A comparison of the inhibitory effect of nano-encapsulated helenalin and free helenalin on telomerase gene expression in the breast cancer cell line, by real-time PCR

Abstract

Background

The up-regulation of telomerase gene expression occurs in numerous cancers such as breast cancer. A recent study used the PLGA-PEG-helenalin complex, and free helenalin, to inhibit the expression of telomerase in the breast cancer cell line. The purpose of this study was to examine whether nano encapsulating helenalin improves the anti-cancer effect of free helenalin in the T47D breast cancer cell line.

Method

The breast cancer cell line (T47D) was grown in the RPMI 1640 medium, supplemented with 10% FBS. The helenalin was encapsulated by the double emulsion method. Then, the drug loading was calculated and its morphology identified by SEM. Other properties of this copolymer were characterized by Fourier transform infrared (FTIR) spectroscopy and H nuclear magnetic resonance (H NMR) spectroscopy. The assessment of drug cytotoxicity on the growth of the breast cancer cell line was carried out through MTT assay. After treating the cells with a given amount of drug, RNA was extracted and cDNA was synthesized. In order to assess the amount of telomerase gene expression, real-time PCR was performed.

Results

With regard to the amount of the drug loaded, IC50 value was significantly decreased in nanocapsulated (NC) helenalin, in comparison with that of free helenalin. This finding has been proved through the decrease of telomerase gene expression by real-time PCR.

Conclusion

In this study, we demonstrated that the NC-helenalin complex is more effective than free helenalin in inhibiting the growth of breast cancer cells.

Keywords::

• breast cancer
• hTERT
• helenalin
• PLGA-PEG
• real-time PCR

Introduction

The incidence of breast cancer in the general population is 10%, and it occurs in 22% of women around the world (Hankey 1992, Torbbaghan 1999). In breast cancer and in almost all human cancers, the overexpression of telomerase is the most important factor responsible for the growth and continuous progress of the tumor [3, 4](Bodnar et al. 1998, Kim et al. 1994).

While telomerase activity is absent in most normal human somatic cells, it is seen in more than 90% of the cancer cells and immortal cells (Kim et al. 1994, Shay and Wright 2000). Telomerase consists of two essential subunits. The first part of the protein is Template RNA, which in humans is called hTR (Feng et al. 1995) that is used as a template for the synthesis of telomeres. The second part, called hTERT, is the catalytic part of the enzyme and has reverse transcriptase activity (Kilian et al. 1997, Lingner et al. 1997, Meyerson et al. 1997). The expression of hTR is seen in high levels in all tissues, despite telomerase activity. In cancer cells, the typical rate of expression is 5 times higher than that in normal cells (Avilion et al. 1996). In contrast, with respect to the mRNA levels of hTERT, there are less than 1 to 5 copies of the telomerase catalytic subunit per cell, and this is closely related to telomerase activity in cells (Yi et al. 1999). Generally, hTERT expression in normal cells is inhibited, and it increases in tumor cells. This shows that hTERT is the determining factor in enzyme activity (Avilion et al. 1996). With regard to telomerase, it is widely expressed in cancer cells, and almost no expression is seen in other normal cells. Thus, telomerase is a suitable therapeutic target in human cancer, including breast cancer, because by inhibiting its expression, tumor progression can be affected (Zimmermann and Martens 2007, Blackburn 2000). When this enzyme is inhibited in cancer cells, telomeres shorten during cell division and the cancer cells undergo apoptosis, and ultimately cell death (Kyo and Inoue 2002, Poole et al. 2001).

Helenalin, a natural sesquiterpene lactone detected in the alcohol extracted from flowers of Arnica chnamissonis and Arnica Montana, has anticancer and antiinflammatory activity. Helenalin expresses its antiinflammatory properties by producing effects on NF-kB (Huang et al. 2001, Lyss et al. 1998). Helenalin is now mostly studied for its anticancer effects. Helenalin causes cell death in leukemia, at concentrations of 10–50 μM (Dirsch et al. 2001a, Dirsch et al. 2001b).

Helenalin has low solubility in water and has a low bioavailability. To solve this problem, various techniques are used. One of these techniques is the use of nanoparticles. More research on nanoparticles as drug carriers is required. In addition to the increase in drug absorption and bioavailability, the drug is also protected. Nanoparticles include dendrimers, polymers, micelles and liposomes (Ali et al. 2011).

