Abstract
Different Mycobacterium spp. infections may indicate varied treatment regimens in the clinic. Thus, the species-level identification of Mycobacterium spp. is one of the most important tasks for a clinical microbiology laboratory. Although matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) has emerged as a rapid and accurate method for the identification of mycobacteria, this method lacks a comprehensive evaluation of the identification accuracy for clinically collected mycobacteria using VITEK MS Knowledge Base Version 3.0 (Ver 3.0). The objectives of the present study were to evaluate the identification performance of Mycobacterium spp. using Ver 3.0 and a sample processing kit for strain inactivation and protein extraction. Among the 507 Mycobacterium isolates, 46 isolates were M. tuberculosis, and 461 isolates were nontuberculous mycobacteria (NTM) (including 27 species: 17 species were slowly growing mycobacteria (SGM), and 10 species were rapidly growing mycobacteria (RGM)). The VITEK MS V3.0 library was used to correctly identify 476/507 (93.9%) isolates (425 isolates were correctly identified initially, and 51 more isolates were correctly identified on repeat), 23/507 (4.5%) isolates were unidentified, and 8/507 (1.6%) isolates were misidentified. In summary, we showed that Mycobacterium spp. can be adequately identified by Ver 3.0 in combination with the use of a standard sample processing kit.
Introduction
Mycobacterium spp. comprise a large group of microorganisms, and many species within the genus are prominent pathogens, particularly the M. tuberculosis complex (MTBC)Citation1. Tuberculosis (TB) caused by MTBC is the ninth leading cause of death worldwide and the leading cause from a single infectious agent, ranking above HIV/AIDS, with 10.4 million illnesses and 1.8 million deaths reviewed in the 2016 WHO reportCitation2. Apart from MTBC, many NTM (nontuberculous mycobacteria) species are also sources of important diseases in humansCitation3,Citation4. These species are considered important opportunistic pathogens that can cause pulmonary, skin, soft tissue, and disseminated infectionsCitation5–Citation7.
The identification of Mycobacterium at the species level is not only important to discriminate true pathogens from environmental contaminants but also to reveal differences in clinical relevance and treatment regimens between NTM speciesCitation8,Citation9. Traditionally, Mycobacterium spp. have been identified using phenotypic methodsCitation10. However, these methods are laborious and cumbersome and may require long incubation periods. These procedures cannot meet the demands of clinical requirements that require prompt and accurate identification results. Thus, rapid, accurate identification of Mycobacterium is an important task of the clinical mycobacteriology laboratoryCitation9.
The use of molecular techniques has dramatically accelerated the Mycobacterium diagnostic process. DNA probes and PCR-based detection have been available for many years and show good performance for certain species but show cross-reactions with M. intracellulare and M. fortuitum species, along with the M. avium complexCitation11–Citation15. Currently, the most reliable methods for the identification of all Mycobacterium spp. involve the molecular analysis of selected genes, such as 16 S rRNA, rpoB, and hsp65Citation16. However, these techniques are expensive, technically complex, time-consuming, require specific equipment and expertise and have limited availability.
Matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) has revolutionized the identification of microorganisms and has recently been applied for the identification of Mycobacterium sppCitation17,Citation18. Many reports adopt this technology for the identification of Mycobacterium spp., but the results have been greatly variedCitation18–Citation25. Due to the presence of mycolic acids and the pathogenicity of mycobacteria, reliable inactivation and reproducible sample extraction protocols present great challenges, which might partly explain the great variances in the findings among researchersCitation17,Citation26,Citation27. Another explanation may be the coverage of Mycobacterium spp. included in different commercial database platformsCitation19,Citation22,Citation28,Citation29.
The objective of the present study was to evaluate the identification performance of clinical Mycobacterium spp. using the VITEK MS Knowledge Base Version 3.0 in combination with the VITEK® MS Mycobacterium/Nocardia Kit (bioMérieux SA, Marcy L’Étoile, France) to generate highly reliable results in sample processing.
