardly rectifying K⁺ ion channels in mouse spermatogenic cells. The addition of Ba²⁺ blocked K⁺ current, inhibited hyperpolarization during capacitation and decreased zona pellucida induced acrosomal exocytosis [Munoz-Garay et al. 2001]. In the present study, boar spermatozoa capacitated and acrosome-reacted in the presence of TQ showed only minor differences in acrosomal remodeling when AR was induced by a Ca-ionophore. However, a lower PNA-FITC fluorescence intensity was observed in the TQ-treated spermatozoa when the AR was induced with isolated ZP extracts, a physiological inducer of AR. The role of GIRK2 K⁺ ion channels in regulating sperm morphogenesis/spermiogenesis and function needs to be further investigated. Such studies will require comprehensive technical approaches that include patch clamp recording in combination with genetic, biochemical, and molecular strategies in order to identify the K⁺ ion mediated signal transduction pathways involved in regulating this terminal developmental process.

A number of lipid membrane molecular components likely to be involved in mediating these downstream signal transduction events occurring during male germ cell differentiation were recently identified in biochemical studies [Wu et al. 2001]. These studies suggest that the phosphoinositide phosphatase (PTEN) homologue, PTEN2, is likely to be a strong candidate for regulating spermatid-specific signal transduction pathways that utilize the phosphoinositide second messenger, phosphatidylinosol 3,4,5 triphosphate [PI (3,4,5) P₃] and its substrate phosphatidylinosital 4,5-biphosphate [PI (4,5) P₂ ]. Localized changes of [PI (4,5) P₂] occurring in the lipid membranes of the spermatids are likely to either positively or negatively regulate ion transporters and channels. Supporting biochemical evidence for involvement of this regulatory pathway in directing morphological processes that occur during spermiogenesis was demonstrated in studies performed by Murata et al. [2005]. These investigators demonstrated that GIRK2 inward-rectifying K⁺ ion channel activity was regulated by G protein βγ subunits, sodium ions, and [PI (4, 5) P₂]. These molecular studies showed that PTEN can increase [PI (4,5) P₂ ] levels in the vicinity of ion channels thus influencing their activity. Supporting this hypothesis is the observation that murine PTEN2 and human TPTE (transmembrane phosphatase with tensin homology) are expressed in secondary spermatocytes in the seminiferous epithelium of the testis. Furthermore, PTEN2 expression is likely to occur exclusively in the Golgi of the spermatids at the terminal period of spermatogenesis that precedes the distinctive morphological changes resulting in spermatozoa.

In summary, several studies have indicated that a large number of ion channels and transporters are expressed in the differentiating germ cell populations in the testis [Felix et al. 2002; Jacob et al. 2000; Jagannathan et al. 2002; Quill et al. 2001; Tosti and Boni 2004]. The specific roles that these ion channels and transporters play in proliferation, differentiation of male germ cells, and spermatozoa function are currently the subject of intensive ongoing investigations. The genetic ‘gain-of-function’ mutations (e.g., weaver) and transgenic null knockouts of members of the Kir3 family of inward-rectifying K⁺ ion channels have made significant contributions towards elucidation of the molecular aspects of GIRK inward-rectifying K⁺ ion channel function. These include identification of the second messengers and signal transduction pathways involved in mediating proliferation of the spermatogonial stem cells, differentiation of the primary and secondary spermatocytes, and the subsequent fertilization functions of the spermatozoa.

Materials and Methods

Isolation of Seminiferous Epithelium and Spermatogenic Cells

Seminiferous cords and tubules were prepared from testes isolated from wild-type and weaver mutant mice by collagenase treatment. All animals were spermatozoa-producing adult males older than 60 d. Monodispersed suspensions of spermatogenic cells were prepared from the seminiferous cords/tubules with collagenase and trypsin digestion [Bellve et al. 1977; Romrell et al. 1976]. The germ cells were separated by velocity sedimentation at unit gravity on 2-4% bovine serum albumin (BSA) gradients [Romrell et al. 1976]. Isolated pachytene spermatocytes and round/elongating spermatids were > 95% pure, while the other spermatogenic cell types were > 85% pure, based on examination of cell morphology and size under phase contrast optics. Animals used in these studies were maintained and sacrificed according to procedures outlined in the National Institutes of Health Guide for the Care and Use of Laboratory Animals [NIH, 2011]. Approval for these studies was received from the Morehouse School of Medicine Institutional Animal Care and Use Committee.