Poly (lactic-CO-glycolic acid) (PLGA) is a biodegradable polymer, and is FDA approved, because it is hydrolyzed to monomeric metabolites, lactic acid and glycolic acid.

The encapsulation of anticancer drugs in biodegradable PLGA nanoparticles may pose advantages over other delivery systems, including liposomes. A few of those advantages are well known and have been demonstrated in previous studies: a wide variety of drugs, from those that are extremely hydrophobic to those that are highly hydrophilic (Kennedy et al. 2010), can be encapsulated in PLGA nanoparticles, the drug release rates can be modified to particular applications (Grill et al. 2009), and loading and size can be easily manipulated to provide further control over drug delivery (Jeong et al. 2000). However, it has been established as being surprisingly difficult to produce surface-modified, drug-encapsulated PLGA particles. For example, the addition of poly(ethylene glycol) (PEG) to nanoparticle surfaces is known to increase circulation time by inhibition of nonspecific protein adsorption, opsonization, and subsequent clearance. This has been well demonstrated with PEGylated liposomes (Yuan et al. 2000, Akbarzadeh et al. 2012a, 2012b, 2012c, 2013, Valizadeh et al. 2012), but a wide variety of attempts to similarly modify PLGA nanoparticles have yet to yield comparable results (Akbarzadeh et al. 2012d, Mollazade et al. 2013, Nejati-Koshki et al. 2013, Rezaei-Sadabady et al. 2013, Fallahzadeh et al. 2000). The difficulty in production of PEGylated PLGA particles has been speculated to be the result of insufficient or non-robust surface attachment of PEG. Effective PEGylation of particles implies a high-density coating with PEG, which has been difficult to achieve. The difficulty associated with surface-modification of PLGA particles has been the lack of functional chemical groups on the aliphatic polyester backbone of the polymer. A variety of techniques have been developed for PEGylation of PLGA nanoparticles, such as adsorption, incorporation of polymer conjugates, or covalent connection via amino or carboxyl-terminated PLGA, but these methods suffer from drawbacks such as low density or decreased presentation over time. Recently we have developed a method for surface modification of drug-encapsulated PLGA particles that yields a vigorous and high-density attachment of ligands to the particle surface (Ebrahimnezhad et al. 2013, Pourhassan-Moghaddam et al. 2013, Ahmadi et al. 2014, Davaran et al. 2013, Ghasemali et al. 2013).

In this report, we have shown the use of this new technique to produce PEGylated PLGA particles, and have examined their clinical efficacy for the safe and effective delivery of the anticancer agent helenalin (Sadat et al. 2014, Davaran et al. 2014, Kouhi et al. 2014, Abbasi et al. 2014b, 2014b Pourhassan-Moghaddam et al. 2014).

Materials and methods

Materials

D, L-lactide and glycolide were purchased from Sigma-Aldrich (St Louis, MO) and recrystallized with ethyl acetate. Stannous octoate (Sn (Oct)_2: Stannous 2-ethylhexanoate), PEG (molecular weight 2000), and dimethyl sulfoxide were purchased from Sigma-Aldrich. Adriamaycin hydrochloride was purchased from Sigma-Aldrich. The drug-loading capacity and release behavior were determined using an ultraviolet visible 2550 spectrometer (Shimadzu, Tokyo, Japan). Infrared spectra were recorded in real-time with a PerkinElmer series FTIR. The magnetic property was measured on a vibrating sample magnetometer (Meghnatis Daghigh Kavir, Iran) at room temperature. ¹H NMR spectra were recorded in real time with a Brucker DRX 300 spectrometer operated at 400 mHz. The average molecular weight was obtained by gel permeation chromatography (GPC) performed in dichloromethane (CH₂Cl₂) with a Waters Associates Model ALC/gel permeation chromatography 244 apparatus. The samples were homogenized using a homogenizer (SilentCrusher M, Heidolph Instruments GmbH, Schwabach, Germany). The organic phase was evaporated by rotary (Rotary Evaporators, Heidolph Instruments, Hei-VAP series).