Results
Inactivation results
To ensure the complete inactivation of Mycobacterium, we tested 10 isolates, including four MTBC and six NTM isolates. As expected, these pathogens were nonviable after a 10-min incubation in 70% ethanol following selection with a 1-µL inoculation loop after inactivation. Neither the MGIT nor the LJ medium made any difference in viability for any of the isolates tested after 6 weeks of incubation.
VITEK MS identification
A total of 507 Mycobacterium isolates, comprising 28 species, were used for analysis. The 28 species included 17 SGM, 10 RGM, and 1 MTBC species. Among the 507 Mycobacterium isolates, 46 isolates were MTBC, 379 isolates were SGM, and 128 isolates were RGM. SGM was divided into 68 photochromogens (including M. kansasii), 39 scotochromogens (including M. scrofulaceum, M. szulgai, M. colombiense, M. parascrofulaceum, M. lentiflavum and M. gordonae), and 226 nonchromogens (including M. avium, M. chimaera, M. timonense, M. intracellulare, M. arupense, M. florentinum, M. marseillense, M. xenopi, M. celatum, and M. gastri).
MTBC is the most important pathogen among Mycobacterium spp., and the correct identification rate was 45/46 (97.8%). Mycobacterium avium and M. intracellulare, two important SGM pathogens, were correctly identified at rates of 54/56 (96.4%) and 150/153 (98.0%), respectively. For M. kansasii, the identification rate was 66/68 (97.1%). The following SGM species were less frequently encountered: M. gordonae 18/18 (100%), M. lentiflavum 8/8 (100%), M. scrofulaceum 5/5 (100%), M. szulgai 4/4 (100%), and M. xenopi 2/2 (100%). For RGM, M. abscessus and M. fortuitum are the two most frequently encountered species, with correct identifications at 88/90 (97.8%) and 16/18 (88.9%), respectively. All of the M. abscessus subspecies abscessus and massiliense were identified as M. abscessus. Regarding the M. fortuitum group, the species M. fortuitum, M. senegalense, M. peregrinum and M. septicum were all identified as M. fortuitum group. The RGM species M. mucogenicum 5/5 (100%), M. mageritense 1/1 (100%), M. vaccae 1/1 (100%), and M. chelonae 8/8 (100%) were also well identified.
During the VITEK MS Ver 3.0 evaluation, 425/507 (83.8%) isolates were initially identified, and 51/507 (10.1%) additional isolates were identified on repeat, with 23/507 (4.5%) isolates remaining unidentified and 8/507 (1.6%) isolates misidentified. All results are shown in Table .
Performance of the Vitek MS version 3.0 library used for the identification of Mycobacterium spp.
Unidentified and misidentified Isolates by VITEK MS
A total of 23 isolates were unidentified by the VITEK MS Ver 3.0 system. Among these species, the 11 isolates not in the database included 1 M. florentinum, 6 M. marseillense, 2 M. colombiense, and 2 M. monacense. The other 12 unidentified isolates included 1 MTBC, 3 M. intracellulare, and 2 each of M. avium, M. kansasii, M. abscessus, and M. fortuitum isolates. There were no misidentifications at the genus level when using the VITEK MS Ver 3.0 database. At the species level, 8 isolates were misidentified. Misidentifications were observed for 4 isolates of M. gastri, which were identified as M. kansasii, 2 M. parascrofulaceum isolates were identified as M. scrofulaceum and 1 isolate each of M. timonense and M. chimaera was identified as M. intracellulare. For other species, one M. scrofulaceum isolate was identified with a 50% confidence value for both M. scrofulaceum and M. intracellulare. The results are shown in Table .
Analysis of the discrepancy strains
Discussion
To our knowledge, this study represents the most comprehensive evaluation of the CE/IVD and FDA-approved VITEK MS V3.0 for the identification of clinically isolated mycobacteria. The correct identification rate of Mycobacterium spp. after retesting was 93.9%. In addition, no isolates were misidentified at the genus level through VITEK MS V3.0.
