Lef1 is transcriptionally activated by Klf4 and suppresses hyperoxia-induced alveolar epithelial cell injury

Abstract

Purpose

Bronchopulmonary dysplasia (BPD) is a long-term respiratory condition. More than a quarter of extremely premature newborns are harmed by BPD. At present, there are no apparent effective drugs or treatments for the condition. In this study, we aimed to investigate the functional role and mechanism of lymphoid enhancer-binding factor 1 (Lef1) in BPD in vitro.

Materials and Methods

Blood samples from BPD patients and healthy volunteers were gathered, and an in vitro model of BPD was developed in alveolar epithelial cells (AECs) MLE-12 induced by hyperoxia. Then expression of krüppel-like factor 4 (KLF4/Klf4) and LEF1/Lef1 were evaluated. After Lef1 overexpressing plasmid and the vector were transfected into hyperoxia-induced MLE-12 cells, cell proliferation assays were carried out. Cell apoptosis was investigated by a flow cytometry assay, and apoptosis related proteins Bcl-2, cleaved-caspase 3 and 9 were analyzed by a western blot assay. The binding between Klf4 and Lef1 promoter predicted on the JASPAR website was verified using luciferase and ChIP assays. For further study of the mechanism of Klf4 and Lef1 in BPD, gain-of-function experiments were performed.

Results

The mRNA levels of KLF4/Klf4 and LEF1/Lef1 were diminished in clinical BPD serum samples and hyperoxia-induced MLE-12 cells. Overexpression of Lef1 stimulated AEC proliferation and suppressed AEC apoptosis induced by hyperoxia. Mechanically, Klf4 bound to Lef1’s promoter region and aids transcription. Moreover, the results of gain-of-function experiments supported that Klf4 could impede AEC damage induced by hyperoxia via stimulating Lef1.

Conclusion

Klf4 and Lef1 expression levels were declined in hyperoxia-induced AECs, and Lef1 could be transcriptionally activated by Klf4 and protect against hyperoxia-induced AEC injury in BPD. As a result, Lef1 might become a prospective therapeutic target for BPD.

Keywords:

• Alveolar epithelial cell injury
• Bronchopulmonary dysplasia
• hyperoxia
• Klf4
• Lef1

Introduction

Bronchopulmonary dysplasia (BPD) is a long-term respiratory condition. As a complication of premature delivery, BPD is most frequent in premature infants whose gestational age is less than 30 weeks and endangers the survival and wellbeing of premature newborns.¹ According to statistics, more than a quarter of extremely premature newborns are harmed by BPD.² Many processes are involved in the pathophysiology of BPD, with hyperoxia being the leading cause of lung damage in BPD.³ Many researches have now documented numerous BPD treatment techniques, such as prenatal glucocorticoid, surfactant therapy, and interleukin-1 receptor antagonist.^4,5 The management of BPD has been continuously strengthened, but the probability of premature infants developing BPD and the mortality rate of premature infants with BPD remain significant difficulties.⁶ At present, there are no apparent and effective drugs or treatments.⁷ As a result, the current focus of research is on elucidating the mechanism and potential therapeutic targets for BPD.

Lymphoid enhancer-binding factor 1 (LEF1) is a transcription factor that belongs to the family of T cell factor.⁸ As a transcription factor, Lef1 participates in the typical Wnt/β-catenin pathway.^9,10 Meanwhile, LEF1 has been linked to the occurrence and development of a variety of diseases.^11,12 Researches have demonstrated that Lef1 can enhance B cell proliferation¹³ as well as differentiation.¹⁴ Cai et al.¹⁵ found that LEF1 expression declines with increasing BPD severity, and in that case, LEF1 is adversely linked with BPD development. In a recent work, we discovered that the expression of LEF1 in the blood of BPD preterm newborns reduced as the severity of the condition increased.¹⁶ However, the role and mechanism of LEF1 in BPD remain unknown.