Isolation of Total RNA and Quantitative Real-Time PCR Analysis

Cytoplasmic RNA was isolated from the StaPut purified germ cell populations using the Clontech Micro-scale total RNA separator kit according to protocols supplied by the manufacturer (Clontech, Palo Alto, CA, USA). The isolated total RNA was treated with RNase-free DNase1 and repurified prior to cDNA synthesis. The reverse transcription reactions were performed at 37°C for 1 h using SensiScript Reverse Transcriptase (Qiagen, Valencia, CA, USA) with 1 µM Random Hexamers (Invitrogen), 1 µM dNTPs, total RNA (200 ng) and RNAsin Ribonucleotide Inhibitor (1 U). Quantitative SYBR green real-time PCR was performed in the Bio-Rad iCYCLER iQ (Bio-Rad Laboratories, Hercules, CA, USA). Gene-specific Girk1 and Girk2 PCR primer sequences were designed using Oligo Primer Analysis Software (National Biomedical Systems, San Diego, CA, USA). For 1.68 kb Girk1 and 2.29 kb Girk2 transcripts, respectively, the transcript-specific sequences were as follows:

Girk1

3:5′CTCCGGTATTATGTCTGCACTGCGAAG3’ (forward)

4:5’AGGGTAGTGAAGAGGTCCGAAAGGTAGCGA3’ (reverse)

5:5’GGTGTAGGTGAGGATGAAGATAAAGAGGTT3’ (reverse)

23:5’CCATCGAAGCTGCAGAAAATTACGGGGAGAGAAGAC3’ (forward)

24:5’GGTAGGTCCTCCAGCCATCTTTTGAA3’ (reverse)

Girk2

3:5’ATCCCTCCACTGCATCCATTCTGTCTCCAAAC3’ (forward)

4:5’GCTTAGGCAACTTTGGCTGGTGAATGG3’ (reverse)

5:5’ATTTTCCTTTTGGTCCTGTCTCGGCTGATGTGTCTCGGA3’ (forward)

6:5’ACTTCCCATCCTTCCTCACGTACCTCT3’ (forward)

The PCR reaction mixture consisted of cDNA template from 200 ng of total RNA, 0.3 µM of each primer and 1X QuantiTect SYBR green PCR mixture (Qiagen) containing HotStart Taq DNA polymerase, dNTPs (1 µM). The cDNAs were amplified after a precycling activation at 95°C for 15 min, followed by 27 cycles of denaturation at 95°C for 15 sec, annealing at 54°C for 30 sec, and extension at 72°C for 30 sec. Internal reference (18S rRNA) and reagent controls (minus RNA or cDNA) were included in each assay. The assays were performed in triplicate to verify the results and the mean threshold Cycle (Ct) number was used to calculate the relative gene expression levels using the comparative 2^−ΔΔCt method [Livak and Schmittgen 2001]. Finally, melting curve analyses were performed to demonstrate the absence of any non-specific PCR products amplified in these PCR reactions. The graphical data reported represent the mean + SEM from triplicate samples from 2 independent studies. Statistical comparisons were made by using unpaired t-test or analysis of variance. Significant difference was defined as p < 0.05.