MALDI-TOF MS is widely used for routine bacterial identification in clinical laboratories. Unlike bacteria and yeasts, mycobacteria have thicker cell walls and thus require an additional protein extraction procedure to ensure effective identification. Although many methods have been described, and perfect inactivation effects were obtainedCitation18,Citation21, there is still a lack of uniform procedures for strain inactivation and protein extraction. Here, we used a kit from bioMérieux for these purposes.
MTBC remains the most important group within the genus Mycobacterium from a global and clinical perspectiveCitation2. In the present study, 1/46 (2.2%) isolates were unidentified using the VITEK MS V3.0 analysis. This excellent identification performance with MTBC indicated that MALDI-TOF MS could be used as a powerful clinical tool. For SGM, the most frequently involved pathogens in human diseases were Mycobacterium intracellulare and Mycobacterium aviumCitation30. In the present study, only 2/56 (3.6%) M. avium and 3/153 (2%) M. intracellulare were unidentified; these rates are lower than the previously reported rates between 7.7 and 27.8%Citation17,Citation31. Mycobacterium colombiense, M. chimaera, M. marseillense and M. timonense are members of species closely related to M. avium and M. intracellulare but absent from the VITEK MS V3.0 databaseCitation32,Citation33. During the VITEK MS V3.0 analysis, all M. colombiense and M. marseillense strains were not identified, but M. chimaera and M. timonense were misidentified as M. intracellulare. This misidentification may be due to the close phylogenetic relationships between M. intracellulare and these two speciesCitation34,Citation35. Mycobacterium kansasii is second in frequency to M. avium and M. intracellulare as a cause of NTM lung disease, and its response to chemotherapy is much betterCitation5. Although the present results showed that the identification performance of M. kansasii is excellent, the major problem is that M. gastri was readily misidentified as M. kansasi. One reason for this misidentification is that incubation conditions may lead to excessive polymer production, which could greatly interfere with the spectra acquisition during MALDI-TOF MS analysis, while other explanations may be attributed to the genetic similarity between M. kansasii and M. gastri, as well as the potential that the entire range of strain diversity is not covered in the databases. However, these two species were also easy to interchange and may still need more spectra incorporated in the databaseCitation22,Citation29,Citation36–Citation38. Other SGM species involved in pulmonary diseases were all correctly identified (including M. xenopi, M. lentiflavum and M. szulgai)Citation4,Citation39. As expected, one isolate of M. florentinum not included in the database was unidentified. Except for the species not included in the database, human disease-related SGM species were well identified.
Mycobacterium gordonae, an SGM species that rarely causes human diseases, is a frequent clinical isolate, and all of these isolates were correctly identifiedCitation40. Other SGM species mainly isolated from the respiratory tract but rarely associated with human diseases, such as M. parascrofulaceum, M. celatum, and M. arupense, were also included in the present studyCitation41–Citation43. These findings were also subjected to the close relationships and limited spectra included in the knowledge database; one isolate of M. scrofulaceum was not well identified, while two isolates of M. parascrofulaceum were misidentified as M. scrofulaceumCitation44. For the limited numbers of some species, such as M. celatum and M. arupense, 100% correct identifications were also observed. In addition to human disease-related SGM species, these rare SGM species also showed good identification performance in VITEK MS V3.0. Evaluation of more strains of these rare species could provide useful information.