Krüppel-like factor 4 (KLF4) is a zinc finger protein¹⁷ and could participate in many processes of cells, such as proliferation, cell cycle, apoptosis, migration and differentiation.^18–21 Also, KLF4 is involved in a variety of illnesses, such as atherosclerosis,²² acute myeloid leukemia,²³ and neonatal pneumonia.²⁴ Via affecting cell apoptosis and damage of inflammation, KLF4 is associated with pneumonia.²⁵ Alejandre Alcazar et al.²¹ found that Klf4 expression was diminished in lung tissue after treating the neonatal mouse with mechanical ventilation with O₂-rich gas. However, the role of KLF4 in BPD remain unclear. In this study, as per bioinformatics predictions, Klf4 might well be paired with Lef1 in the promoter.

With the foundation of the above findings, we hypothesize that Klf4 and Lef1 are downregulated in BPD, and that Klf4 activates Lef1 production by enriching in the Lef1 promoter, therefore preventing the harm of AECs caused by hyperoxia. This research seeks to afford a theoretical basis for Lef1 as a viable treatment target for BPD.

Methods

Clinical sample collection

This research, which was authorized by Hunan Children’s Hospital’s institutional review committee (approval number: KYSQ2022-132), involved twenty infants delivered at <32 weeks of pregnancy. Infants were followed up on until 36 weeks of pregnancy after conception, with the parents’ informed agreement, to see if they had BPD. All 20 infants fulfill the Ministry of Child Health and Human Development’s BPD diagnosis criteria. BPD illness is defined as any oxygen dependency that lasts more than 28 days (FiO2 > 21%). On the 28th day of birth, blood was obtained from the radial artery.^3,21 Blood from healthy volunteers was collected as control. Then, the blood samples were centrifuged at 3500 rpm for 10 min to obtain serums for subsequent experiments. The basic characteristics of subjects and controls were listed in Table 1.

Table 1. Characteristics of enrolled infants.

	Control group (n = 20)	BPD group (n = 20)	P value
Sex (male/female)	11/9	8/12	0.527
Gestational age (week)	30.12 ± 2. 16	29.65 ± 2.08	0.488
Birth weight (g)	1 309.56 ± 163.16	1176.45 ± 236.38	0.045
Intrauterine distress (n)	4 (20%)	7 (35%)	0.480
Mechanical ventilation time (d)	3.75 ± 1.04	15.56 ± 3.88	<0.001
Oxygen inhalation time (d)	18.16 ± 3.12	45.26 ± 7.34	<0.001
Nosocomial infection (n)	1 (5%)	7 (35%)	<0.001
Antibiotic use time 2 weeks after birth (d)	4.32 ± 3.44	9.65 ± 4.22	<0.001

Cell culture and transfection

American Type Culture Collection (ATCC, Manacas, Virginia, USA) supplied mouse type II AECs (MLE-12). Dulbecco’s modified Eagle’s medium (DMEM; Gibco, USA) supplied with two percent fetal bovine serum (FBS) was utilized to cultivate MLE-12 cells. MLE-12 cells were cultivated for 24 h under conditions of 5% CO₂, 37 °C, followed by exposing to hyperoxia (95% O₂+5% CO₂) for 24 h.^6,26 MLE-12 cells cultured under normoxia was used as control group.

For overexpression of Lef1 and Klf4, mouse Lef1 and Klf4 cDNA were PCR-amplified and then cloned into the expression vector pcDNA3.1 (RiboBio, Guangzhou, China). For silencing Lef1, short interfering RNA (siRNA) targeting Lef1 designed and synthesized by GenePharma (Shanghai, China). When the cell density met 70-80%, plasmids oe-Lef1 (overexpression of Lef1), oe-Klf4 (overexpression of Klf4), si-Lef1 (siRNA targeting Lef1; 5′-ATCATCACAAACTTTATTCTTGG-3′) and their controls ­vector; si-NC: 5′-UGUCUCCGAACGUGUCACGUC-3′) were transfected for 48 h following the manual of Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA).⁶

Cell counting kit-8 (CCK-8) assay

Cells were seeded in 96-well plates at a density of 5 × 10³ cells/well and cultured for 24 hours, followed by adding CCK-8 reagent (Beyotime, Shanghai, China). After constantly fostering 3 hours at 37 °C, a microplate reader (Bio-Rad, Hercules, CA, USA) was used to determine the optical density (OD) at 450 nm.^6,22