Preparation of PLGA-PEG triblock copolymer

PLGA- PEG₂₀₀₀ copolymer as an initiator was synthesized by a melt polymerization process under vacuum, using stannous octoate [Sn(Oct)_2: stannous 2-ethylhexanoate] as a catalyst. DL-lactide (3.6 g), glycolide (0.86 g), and PEG₂₀₀₀ (2 g) (40% w/w), taken in a bottleneck flask, were heated to 140°C under a nitrogen atmosphere for complete melting. The molar ratio of DL-lactide and glycolide was 3:1. Then, 0.05% (w/w) stannous octoate was added, and the temperature of the reaction mixture was raised to 180°C. The temperature was maintained for 3 h. The polymerization was carried out under vacuum. The copolymer was recovered by dissolution in methylene chloride followed by precipitation in ice-cold diethyl ether. A triblock copolymer of PLGA-PEG was prepared by ring opening polymerization of DL-lactide and glycolide in the presence of PEG₂₀₀₀ (Blasco 2001, Shay and Woodring 2005, Abbasi et al. 2014d, Eatemadi et al. 2014a,b, Hosseininasab et al. 2014, Davoudi et al. 2014, Anganeh et al. 2000, Alimirzalu et al. 2014).

Preparation of helenalin-encapsulated PLGA-PEG nanoparticles

Helenalin-encapsulated PLGA-PEG nanoparticles were prepared using the double emulsion method (w/o/w) employed by Song et al. with small modifications. An aqueous solution of helenalin, at a concentration of 5 mg/5 mL, was emulsified in 3 mL dichloromethane, in which 100 mg of the copolymer had been dissolved, using a probe homogenizer or sonicator at 20,000 rpm for 60 s. This w/o emulsion was transferred to 10 mL of an aqueous solution of polyvinyl alcohol (1%), and the mixture was probe-homogenized at 72,000 rpm for one minute. The w/o/w emulsion formed was gently stirred at room temperature until evaporation of the organic phase was completed, or the organic phase was evaporated (Heidolph Instruments). The nanoparticles were purified by applying two cycles of centrifugation (12,000 rpm for 15 min in a Biofuge 28 RS, Heraeus centrifuge) and reconstituted with deionized and distilled water. The nanoparticles were finally filtered through a 1.2 mm filter (Millipore, Bedford, MA). In order to increase helenalin entrapment in the nanoparticles, the external aqueous phase used during the second emulsification step was saturated with helenalin. Blank nanoparticles were also prepared by the same method, without adding helenalin at any stage of the preparation. The content and efficiency of helenalin encapsulation in PLGA-PEG nanoparticles were determined by the disintegration of nanoparticles in dichloromethane (Karnoosh-Yamchi et al. 2014, Alizadeh et al. 2014a,b, Nejati-Koshki et al. 2014, Abbasi et al. 2014a,c, Ebrahimi et al. 2014, Ghalhar et al. 2014, Daraee et al. 2014a). The helenalin concentrations were determined spectrophotometrically at 280 nm. Drug encapsulation efficiency was calculated using the following equations:

Encapsulation Efficiency (%) = [amount of Adriamaycin drug in mg/amount of added drug in mg] × 100%.

Cell culture and cytotoxicity

The human breast cancer cell lines, T47D, were purchased from the Pasteur Institute cell bank of Iran, and were cultured in RPMI1640 supplemented with 10% FBS, 2 mM L-glutamine, and antibiotics (80 mg per 1 l penicillin G, 50 mg per liter streptomycin) and 2 g Na2HCo3 per liter at 37°C in a 5% CO₂ incubator.

Cell cytotoxicity was assessed by the 3-(4, 5-dimethylthiazol-2-yl)-2, 5 diphenyl tetrazolium bromide (MTT) assay. Cells (2000 cells/well) were seeded into a 96-well plate for 24 h. NC-helenalin was added at a particular concentration (0 nM/ml–2 nM/ml) and the cells were incubated for 24, 48 and 72 h. After incubation, 50 μL of 2 mg/ml MTT (Sigma Co., Germany) was dissolved in PBS, added to the cells, and allowed to stand for 4 h at 37°C. The absorbance at 570 nm was read using an ELISA plate reader (Bio-Tek Instruments). The NC and DMSO were used as control. This process was repeated three times (triplicate) (Tabatabaei Mirakabad et al. 2014, Daraee et al. 2014b, Nasrabadi et al. 2014, Chung et al. 2014, Fekri Aval et al. 2014).

Cell treatment

Cells were treated with NC-helenalin at various concentrations for 24, 48 and 72 h, after calculating the IC50. After this period, cells were harvested, and the entire process given was used as control, with 10% DMSO, without the NC− helenalin complex.