The RGM are opportunistic pathogens that produce disease in a variety of clinical settingsCitation39. The three major clinically important species of RGM, M. abscessus, M. fortuitum group and M. chelonae, are responsible for approximately 80% of RGM-related mycobacterial diseasesCitation7. The M. abscessus complex, consisting of three subspecies (M. massiliense, M. bolletii, and M. abscessus), is the most common of the RGM species that cause NTM pulmonary diseases. Among these species, M. abscessus subsp abscessus is the dominating subspecies and is responsible for treatment failures, mainly due to the inducible resistance of an erm (position 28: C to T) mutation, which results in clarithromycin resistance, which would be impossible in M. abscessus subsp massiliense due to its incomplete erm geneCitation45,Citation46; thus, different subspecies of M. abscessus infections may result in varied therapiesCitation47. However, although the correct identification rate was perfect for M. abscessus (the unidentified two isolates are smooth-growing, one each of M. abscessus subspecies abscessus and massiliense), these subspecies could not be discriminated in the VITEK MS V3.0 knowledge database. In prospect, these subspecies should be differentiated by the VITEK MS IVD (In Vitro Diagnosis) system, owing to the different treatment requirements. M. fortuitum group includes up to 13 species, but the VITEK MS V3.0 knowledge database includes the seven most prominent and closely related species. Species such as M. peregrinum, M. senegalense and M. septicum, were all identified as the M. fortuitum group. Except for M. septicum species, M. peregrinum and M. senegalense were included in the database, which may be partially explained by the limited strains and spectra used for the database constructionCitation48. All M. chelonae isolates were correctly identified and well discriminated from the M. abscessus complex. As we only tested a limited number of M. chelonae isolates, more strains will be necessary for further confirmation. Other rarely isolated species, such as M. mucogenicum, M. mageritense, and M. vaccae, were well identified using VITEK MS V3.0. However, the limited number of isolates used in the present study was not enough to sufficiently evaluate the performance of these species using MALDI-TOF MS.
The present study was associated with a number of limitations. First, despite the large number of clinical Mycobacterium isolates included in the present study, almost all isolates were from respiratory tract samples, and a limited number of species were recovered. Second, only a few isolates were tested for some species, and a more thorough evaluation would seem worthwhile with more isolates collected globally. Third, we did not examine the identification performances of Mycobacterium species from other liquid media and thus cannot draw any conclusions regarding the performance of other isolation media. In follow-up studies, we plan to identify Mycobacterium directly from positive MGIT broth cultures to obtain a more comprehensive evaluation of MALDI-TOF MS used for Mycobacterium identification.
Nevertheless, the present study had several strengths. First, the present study evaluated the performance of the identification of a large number of clinical Mycobacterium isolates using the CE/IVD and FDA-approved VITEK MS Version 3.0 database. Second, the combined use of the VITEK MS Mycobacterium/Nocardia sample processing kit in Mycobacterium inactivation and protein extraction generated sample spectra compatible with the reference spectra provided by the manufacturer. With the process presented here, the identification performance was slightly higher than those reported by other researchers using the VITEK MS Version 3.0 databaseCitation28,Citation29.
In summary, we showed that Mycobacterium spp. can be adequately identified by the VITEK MS Version 3.0 database. The use of a commercial sample processing kit and standard protocols are likely to yield highly reliable results in the identification of Mycobacterium species. This study further confirmed that the implementation of MALDI-TOF MS in the clinical laboratory enables the highly accurate identification of Mycobacterium species.
Materials and methods
Clinical isolates
A total of 507 Mycobacterium isolates representing 28 species, were enrolled in the present study. Clinical samples were submitted to the Shanghai Pulmonary Hospital for mycobacterial culture, and these isolates were recovered between June 2015 and March 2017. For MALDI-TOF MS analysis, all isolates were subcultured on Löwenstein-Jensen (LJ) medium at 35 °C. Rapidly growing species were tested after 3 to 10 d of incubation, while slowly growing species were tested after 3 to 5 weeks of incubation at 35 °C.
Viability assay
Inactivation was performed as previously describedCitation17,Citation21,Citation31. Briefly, colonies were selected from LJ medium with a 1-µL loopful of the organisms and then suspended in 1 mL of 75% ethanol and vortexed at maximum speed on a vortex adapter (Vortex-Genie 2, Scientific Industries, Inc. Bohemia, NY, USA) for 15 min followed by incubation for another 10 min at room temperature for inactivation. After centrifugation, the pellet was resuspended in 200 µL of sterile water, and the supernatant was discarded. Viability was measured by inoculating samples (100 µL) in BACTEC MGIT 960 bottles (BD Diagnostics, Shanghai, China) and subsequently assessing for growth on LJ medium. The LJ medium was examined daily for growth during the first week and then weekly thereafter, for a total of 6 weeks under incubationCitation28. Viability was tested using the following strains: four isolates of M. tuberculosis and six NTM isolates (one each of M. abscessus, M. fortuitum, M. kansasii, M. intracellulare, M. avium and M. lentiflavum).