5-Ethynyl-2’-deoxyuridine (EdU) assay

Cell proliferation was evaluated using Cell-Light EdU Apollo 567 kits (RiboBio). After adding 50 M of EdU labeling medium, the cells were cultured for 2 hours. Following that, 4% paraformaldehyde was used to fix the cells, and 0.5 percent TritonX-100/phosphate buffered saline (PBS) was used to permeabilize it. Then cells were dyed using Apollo staining reagent and 4′, 6-diamidino-2-phenylindole (DAPI). An IX73-AIZFL/PH inverted fluorescence microscope (OLYMPUS Corporation, Tokyo, Japan) was utilized to capture images.²⁷

Flow cytometry assay

To assess cell apoptosis, the Annexin V-fluorescein isothiocyanate (FITC)/Propidium iodide (PI) Apoptosis Detection Kit (Sigma-Aldrich, Louis, MO, USA) was utilized. After resuspending 1 × 10⁵ cells in 500 μL binding buffer, cell suspension was well mixed with Annexin V-FITC reagent (5 μL) and PI solution (10 μL). After incubation in dark for 30 minutes, the apoptosis of MLE-12 was then assessed utilizing a flow cytometer (BD Biosciences, San Jose, CA, USA).²²

Quantitative real-time PCR (qRT-PCR) assay

RNA extraction from serum samples or MLE-12 cells utilizing RNAiso Plus reagent (Takara, Shiga, Japan) and cDNA reverse transcription utilizing Omniscript Reverse-Transcription Kit (Qiagen, Hilden, Germany) were conducted as previously Reported.²⁸ qRT-PCR was carried out utilizing Applied Biosystems 7500 instrument and SYBR Green Kit (Takara, Dalian, China).^6,28 The sequences of primers are listed in Table 2. β-actin was employed as endogenous controls. The relative gene expression was calculated using the 2^-ΔΔCT method.^22,28

Table 2. Primer sequences for qRT-PCR.

Primer name	Primer sequences
KLF4-forward	5′-TCGGACCACCTCGCCTTACA‐3′
KLF4-reverse	5′-CTGGGCTCCTTCCCTCATCG‐3′
LEF1-forward	5′-GCCACGGACGAGATGATCC‐3′
LEF1-reverse	5′-TGTCTGGCCACCTCGTGTC‐3′
ACTB-forward	5′-TGGCACCACACCTTCTACAA‐3′
ACTB-reverse	5′-CCAGAGGCGTACAGGGATAG‐3′
Klf4-forward	5′-CTATGCAGGCTGTGGCAAAACC‐3′
Klf4-reverse	5′-TTGCGGTAGTGCCTGGTCAGTT‐3′
Lef1-forward	5′-ACTGTCAGGCGACACTTCCATG‐3′
Lef1-reverse	5′-GTGCTCCTGTTTGACCTGAGGT‐3′
β-actin-forward	5′-CCCCTGAACCCTAAGGCCA‐3′
β-actin-reverse	5′-CGGAGTCCATCACAATGCCT‐3′

Western blot assay

Total proteins from MLE-12 cells were obtained utilizing RIPA buffer (Beyotime, Shanghai, China) and western blot assay was carried as reported before.^6,7 The primary antibodies used were KLF4 (1:1000, ab214666, Abcam, Cambridge, UK), LEF1 (1:1000, ab137872, Abcam), Bcl-2 (1:2000, ab182858, Abcam), cleaved-caspase 3 (1:5000, ab214430, Abcam), cleaved-caspase 9 (1:1000, ab184768, Abcam), and GAPDH (1:10000, ab181602, Abcam). Goat anti-rabbit IgG (1:10000, ab6721, Abcam) were used as secondary antibody.

Dual luciferase reporter assay

The luciferase reporter vectors containing Klf4 binding site (Lef1-WT) or binding site mutation (Lef1-MUT) gene sequences of Lef1 promoter were constructed, and co-transfected with oe-Klf4 into MLE-12 cells. Following 24 h transfection, the luciferase reporter experiment was carried out employing a dual-luciferase assay kit (Promega, Madison, WI, USA) in accordance with the manufacturer’s instructions. The intensity of fluorescence was evaluated utilizing a Multiskan Spectrum (Thermo Fisher Scientific, Waltham, MA, USA).^29,30

Chromatin immunoprecipitation (ChIP)

MLE-12 cells (2 × 10⁶) were processed for ChIP assay utilizing a ChIP assay kit (Millipore, MA, USA) as per the manufacturer’s instructions. The precipitated DNA samples were gathered, and fragments of the Lef1 promoter region were amplified and evaluated using qRT-PCR.³⁰ The primer sequences for the Lef1 promoter were as follows: forward, 5′-GGAGGAGGGCATCA GATCTTATTGTGAGTGGTTG‐3′; reverse: 5′-TTAGGAGGCAAGGTACATA TTT­AAGGGGGAGAG‐3′. Anti-KLF4 (11880-1-AP, 0.5 μg) antibody was purchased from Proteintech (USA).