RNA extraction and cDNA synthesis

In order to extract RNA, we used a Trizol kit that needs approximately one million cells in each flask. To do this, the micro tubes and tips should be RNase-free. To ensure the purity of the extracted RNA, it was measured at a wavelength of 260–280 nm using a spectrophotometer. To ensure the extraction of RNA, we subjected it to electrophoresis in agarose gel (2%), and observed its specific band. cDNA synthesis was contacted based on the protocols proposed in the Fermentas kit. In this method, we used the RT enzyme and oligo (dt) polymers.

Real time PCR

In this technique, cDNA is amplified with particular primers of the telomerase gene and the internal control gene (β-actin).

Corbett 6000 was the instrument used to perform real time PCR.

The information related to the sequence and length of primers and the accession numbers are shown in Table I.

Table I. Forward (F) and reverse (R) primer sequences, and product size base pairs (bp) of the Housekeeping genes β-actin and telomerase.

Oligonucleotide	Location	Sequence	PCR product size (bp)
hTERT Forward primer Reverse primer	2165F 2362R	5′CCGCCTGAGCTGTACTTTGT3′ 5′CAGGTGAGCCACGAACTGT3′	198
Beta-actin Forward primer Reverse primer	787F 917R	5′TCCCTGGAGAAGAGCTACG 3′ 5′GTAGTTTCGTGGATGCCACA 3′	131

The level of expression of the hTERT gene was analyzed through the real-time PCR technique, using the SYBR Green PCR Master Mix TAKARA and Rotor-gene TM 6000 apparatus, according to the proposed protocol.

In order to analyze the data and quantitatively assess gene expression, we first calculated the value for cycle threshold (ct) for each sample, and since it was duplicated, we calculated the mean of the ct values.

Statistical analysis

To compare the significance of differences in the levels of gene expression, treated and control cells were subjected to the ANOVA test. All statistical analyses were carried out using SPSS statistical software, version 14. This study is significant because the P value obtained is lower than 0.05.

Results

Measurement and characterization of nanoparticles

FT-IR spectroscopy

The FT-IR spectrum is consistent with the structure of the expected copolymer. FT-IR spectroscopy was used to show the structure of PLGA-PEG copolymer nanoparticles. From the IR spectra presented in Figure 1, the absorption band at 3509.9 cm^{− 1} is attributed to the terminal hydroxyl groups in the copolymer from which the PEG homopolymer has been removed. The bands at 3010 cm^{− 1} and 2955 cm^{− 1} and 2885 cm^{− 1} are due to the C–H stretch of CH, a strong band at 1762.6 cm^{− 1} is assigned to the C = O stretch. The absorption at 1186–1089.6 cm^{− 1} is due to the C–O stretch (Table II).

Figure 1. FT-IR spectra of PLGA-PEG copolymer nanoparticles.

Table II. FT-IR bands of PLGA-PEG copolymer.

Copolymer	IR bands (cm)^−1	Description*
PLGA-PEG	2924, 2852	CH2, CH3
	1745	C = O from ester
	1097	C–O–C from PEG
	2954	C–H from PEG
	3000–3100	COOH end groups of PLGA

¹H NMR spectrum of PEG-PLGA copolymer

The basic chemical structure of the PEG-PLGA copolymer is confirmed by the ¹H NMR spectra that were recorded at RT with a Brucker DRX 300 spectrometer operating at 400 MHz. The chemical shift (δ) was measured in ppm using tetramethylsilane (TMS) as an internal reference (Figure 3). One of the striking features is a large peak at 3.65 ppm, corresponding to the methylene groups of the PEG. Overlapping doublets at 1.55 ppm are attributed to the methyl groups of the repeating units of D-lactic acid and L-lactic acid. The multiple peaks at 5.2 and 4.8 ppm correspond to the lactic acid CH and the glycolic acid CH respectively, with the high complexity of the two peaks resulting from different D-lactic, L-lactic, and glycolic acid sequences in the polymer backbone (Figure 2).

Figure 2. ¹H NMR spectrum of the PEG-PLGA copolymer.

Figure 3. The SEM nanographs of helenalin-loaded PLGA–PEG copolymer nanoparticles (A) PLGA-PEG-helenalin (B) PLGA-PEG.

GPC chromatogram of the PEG-PLGA copolymer

Molecular weights and the molecular weight distribution of the copolymer obtained were determined by means of gel permeation chromatography (GPC). The average molecular weight was 16400. The unimodal mass distribution excluded the presence of PEG₂₀₀₀ and PEG₄₀₀₀ or PLGA)Mw: 16400, Mn: 7131, Mz: 20300, Mp: 6850).