Immunohistochemistry and Immunocytochemistry

For immunohistochemistry, murine testicular tissues were fixed in 4% paraformaldehyde, embedded, and sectioned by using standard histological procedures [Yi et al. 2007]. After de-embedding and rehydration, the tissues were blocked with 5% normal goat serum and incubated overnight with rabbit polyclonal anti-GIRK2 antibody (1:100 dilution; Alomone Labs, Jerusalem, Israel), raised against a GST fusion protein corresponding to amino acid residues 374-414 of murine GIRK2. This C-terminal sequence is conserved between human, pig, and mouse GIRK2 and occupies the pore facing ‘cytoplasmic’ portion of the GIRK2 protein, as opposed to the N-terminal, membrane-buried portion. After washing, the sections were incubated for 40 min with a mixture of goat anti-rabbit IgG-TRITC (Zymed, San Francisco, CA, USA) and DNA stain DAPI (Molecular Probes, Eugene, OR, USA).

For immunocytochemistry, mouse and boar spermatozoa were mounted on lysine-coated microscopy coverslips, fixed in 2% formaldehyde and permeabilized with 0.1% Triton TX-100 (Sigma) as described previously [Sutovsky 2004]. Spermatozoa were incubated with anti-GIRK2 antibody as described for immunohistochemistry. After washing, coverslips were incubated for 40 min with a mixture of goat anti-rabbit IgG-TRITC and DNA stain DAPI. Negative controls were generated concomitantly by the replacement of anti-GIRK2 antibody with a non-immune rabbit serum, followed by goat anti-rabbit-TRITC. The GIRK1 protein was analyzed by applying an identical procedure and anti-GIRK1 antibody made in goat (#sc-22926, Santa Cruz, Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA). The GIRK3 protein was detected using rabbit polyclonal antibody P8247 from Sigma (Sigma, St. Louis, MO, USA). Images were acquired by using Nikon Eclipse 800 microscope (Nikon Instruments Inc., Melville, NY, USA) with Cool Snap camera (Roper Scientific, Tucson, AZ, USA) and MetaMorph software (Universal Imaging Corp., Downington, PA, USA).

Sperm Capacitation and Induction of Acrosome Reaction

Fresh boar spermatozoa were capacitated for 4 h at 38.5°C, 5% CO₂ in the air. The capacitation medium was TL-HEPES-PVA supplemented with 5 mM sodium pyruvate, 11 mM glucose, and 2% bovine serum albumin (BSA; A6003, Sigma). Acrosome reaction (AR) was induced by 10 µM Ca-ionophore A23187 (#BP595-1, Fisher Scientific, Houston, TX, USA) or isolated zona pellucida (ZP; 10 µl TBS [100 mM Tris, 150 mM NaCl and pH 2.0] and 10 µl TBS [pH 8.0]). During capacitation and AR, tertiapin-Q (TQ; Cat. No. 1316, Tocris Bioscience, UK) or tetraethylammonium (TEA, MP Biomedicals, Santa Ana, CA, USA) were added to medium.

Flow Cytometric Analysis

After capacitation and AR, spermatozoa were washed twice with TL-HEPES-PVA and sperm concentration was adjusted to 1 × 10⁶ sperm/ml. To examine sperm viability, acrosomal status and calcium level, spermatozoa were stained with SYBR14/PI (Live/Dead sperm viability kit, L-7011, Molecular Probes), fluorescein isothiocyanate-conjugated peanut agglutinin (FITC-PNA, 3 µg/ml), and Fluo-4NW calcium kit (F36206, Molecular Probes), respectively. Two hundred microliters of sperm sample were loaded into 96-wells (Coster-Corning, Corning, NY, USA), and flow cytometric analysis was performed using a Guava EasyCyte^TM Plus flow cytometer (Guava Technologies/IMV Technologies, L'Aigle, France). For each sample, 5,000 events were analyzed in three replicates by using Guava ExpressPro software.