Statistical analysis

SPSS 22.0 statistical software (IBM Corp. Armonk, NY, USA) was employed to evaluate all of the data. The data from at least 3 separate tests was presented as mean ± standard deviation (SD). Statistical comparisons were made employing the student t-test for two groups, or Tukey’s test-corrected one-way analysis of variance (ANOVA) for multiple groups. With P < 0.05 deemed statistically significant.

Results

The expression of KLF4/Klf4 and LEF1/lef1 are diminished in clinical BPD serum samples and hyperoxia-induced MLE-12 cells

Serum samples from BPD patients and healthy volunteers were gathered and the expression of KLF4 and LEF1 were evaluated utilizing qRT-PCR. The data documented that KLF4 and LEF1 expression had apparently declined by 38% and 44% in the BPD group in comparison with the healthy group (Figure 1A and B). An in vitro model of BPD was developed in MLE-12 cells induced by hyperoxia, and the expression of Klf4 and Lef1 was evaluated by qRT-PCR assay. It elucidated that compared with the normoxia group, hyperoxia induced low expression of Klf4 and Lef1 (Figure 1C). Also, KLF4 and LEF1 levels were downregulated by 41% and 45% in hyperoxia-induced cells measured by western blot (Figure 1D).

Figure 1. The expression of KLF4/Klf4 and LEF1/Lef1 are diminished in Clinical BPD serum samples and hyperoxia-induced MLE-12 cells. A-B. The levels of KLF4 and LEF1 in serum samples from BPD patients (n = 20) and healthy volunteers (n = 20) were evaluated utilizing qRT-PCR, male: grey, female: black; C. Klf4 and Lef1 expression were measured by qRT-PCR; D. The levels of KLF4 and LEF1 in MLE-12 cells induced by hyperoxia were evaluated utilizing western blot. Data were displayed as mean ± SD (n = 3), and analyzed utilizing t test; **, p < 0.01; ***, p < 0.001.

Overexpression of Lef1 suppresses hyperoxia-induced AEC injury

To explore the function of Lef1 in BPD, oe-Lef1 and the vector were transfected into hyperoxia-induced MLE-12 cells. The results elucidated that Lef1 mRNA expression and LEF1 protein levels (increased by 1.1 times) were higher in the hyperoxia + oe-Lef1 group than in the hyperoxia + vector group (Figure 2A and B). After that, CCK-8 and EdU assays were carried out to evaluate cell proliferation. The data documented that cell proliferation repressed by hyperoxia was dramatically stimulated by oe-Lef1 (Figure 2C and D). The effect of oe-Lef1 on cell apoptosis was investigated by flow cytometry assay, and the results revealed that cell apoptosis induced by hyperoxia was dramatically diminished by oe-Lef1 (Figure 2E). Moreover, Bcl-2, cleaved-caspase 3 and 9 were analyzed, and the results of western blot showed hyperoxic conditions decreased expression of Bcl-2 by 40% and elevated the expression of cleaved-caspase 3 and 9 by 2.4 and 1.2 times, but oe-Lef1 strongly reversed the expression of the aforementioned apoptosis related proteins in the presence of hyperoxia (Figure 2F). Collectively, these results revealed that Lef1 could suppress hyperoxia-induced AEC injury.

Figure 2. Overexpression of Lef1 suppresses hyperoxia-induced AEC injury. A. The expression of Lef1 was evaluated by qRT-PCR; B. Western blot assay for LEF1 level after transfecting oe-LEF1 into hyperoxia-induced MLE-12 cells; C. The cell viability was determined using CCK-8 assay; D. The cell proliferation was determined using EdU assay; E. Cell apoptosis was investigated by flow cytometry assay; F. The expression of Bcl-2, cleaved-caspase 3 and 9 were determined using western blot. Data were displayed as mean ± SD (n = 3) and analyzed utilizing one-way ANOVA, followed by Tukey’s multiple comparisons test; **, p < 0.01; ***, p < 0.001.