VITEK® MS Mycobacterium/Nocardia Kit
All procedures were performed with the VITEK® MS Mycobacterium/Nocardia Kit (bioMérieux SA, Marcy L’Étoile, France). In brief, a 1-µL loopful of organisms was picked and transferred into a tube with glass beads and 70% ethanol, followed by vortexing for 15 min and incubation at room temperature for another 10 min. After the subsequent transfer and centrifugation, the dried pellets were uniformly dispersed with 70% formic acid and acetonitrile in turn. After centrifugation, 1 µL of the supernatant was transferred to the target slide. Once the sample was dry, 1 µL of CHCA matrix (bioMérieux SA, Marcy L’Eoile, France) was applied and allowed to dry prior to analysis. All slides were run within 3 h after preparation, and the identifications were run in automatic mode. For each isolate, a single extraction was performed and spotted in duplicate. For any isolates where discrepancies were observed, the isolate was confirmed by gene sequencing (16 S rRNA, hsp65 PRA or erm). For each run, Escherichia coli (ATCC 8739; American Type Culture Collection, Manassas, VA, USA) was used for calibration and quality control according to the manufacturer’s protocols. Mycobacterium abscessus ATCC 19977 was used as a positive control, while negative controls were simultaneously analyzed, which was performed with spotted matrix onlyCitation49.
VITEK MS knowledge base version 3.0 and MALDI-TOF MS analysis
Isolates were tested using the VITEK MS system (bioMérieux SA, Marcy L’Eoile, France), and the results were analyzed using knowledge base (KB) Version 3.0. Version 3.0 KB includes 49 Mycobacterium species grouped into 39 taxa, 14 Nocardia species, 48 mold species grouped into 47 taxa and 197 other new bacteria and yeasts, most of which are clinically relevant. Among the added 49 Mycobacterium species, there are 45 NTM (including 23 SGM and 22 RGM) and 4 MTBC speciesCitation29. During the present analysis, if the identification score was lower than 99%, then reanalysis was performed, or the extraction was repeated. Repeat testing was performed with the original culture or a newly sub-cultured isolate, according to the procedures specified above. If an isolate still yielded no identification, then this sample was considered as an unidentified resultCitation36. For results in which the confidence score was lower than 50%, repeated extraction analysis and sequencing were performed.
Sequencing
All analyzed strains were sequenced across the full 16 S rRNA gene using the universal primers 27-FOR (AGAGTTTGATCMTGGCTCAG) and 1492-REV (TACGGYTACCTTGTTACGACTT). For species such as M. kansasii and M. gastri, M. fortuitum group, M. peregrinum and M. septicum, hsp65 PRA genes (FOR:ACCAACGATGGTGTGTCCAT and REV:CTTGTCGAACCGCATACCCT) were used to supplement the identificationCitation50,Citation51. The erm gene was used for differentiating between Mycobacterium abscessus subspecies abscessus, bolletii and massilienseCitation45. If the isolate identification obtained by VITEKVITEK MS Knowledge Base Version 3.0 was consistent with the gene sequence, then the result was considered as correct. For discrepancies between sequencing and MALDI-TOF MS analysis, the sequencing result was considered the gold standard.
Acknowledgements
This project was supported through grants from the National Natural Science Foundation of China (No. 811012310 and No. 81371775), The Medical Guide Program of the Shanghai Science and Technology Committee (No. 14411970500), and Shanghai Municipal Health Outstanding Youth Clinical Medical Talents Funding (No. 201604).
The authors would like to thank David H. Pincus for careful review and editing of the manuscript and Sheldon Wei and Kevin Li for their many useful suggestions and assistance. The sample processing kit used in the present study was provided by bioMérieux.