Collection and In Vitro Maturation (IVM) of Porcine Oocytes

Ovaries were collected from prepubertal gilts at a local slaughterhouse and transported to the laboratory in a warm box (25–30^oC). Ovaries were rinsed in 0.9% NaCl solution that contained 75 µg/ml penicillin G and 50 µg/ml streptomycin-sulfate at 37.5^oC. Cumulus oocyte complexes (COCs) were aspirated from antral follicles (3–6 mm in diameter) using an 18G needle attached to a 10 ml disposable syringe. COCs were washed three times in HEPES buffered Tyrode lactate (TL-HEPES-PVA) medium that contained 0.01% (w/v) polyvinyl alcohol (PVA) and three times with the maturation medium [Abeydeera et al. 1998]. A total of 50 COCs was transferred to 500 µl of the maturation medium that had been covered with mineral oil in a 4-well multidish (Nunc, Roskilde, Denmark) and equilibrated at 38.5^oC in 5% CO₂ in air. The medium used for oocyte maturation was tissue culture medium 199 (TCM199; Gibco, Grand Island, NY, USA) supplemented with 0.1% PVA, 3.05 mM D-glucose, 0.91 mM sodium pyruvate, 0.57 mM cysteine, 0.5 µg/ml LH, 0.5 µg/ml FSH, 10 ng/ml epidermal growth factor, 10% porcine follicular fluid, 75 µg/ml penicillin G, and 50 µg/ml streptomycin sulfate. After 22 h of culture, the oocytes were washed twice and cultured in TCM199 without LH and FSH for 22 h at 38.5^oC in 5% CO₂ in air.

In Vitro Fertilization (IVF) and Culture of Porcine Oocytes

After the completion of in vitro maturation, cumulus cells were removed with 0.1% hyaluronidase in TL-HEPES-PVA medium. Ova were washed three times with TL-HEPES-PVA medium and Tris-buffered (mTBM) medium [Abeydeera et al. 1998] that contained 0.2% (w/v) BSA. Thereafter, 25–30 oocytes were placed into each of four 50 µl drops of the mTBM medium and covered with mineral oil in 35x10-mm² polystyrene culture dishes. The dishes were kept in the incubator for 30 min until spermatozoa were added for fertilization. A semen pellet was thawed in PBS that contained 0.1% PVA (PBS-PVA) at room temperature and centrifuged at 1,500 x g through 60% and 40% isotonic Percoll layers for 10 min. The spermatozoa were resuspended and washed twice in PBS-PVA at 800 x g for 5 min. At the end of the washing procedure, the spermatozoa were resuspended in mTBM medium. After an appropriate dilution, 50 µl of this sperm suspension were added to 50 µl of the medium that contained oocytes at a final sperm concentration of 5x10⁵ sperm/ml. Different concentrations of GIRK channels inhibitor, TQ, ranging from 0.6 to 5.0 µg/ml, were added into the IVF medium. Oocytes were co-incubated with spermatozoa for 6 h at 38.5^oC in 5% CO₂ in air. At 6 h after IVF, oocytes were transferred to a 500 µl NCSU-23 culture medium that contained 0.4% BSA, for an additional culture period of 13–19 h.

Evaluation of Fertilization Rates and Sperm-Zona Binding

After IVF, oocytes were fixed in 2% formaldehyde for 40 min to examine sperm penetration, monospermic and polyspermic fertilization rates, and pronucleus formation. The zona pellucida (ZP) was removed by a short incubation in TL-HEPES-PVA with 0.5% pronase. Fixed oocytes and embryos were washed with PBS, permeated with PBS containing 0.1% Triton X-100, and stained with 2.5 µg/ml DNA stain DAPI. Sperm penetration and the fertilization status of the zygotes (unfertilized, fertilized-monospermic, or fertilized-polyspermic) were assessed under epifluorescence microscope (Nikon Eclipse 800). For sperm-zona binding, zona-enclosed oocytes after IVF were fixed in 2% formaldehyde for 40 min. Fixed oocytes were washed in PBS, permeabilized with PBS containing 0.1% Triton X-100 for 40 min, then blocked for 25 min in 0.1 M PBS that contained 5% normal goat serum and 0.1% Triton X-100. Primary antibody incubation was performed for 40 min with mouse monoclonal anti-acrosin antibody (1:100 dilution) to assess acrosomal status (intact or exocytosed acrosome). After washing, the samples were incubated for 40 min with goat anti-mouse-FITC (1:80 dilution). The DNA stain DAPI was added to the second antibody solution at a concentration of 2.5 µg/ml. Spermatozoa bound to ZP (DAPI stain) and spermatozoa with intact acrosome (goat anti-mouse-FITC stain) were observed under an epifluorescence microscope.