Klf4 activates the transcription of Lef1

Klf4 functions as a transcription factor, regulating the transcription of target genes. To evaluate the link between Klf4 and Lef1, we utilized JASPAR (https://jaspar.genereg.net/) to predict probable Klf4 binding sites in the Lef1 promoter (Figure 3A). The luciferase test was used to validate the prediction. After co-transfecting oe-Klf4 and Lef1-WT or Lef1-MUT into MLE-12 cells, oe-Klf4 increased Lef1-WT luciferase activity but had no impact on Lef1-MUT (Figure 3B). Moreover, the ChIP assay revealed that Klf4 was enriched in the promoter of Lef1 (Figure 3C). These results revealed that Klf4 could bind to the promoter of Lef1, and hyperoxia increased the combination (Figure 3B and C). After transfection with oe-Klf4 in normoxia or hyperoxia treated MLE-12 cells, and the findings revealed that oe-Klf4 significantly increased Lef1 expression (Figure 3D) and LEF1 level (increased by 47% for normoxia condition and 1.1 times for hyperoxia condition; Figure 3E). It was concluded from these findings that Klf4 binds to Lef1’s promoter region and aids transcription.

Figure 3. Klf4 activates the transcription of Lef1. A. JASPAR (https://jaspar.genereg.net/) was employed to predict probable Klf4 binding sites in the Lef1 promoter; B. The luciferase and C. ChIP assays were used to validate the prediction from JASPAR. D. Lef1 expression was determined by qRT-PCR; E. Western blot assay for LEF1 level after transfection in normoxia or hyperoxia treated MLE-12 cells with oe-Klf4. Data were displayed as mean ± SD (n = 3) and analyzed utilizing t test or one-way ANOVA followed by Tukey’s multiple comparisons test; ***, p < 0.001.

Klf4 impedes hyperoxia-induced AEC damage via stimulating Lef1

To further study the mechanism of Klf4 and Lef1 in BPD, oe-Klf4 and si-Lef1 were co-transfected into hyperoxia-induced MLE-12 cells. After that, CCK-8 and EdU assays were carried out to evaluate cell proliferation. The data documented that oe-Klf4 significantly enhanced cell proliferation that had been suppressed by hyperoxia, whereas si-Lef1 reversed the effect of oe-Klf4 (Figure 4A and B). Flow cytometry assay was applied to evaluate cell apoptosis, and the analysis revealed that oe-Klf4 significantly reduced hyperoxia-induced cell apoptosis whereas si-Lef1 enhanced it (Figure 4C). Finally, western blot analysis was used to determine the expression of Bcl-2, cleaved-caspase 3 and 9, and the findings indicated that oe-Klf4 greatly diminished hyperoxia-induced cleaved-caspase 3 and 9 by 42% and 52%, and increased those of Bcl-2 by 56%, but si-Lef1 exerted absolutely opposite effects on expression levels. (Figure 4D). In a word, Klf4 could impede AEC damage induced by hyperoxia via stimulating Lef1.

Figure 4. Klf4 impedes hyperoxia-induced alveolar epithelial cell damage via stimulating Lef1. A The cell viability was determined using CCK-8 assay after co-transfecting oe-Klf4 and si-Lef1 into hyperoxia-induced MLE-12 cells; B. The cell proliferation was determined using EdU assay; C. Cell apoptosis was investigated by flow cytometry assay; D. The expression of Bcl-2, cleaved-caspase 3 and 9 were determined using western blot. Data were displayed as mean ± SD (n = 3) and analyzed utilizing one-way ANOVA, followed by Tukey’s multiple comparisons test; *, p < 0.05; ***, p < 0.001.