Physicochemical characterization of nanoparticles

In order to investigate the physicochemical characterization of nanoparticles prepared by the double emulsion method (w/o/w), the nanoparticles were observed by scanning election microscopy (SEM) (Figure 3). It was seen from these micrographs that the nanoparticles of helenalin entrapped in PLGA–PEG were spherical in shape and uniform, with the size ranging from 30 nm–60 nm. The encapsulation efficiency values achieved for helenalin were influenced by the presence of PEG with different molecular weights in PLGA chains (Table III). The values of the zeta potential were obviously affected by the presence of different PEG chains of different molecular weights. Higher negative values were obtained for PLGA-PEG nanoparticles (-33.2 mV).

Table III. The values of encapsulation efficiency achieved for helenalin and the presence of PEG- PLGA with different molecular weights.

Formulation no.	Polymer type	Encapsulation efficiency (EE%)	Particle size (nm)
F1	PLGA-PEG2000,10	64.2 ± 3.5	77
F2	PLGA-PEG2000,30	72.3 ± 4.6	55

Size and size distribution (SEM)

The surface morphologies of nanospheres during the incubation period were observed by SEM (VEGA/TESCAN). The SEM nanographs of helenalin-loaded PLGA–PEG copolymer nanoparticles are shown in Figure 4. Observing the photograph, it can be seen that after encapsulation and the formation of helenalin-loaded PLGA–PEG copolymers, the size of the particles was changed, and ranged between 35 nm–85 nm, and the dispersion of particles was greatly improved, which can be explained by the electrostatic repulsive force and steric hindrance between the copolymer chains on the encapsulated nanoparticles. The samples were coated with gold particles.

Figure 4. (A) The comparison of the cytotoxic effect of free helenalin (left) and NC-helenalin (right) on T47D cells over a 24-h exposure. This graph shows that both free helenalin and NC-helenalin have not IC50 in the 24-h exposure on T47D cells, within the concentration limits. (B) The comparison of the cytotoxic effect of free helenalin (left) and NC-helenalin (right) on T47D cells over a 48-h exposure. This graph shows that free helenalin has no IC50 in the 48 h exposure for T47D cells within the concentration limits, but NC-helenalin has IC50 in 48 h (0.16 μM). (C) A comparison of the cytotoxic effect of free helenalin (left) and NC-helenalin (right) on T47D cells over a 72-h exposure. This graph shows that the IC50 of free helenalin is about 1.3 μM and that of NC-helenalin is about 0.14 μM, over a 72-h exposure for T47D cells.

Drug loading and determination of helenalin entrapment efficiency

The anticancer drug helenalin was used for the drug loading and release studies. In brief, 20 mg of lyophilized nanoparticles and 5 mg of helenalin were dispersed in phosphate-buffered solution. The solution was stirred at 4°C for 3 days, to allow helenalin to be entrapped within the nanoparticle network. This value was then compared with the total amount of helenalin, to determine the helenalin-loading efficiency of the nanoparticles. The amount of non-entrapped helenalin in aqueous phase was determined using an ultraviolet 2550 (λex 280 nm and λem 485 nm) spectrophotometer (Shimadzu). This procedure permits the analysis of a helenalin solution with removal of most interfering substances (Kouhi et al. 2014). The amount of helenalin entrapped within the nanoparticles was calculated by the difference between the total amount used to prepare the nanoparticles and the amount of helenalin present in the aqueous phase, using the following formula:

$$\text{Loading}\text{efficiency}\%=[(\text{amount}\text{of}\text{loaded}\text{drug}\text{in}\text{mg})/(\text{amount}\text{of}\text{added}\text{drug}\text{in}\text{mg})]\times 100\%$$

In vitro cytotoxicity study (MTT assay)

In the cytotoxicity assay, T47D cell lines were treated with free helenalin and increasing concentration of NC-helenalin (1–1.8 μM) for 3 days (24, 48 and 72 h). The value of inhibitory concentration 50 (IC50) was then calculated for each case.

Significant differences in the growth pattern were found between control and cells treated with free helenalin or NC-helenalin.

The IC50 value of free helenalin was 1.3 μM for 72 h. The IC50 value of NC-helenalin was 0.16 μM for 48 h, and 0.14 μM for 72 h, respectively.

The Figure 4A, B, and C represent the comparison of the IC50 values of free helenalin and NC-helenalin with respect to time.