Authors’ contributions
L.L.L. designed the study, contributed to the interpretation of results, and wrote the manuscript. W.C., R.R.Z., and W.W.C. performed the laboratory work, contributed to the interpretation of results, and revised the manuscript. H.P.C. and L.J.J. performed the laboratory work. F.Y.Y. contributed to the interpretation of results and revised the manuscript. J.Y. conceived the study, designed the study, and revised the manuscript. All authors read and approved the manuscript.
Conflict of interest
The authors declare that they have no conflict of interest.
References
- LewinsohnDMOfficial American Thoracic Society/Infectious Diseases Society of America/Centers for Disease Control and Prevention Clinical Practice Guidelines: diagnosis of tuberculosis in adults and childrenClin. Infect. Dis.201764 111 11510.1093/cid/ciw7785504475
- World Health Organization. Global Tuberculosis Report2016 142 (World Health Organization, 2016).
- SchlugerNWThe growing challenge of nontuberculous mycobacteriaChest201414652953010.1378/chest.14-0279
- GriffithDEAn official ATS/IDSA statement: diagnosis, treatment, and prevention of nontuberculous mycobacterial diseasesAm. J. Respir. Crit. Care Med.200717536741610.1164/rccm.200604-571ST
- Philley, J. V. et al. Treatment of non-tuberculous mycobacterial lung disease. Curr. Treat. Options Infect. Dis.8, 275–296 (2016).
- Koh, W.-J. Nontuberculous mycobacteria—overview. Microbiol. Spectr. 5, 1–24 (2017).
- Brown-Elliott, B. A. & Philley, J. V. Rapidly growing mycobacteria. Microbiol. Spectr. 5, 1–27 (2017).
- KangYAKohWJAntibiotic treatment for nontuberculous mycobacterial lung diseaseExpert Rev. Respir. Med.20161055756810.1586/17476348.2016.1165611
- van Ingen, J. Diagnosis of nontuberculous mycobacterial infections. Semin. Respir. Crit. Care Med. 34, 103–109 (2013).
- Jorgensen, J., Pfaller, M. & Carroll, K. in Manual of Clinical Microbiology 11th edn. (ASM: Washington, DC, 2015).
- TortoliEPecorariMFabioGMessinòMFabioACommercial DNA probes for mycobacteria incorrectly identify a number of less frequently encountered speciesJ. Clin. Microbiol.20104830731010.1128/JCM.01536-09
- TortoliESimonettiMTLaviniaFEvaluation of reformulated chemiluminescent DNA probe (AccuProbe) for culture identification of Mycobacterium kansasiiJ. Clin. Microbiol.19963428382840229416
- TortoliEMariottiniAMazzarelliGEvaluation of INNO-LiPA MYCOBACTERIAv2: improved reverse hybridization multiple DNA probe assay for mycobacterial identificationJ. Clin. Microbiol.2003414418442010.1128/JCM.41.9.4418-4420.2003193803
- SharmaKSharmaMBatraNSharmaADhillonMSDiagnostic potential of multi-targeted LAMP (Loop-mediated isothermal amplification) for osteoarticular tuberculosisJ. Orthop.2016352361365
- BhollaMEvaluation of Xpert(R) MTB/RIF and Ustar EasyNAT TB IAD for diagnosis of tuberculous lymphadenitis of children in Tanzania: a prospective descriptive studyBMC Infect. Dis.20161610.1186/s12879-016-1578-z4895953
- YamWCDiagnostic application of genotypic identification of mycobacteriaJ. Med Microbiol.20065552953610.1099/jmm.0.46298-0
- MatherCARiveraSFButler-WuSMComparison of the Bruker Biotyper and Vitek MS matrix-assisted laser desorption ionization–time of flight mass spectrometry systems for identification of mycobacteria using simplified protein extraction protocolsJ. Clin. Microbiol.20145213013810.1128/JCM.01996-133911429
- van EckKMatrix-assisted laser desorption ionization-time of flight mass spectrometry fails to identify nontuberculous mycobacteria from primary cultures of respiratory samplesJ. Clin. Microbiol.2016541915191710.1128/JCM.00304-164922120