Transmission Electron Microscopy and Colloidal Gold Labeling

Following IVF in presence or absence of anti-GIRK2 antibodies, zygotes were washed and fixed in formaldehyde as described above. Instead of being incubated with fluorescently conjugated anti-rabbit IgG, a 12 nm colloidal gold conjugated goat-anti-rabbit IgG was applied for 2 h at room temperature and the zygotes were washed and processed for transmission electron microscopy as described [Yi et al. 2007]. Zygotes fertilized in the presence of non-immune sera served as negative controls. This procedure allowed us to identify the binding sites of anti-GIRK antibodies present in IVF media on the surface of the zona-bound spermatozoa.

Western Blotting Analysis

For Western blotting, protein extracts obtained from approximately 1x10⁹ sperm (100 µg total protein) were loaded per lane after extraction. Mouse or boar spermatozoa were washed in warm PBS and boiled in loading buffer (50 mM Tris [pH 6.8], 150 mM NaCl, 2% SDS, 20% glycerol, 5% β-mercaptoethanol, 0.02% bromophenol blue). Gel electrophoresis was performed on 4–20% gradient gels (PAGEr Gels; Cambrex Bio Science, Rockland, ME, USA) by loading sperm extracts, followed by transfer to PVDF membranes (Millipore Corp., Bedford, MA, USA) using an Owl wet transfer system (Fisher Scientific, Houston, TX, USA) at a constant 50V for 4 h. The membranes were sequentially incubated with 10% non-fat milk for 1 h and primary antibody (1:1,000 dilution of anti-GIRK2 antibody overnight. The polyclonal antisera were detected by incubation with HRP-conjugated goat anti-rabbit IgG (1:10,000 dilution) for 1 h. The membranes were incubated with a chemiluminiscent substrate (SuperSignal; Pierce, Rockford, IL, USA) and visualized by exposing to an x-ray film. Negative controls were performed using non-immune rabbit sera (1:10,000 dilution).

Statistical Analysis

Analyses of variance (ANOVA) were carried out using the SAS package in a completely randomized design. Duncan's multiple range test was used to compare values of individual treatment when the F-value was significant (p < 0.05).

Abbreviations

IVF:	=	in vitro fertilization
TQ:	=	tertiapin-Q
AR:	=	acrosome reaction
ZP:	=	zona pellucida
TEA:	=	tetraethylammonium
ICSI:	=	intracytoplasmic sperm injection
BSA:	=	bovine serum albumin
COCs:	=	cumulus oocyte complexes
TL-HEPES-PVA:	=	HEPES buffered Tyrode lactate
PVA:	=	polyvinyl alcohol
mTBM:	=	Tris-buffered.

Acknowledgments

We thank Ms. Cheryl Jensen, Ms. Melainia McLain, and Mr. Randy Tindall (Electron Microscopy Core, University of Missouri) for EM sample processing, and Ms. Kathy Craighead for clerical assistance. Special thanks go to Ms. Doris Pitts and Ms. Kathy Craighead for preparing this manuscript for publication. We also gratefully acknowledge Dr. Peter MacLeish for reviewing the manuscript and the free loan of Guava instrument by IMV Technologies, Mineneapolis, MN.

Declaration of Interest: These studies were supported by grants HD41749 from National Institutes of Child Health and Human Development, Minority Biomedical Research support grant S06GM08248, and Research Centers in University Institutions grant RRA03034 to K.T. and W.T. Y-J Y was in part supported by the National Research Foundation of Korea (NRF) grant funded by the Korea Government (MEST) (No. 2010-0001356). In addition, this work was supported by funding from the Food for the 21st Century Program of the University of Missouri-Columbia, the USDA-CREES National Research Initiative Competitive Grant No. 2002-35203-12237 and National Research Initiative Competitive Grant No. 2007-35203-18274 from the USDA National Institute of Food and Agriculture, to P.S. The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.