Real-time PCR for hTERT gene expression

Quantitative gene expression (hTERT) was examined by real-time PCR assay in the T47D cell lines after treatment with free helenalin and NC-helenalin, and compared with controls.

The housekeeping gene (β actin) was used as a reference gene. Each sample was duplicated twice.

The relative levels of hTERT gene expression were calculated through the ∆∆CT method.

With regard to the data analysis shown in Figure 5A and B, free helenalin, with a concentration of 13 nM in 72 h, and NC-helenalin, with a concentration of 1.6 nM in 72 h, showed significantly decreased gene expression.

Figure 5. (A) Amplification column for hTERT expression in free helenalin. (B) Amplification column for hTERT expression in NC− helenalin.

Discussion

Today, the most important issue in cancer therapy is drug delivery, to eliminate cancer cells in a manner that has the lowest side effect on healthy cells.

Although various methods such as chemotherapy, hormone therapy and gene therapy are used for treating cancer (Kennedy et al. 2010), the best method, which has been popular in recent years, is the use of nanoparticles for the delivery of drugs to cancer tissue. This is more effective than using free drugs, and due to the use of low dose of drug, the toxicity is decreased. Nano carriers have several advantages, including the fact that they can take more of the drug, and they will protect and enhance the solubility of the drug, while avoiding toxicity to normal cells (Grill et al. 2009). For this purpose, this study focused on the use of polymers as nanoparticles. The speed with which nanoparticles undergo degradation in organisms has some advantages, since it quickly eliminates polymers in the body (Jeong et al. 2000).

One of the reasons for choosing PLGA-PEG is that it sits in the aquatic environment easily and sits at the level of the nanoparticle, while PLGA of this copolymer sits in the hydrophobic part of the nanoparticle (Yuan et al. 2000).

In this study, after sufficient growth, the breast cancer cell line (T47D) in the RPMI 1640 medium was exposed to various concentrations of free helenalin and NC-helenalin, for different time durations (24, 48, and 72 h).

After calculating IC50, the T47d cell line, with different concentrations of free helenalin and NC-helenalin, was treated with control. Then, hTERT gene expression was assessed by real-time PCR.

The data obtained from MTT analysis indicates that IC50 of free helenalin in the T47D cell line is time-dependent, but IC50 in NC-helenalin is both dose-dependent and time-dependent.

The assessment of hTERT gene expression by real-time PCR showed that hTERT gene expression decreases on exposure to both free helenalin and NC-helenalin, when concentration and time are increased. The greatest decrease of gene expression on exposure to free helenalin is seen at a concentration of 13 nM for 72 h, and the greatest decrease of gene expression on exposure to NC-helenalin occurs at a concentration of 1.4 nM for 72 h.

The expression of the hTERT gene in the control sample shows that nanoparticles generally do not have any toxic effects on cell cultures.

To load drugs, the different polymers of PLGA-PEG 2000, 3000 and 2000 were used in previous studies. PLGA-PEG 2000 was found to have the largest drug load (Akbarzadeh et al. 2012a), and that why it was used to form the nanoparticles.

With regard to the amount of drug loaded and the results obtained from MTT and real-time PCR studies,we found that by using nano particles made with the PLGA-PEG polymer as drug carriers with a free drug (helenalin) concentration (0.1 nM), approximately the same result can be obtained to cure cancer in in vitro.

Conclusion

This study showed that helenalin has a significant inhibitory effect on the growth of breast cancer cell line (T47D). Using nanocapsules, the dose of helenalin administered could be reduced, without reducing its therapeutic effect. Therefore, encapsulated helenalin preserved its full function.

The polymer which been used as a nanoparticle has the least toxic effect on cells, while on the other hand, it carries the greatest drug load.

This nanocapsule can be used in the future as a suitable carrier in target therapy for cure of breast cancer.

Authors’ contributions

MR conceived of the study and participated in its design and coordination. NZ and A.A participated in the sequence alignment and drafted the manuscript. All authors read and approved the final manuscript.

Acknowledgments

The authors are grateful to the financial support from Iran National Science Foundation, Drug Applied Research Center, Tabriz university of Medical Sciences, and The Department of Medicinal Chemistry, Tabriz University of Medical Sciences. The authors thank the Department of Medical Nanotechnology, Faculty of Advanced Medical Science of Tabriz University, for all support provided.

Declaration of interest

The authors report no declarations of interest. The authors alone are responsible for the content and writing of the paper.

This work is funded by the 2012 Yeungnam University Research Grant.