- LevesqueSA side by side comparison of bruker biotyper and VITEK MS: utility of MALDI-TOF MS technology for microorganism identification in a public health reference laboratoryPLoS One201510e014487810.1371/journal.pone.01448784689555
- KehrmannJPerformance of Vitek MS in identifying nontuberculous mycobacteria from MGIT liquid medium and Lowenstein–Jensen solid mediumDiagn. Microbiol Infect. Dis.201684434710.1016/j.diagmicrobio.2015.10.007
- DunneWMRapid inactivation of mycobacterium and nocardia species before identification using matrix-assisted laser desorption ionization–time of flight mass spectrometryJ. Clin. Microbiol.2014523654365910.1128/JCM.01728-144187772
- Rodriguez-SanchezBEvaluation of MALDI biotyper mycobacteria library v3.0 for identification of nontuberculous mycobacteriaJ. Clin. Microbiol.2016541144114710.1128/JCM.02760-154809906
- ChienJYYuCJHsuehPRIdentification of nontuberculous mycobacteria in MGIT by matrix-assisted laser desorption/ionization mass spectrometryFuture Microbiol.2016111025103310.2217/fmb.16.20
- MarekovicIEvaluation of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry in identification of nontuberculous mycobacteriaChemotherapy20166116717010.1159/000442517
- TottyHMillerEMorenoEDunneWMDeolPComparison of mechanical disruption techniques for rapid inactivation of mycobacterium and nocardia species before identification using matrix-assisted laser desorption ionization–time of flight (MALDI-TOF) mass spectrometryJ. Clin. Microbiol.2016542626262710.1128/JCM.01096-165035402
- BalážováTThe influence of culture conditions on the identification of mycobacterium species by MALDI-TOF MS profilingFEMS Microbiol Lett.2014353778410.1111/1574-6968.12408
- MachenAKobayashiMConnellyMRWangYFWComparison of heat inactivation and cell disruption protocols for identification of mycobacteria from solid culture media by use of Vitek matrix-assisted laser desorption ionization–time of flight mass spectrometryJ. Clin. Microbiol.2013514226422910.1128/JCM.02612-133838084
- WilenCBMcMullenARBurnhamCAComparison of sample preparation methods, instrumentation platforms, and contemporary commercial databases for identification of clinically relevant mycobacteria by matrix-assisted laser desorption ionization-time of flight mass spectrometryJ. Clin. Microbiol.2015532308231510.1128/JCM.00567-154473241
- GirardVIdentification of mycobacterium spp. and nocardia spp. from solid and liquid cultures by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS)Diagn. Microbiol Infect. Dis.20168627728310.1016/j.diagmicrobio.2016.07.027
- Brown-ElliottBANashKAWallaceRJJr.Antimicrobial susceptibility testing, drug resistance mechanisms, and therapy of infections with nontuberculous mycobacteriaClin. Microbiol Rev.20122554558210.1128/CMR.05030-113416486
- BuckwalterSPEvaluation of matrix-assisted laser desorption ionization-time of flight mass spectrometry for identification of mycobacterium species, nocardia species, and other aerobic actinomycetesJ. Clin. Microbiol.20165437638410.1128/JCM.02128-154733196
- SchweickertBOccurrence and clinical relevance of Mycobacterium chimaera sp. nov., GermanyEmerg. Infect. Dis.2008141443144610.3201/eid1409.0710322603105
- VuorenmaaKBen SalahIBarlogisVChambostHDrancourtMMycobacterium colombiense and pseudotuberculous lymphadenopathyEmerg. Infect. Dis.20091561962010.3201/eid1504.0814362671429
- MurciaMITortoliEMenendezMCPalenqueEGarciaMJMycobacterium colombiense sp. nov., a novel member of the Mycobacterium avium complex and description of MAC-X as a new ITS genetic variantInt J. Syst. Evol. Microbiol.2006562049205410.1099/ijs.0.64190-0