Discussion

BPD stunts children’s development and affects their respiratory, neurological, mobility, and hearing systems. The respiratory system’s influence is mainly seen in infancy and adulthood. Recurrent infections, pulmonary hypertension, and poor lung function are all elevated. Because BPD has such severe consequences, early management for preterm babies with BPD risk factors is critical.² At present, there are many researches on the molecular mechanism of BPD. Liang et al.³¹ reported that Semaphorin 3 A (Sema3a) attenuated hyperoxia-induced apoptosis and inflammation in newborn rats via blocking the extracellular signal-regulated kinase (Erk)/c-Jun N-terminal kinase (Jnk) pathway. Huang et al.³² found that blocking fatty acid-binding protein 4 (Fabp4) reduces hyperoxia-induced lung damage and fibrosis. Research conducted by Zhang et al.³³ reported that miR-214 decreases type II AEC apoptosis and fibrosis through blocking the placental growth factor (PlGF)-dependent signal transducer and activator of transcription 3 (Stat3) pathway. The type II AEC injury, which is regarded to be the pathological foundation of BPD, was the primary subject on which we concentrated in this research.¹

Lef1 is a transcription factor that is known to be involved in canonical Wnt signaling and to regulate cell proliferation during lung development.³⁴ Lef1 is found to be abundantly expressed in the alveolar epithelium and mesenchyme adjacent to the lung epithelium.³⁵ By recruiting to the promoter of vascular endothelial growth factor (Vegf), Lef1 elevates expression of Vegf and promotes epithelial and endothelial cell proliferation.³⁶ Additionally, LEF1 may interact directly with the miR-124 promoter region to influence the maturation of embryonic pulmonary epithelial cells.³⁷ To elucidate the regulatory mechanism underlying BPD, this work focused on LEF1/Lef1 and discovered that LEF1/Lef1 expression was diminished in clinical BPD serum samples and hyperoxia-induced MLE-12 cells. Additionally, we discovered that overexpression of Lef1 might protect AECs from hyperoxia-induced damage.

Numerous researchers have depicted that transcription factors are critical for lung development, such as forkhead box F1 (Foxf1),³⁸ Yes-associated protein (Yap)³⁹ and SRY-related high-mobility group box 9 (SOX9).⁴⁰ As a transcription factor, KLF4 is required for cell differentiation and proliferation in a variety of disorders.⁴¹ Klf4 is identified as the most substantially changed gene in the lung after birth,⁴² and is found in the endothelial cells of the pulmonary arterial and venous of mice.⁴³ The data of this research revealed that KLF4/Klf4 expression was diminished in clinical BPD serum samples and hyperoxia-induced MLE-12 cells. In its function as a transcription factor, KLF4 transcriptionally modulates the expression of insulin receptor (INSR) and diminishes the development of osteoarthritis, according to research of Liu et al..⁴⁴ It may also attach to the C-X-C motif chemokine ligand 8 (CXCL8) promoter, which consequently promotes the proliferation of gastric cancer cells.³⁰ Besides, Wang et al.⁴⁵ revealed that by directly interacting to the tissue inhibitor of metalloproteinase 3 (TIMP3) promoter, KLF4 may stimulate the transcription of the lung tumor suppressor TIMP3. In this research, the data elucidated that Klf4 could bind to Lef1’s promoter region and aid its transcription. Moreover, the results of gain-of-function experiments supported that Klf4 had the potential to protect against AEC damage caused by hyperoxia through stimulating Lef1.

In conclusion, the Klf4-Lef1 axis played a crucial role in hyperoxia-induced AEC injury. KLF4/Klf4 and LEF1/Lef1 expression levels were declined in clinical BPD serum samples and hyperoxia-induced MLE-12 cells, respectively, and overexpression of Lef1 could protect AECs from hyperoxia-induced damage. As a target gene of Klf4, Lef1 could be transcriptionally activated by Klf4. Klf4 overexpression could protect against AEC damage caused by hyperoxia through stimulating Lef1. As a result, Lef1 might become a prospective therapeutic target for BPD.

Ethics statement

This research was authorized by Hunan Children’s Hospital’s institutional review committee (approval number: KYSQ2022-132). All patients were informed of the study and signed the written consent.

Acknowledgements

Thanks to the members of our laboratory for their contributions.

Disclosure statement

No potential conflict of interest was reported by the authors.

Data availability statement

The datasets used or analyzed during the current study are available from the corresponding author on reasonable request.

Additional information

Funding

This work was supported by Youth Fund of Hunan Natural Science Foundation (2019JJ50293) and Hunan Health Commission (B2019012).