- SalahIBCayrouCRaoultDDrancourtMMycobacterium marseillense sp. nov., Mycobacterium timonense sp. nov. and Mycobacterium bouchedurhonense sp. nov., members of the Mycobacterium avium complexInt J. Syst. Evol. Microbiol.2009592803280810.1099/ijs.0.010637-0
- McMullenARWallaceMAPincusDHWilkeyKBurnhamCADEvaluation of the Vitek MS matrix-assisted laser desorption ionization–time of flight mass spectrometry system for identification of clinically relevant filamentous fungiJ. Clin. Microbiol.2016542068207310.1128/JCM.00825-164963483
- RothANovel diagnostic algorithm for identification of mycobacteria using genus-specific amplification of the 16S-23S rRNA gene spacer and restriction endonucleasesJ. Clin. Microbiol.2000381094110486348
- ThomsonRTolsonCHuygensFHargreavesMStrain variation amongst clinical and potable water isolates of M. kansasii using automated repetitive unit PCRInt J. Med Microbiol.201430448448910.1016/j.ijmm.2014.02.004
- JagielskiTMethodological and clinical aspects of the molecular epidemiology of mycobacterium tuberculosis and other mycobacteriaClin. Microbiol Rev.20162923929010.1128/CMR.00055-154786889
- EckburgPBClinical and chest radiographic findings among persons with sputum culture positive for Mycobacterium gordonae: a review of 19 casesChest.20001179610210.1378/chest.117.1.96
- MazzarelliGEvaluation of the BDProbeTec ET system for direct detection of Mycobacterium tuberculosis in pulmonary and extrapulmonary samples: a multicenter studyJ. Clin. Microbiol.2003411779178210.1128/JCM.41.4.1779-1782.2003153925
- CorbettEMycobacterium kansasii and M. scrofulaceum isolates from HIV-negative South African gold miners: incidence, clinical significance and radiologyInt J. Tuberc. Lung Dis.19993501507
- TortoliESurvey of 150 strains belonging to the Mycobacterium terrae complex and description of Mycobacterium engbaekiisp. nov., Mycobacterium heraklionense sp. nov. and Mycobacterium longobardum sp. novInt J. Syst. Evol. Microbiol.20136340141110.1099/ijs.0.038737-0
- WolinskyEMycobacterial lymphadenitis in children: a prospective study of 105 nontuberculous cases with long-term follow-upClin. Infect. Dis.19952095496310.1093/clinids/20.4.954
- LuoLEvaluation of matrix-assisted laser desorption ionization-time of flight mass spectrometry for identification of Mycobacterium abscessus subspecies according to whole-genome sequencingJ. Clin. Microbiol.2016542982298910.1128/JCM.01151-165121389
- LuoLCharacterization of Mycobacterium abscessus subtypes in Shanghai of China: drug sensitivity and bacterial epidemicity as well as clinical manifestationsMedicine201695e233810.1097/MD.00000000000023384998240
- ParkJChoJLeeCHHanSKYimJJProgression and treatment outcomes of lung disease caused by Mycobacterium abscessus and Mycobacterium massilienseClin. Infect. Dis.20176430130810.1093/cid/ciw723
- MalmAChudzikBPiersiakTGawronAGlass surface as potential in vitro substratum for Candida famata biofilmAnn. Agr. Env Med.201017115118
- CLSI Guideline M5820171st edWayne, PAClinical and Laboratory Standards Institute
- McNabbAAdieKRodriguesMBlackWAIsaac-RentonJDirect identification of mycobacteria in primary liquid detection media by partial sequencing of the 65-kilodalton heat shock protein geneJ. Clin. Microbiol.200644606610.1128/JCM.44.1.60-66.20061351931
- TortoliEMicrobiological features and clinical relevance of new species of the genus MycobacteriumClin. Microbiol Rev.20142772775210.1128/CMR.00035-144187642